| Locus | Gene model | Sequence | Description |
| AT1G04340 | AT1G04340.1 | GTCCGGTTTT | lesion inducing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT5G43460.1); Has 99 Blast hits to 99 proteins in 21 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G04350 | AT1G04350.1 | AAAACCGGAC | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G06650 | AT1G06650.1 | GTCCGGTTA | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G06650.2 | GTCCGGTTA | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G08840 | AT1G08840.1 | TTGAACCGGAC | embryo defective 2411 (emb2411); FUNCTIONS IN: ATP-dependent DNA helicase activity, DNA binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA replication factor Dna2 (InterPro:IPR014808); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G03270.1); Has 4081 Blast hits to 3639 proteins in 571 species: Archae - 158; Bacteria - 979; Metazoa - 1088; Fungi - 747; Plants - 269; Viruses - 30; Other Eukaryotes - 810 (source: NCBI BLink). |
| AT1G08845 | AT1G08845.1 | GTCCGGTTCAA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: endomembrane system, ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G22450.1). |
| AT1G10660 | AT1G10660.1 | GTCCGGTTAT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G10660.2 | GTCCGGTTAT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G10660.3 | GTCCGGTTAT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G10660.4 | GTCCGGTTAT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G11320 | AT1G11320.1 | AAACCGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G11760 | AT1G11760.1 | GTCCGGTTTG | unknown protein; LOCATED IN: cellular_component unknown; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G12770 | AT1G12770.1 | GTCCGGTTTGG | embryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink). |
| AT1G12830 | AT1G12830.1 | GTCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). |
| AT1G12840 | AT1G12840.1 | AAAACCGGAC | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. |
| AT1G13870 | AT1G13870.1 | CAAACCGGAC | Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. |
| AT1G13870.1 | CTAAACCGGAC | Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. |
| AT1G13880 | AT1G13880.1 | GTCCGGTTTAG | ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949); BEST Arabidopsis thaliana protein match is: myb family transcription factor / ELM2 domain-containing protein (TAIR:AT2G03470.2); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G13880.1 | GTCCGGTTTG | ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949); BEST Arabidopsis thaliana protein match is: myb family transcription factor / ELM2 domain-containing protein (TAIR:AT2G03470.2); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G14060 | AT1G14060.1 | GTTCGGTTTGGTCCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: GCK (InterPro:IPR012891); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G02210.1); Has 243 Blast hits to 215 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 93; Fungi - 27; Plants - 49; Viruses - 2; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT1G14230 | AT1G14230.1 | GTAAACCGGTCCGGTTCA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT1G16700 | AT1G16700.1 | GTCCGGTTA | NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). |
| AT1G17430 | AT1G17430.1 | TTTAACCGGAATTAACCGGAC | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G72620.1); Has 3179 Blast hits to 3177 proteins in 659 species: Archae - 36; Bacteria - 2008; Metazoa - 134; Fungi - 8; Plants - 175; Viruses - 0; Other Eukaryotes - 818 (source: NCBI BLink). |
| AT1G17890 | AT1G17890.1 | GTCCGGTTTAA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). |
| AT1G17890.2 | GTCCGGTTTAA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). |
| AT1G17890.3 | GTCCGGTTTAA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). |
| AT1G19910 | AT1G19910.1 | GTCCGGTTCG | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2) |
| AT1G19990 | AT1G19990.1 | GTCCGGTTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). |
| AT1G22960 | AT1G22960.1 | TTGAACCGGTCCGGTTAAG | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink). |
| AT1G24265 | AT1G24265.1 | GTCCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G24265.2 | GTCCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G24706 | AT1G24706.1 | CTTAACCGGACCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink). |
| AT1G29680 | AT1G29680.1 | GTCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1264 (InterPro:IPR010686); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45690.1); Has 188 Blast hits to 188 proteins in 83 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 43; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G30550 | AT1G30550.2 | GTCCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: WW domain-containing protein (TAIR:AT1G45231.2); Has 891 Blast hits to 591 proteins in 275 species: Archae - 68; Bacteria - 248; Metazoa - 211; Fungi - 176; Plants - 45; Viruses - 3; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT1G31800 | AT1G31800.1 | GTCCGGTTTG | Encodes a protein with β-ring carotenoid hydroxylase activity. |
| AT1G33390 | AT1G33390.1 | GTCCGGTTTAG | helicase domain-containing protein; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein (TAIR:AT1G48650.2); Has 11093 Blast hits to 6432 proteins in 948 species: Archae - 0; Bacteria - 3704; Metazoa - 3089; Fungi - 1453; Plants - 542; Viruses - 298; Other Eukaryotes - 2007 (source: NCBI BLink). |
| AT1G53140 | AT1G53140.1 | AACCGGAC | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
| AT1G56290 | AT1G56290.1 | GTCCGGTTTAT | CwfJ-like family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein / zinc finger (CCCH-type) family protein (TAIR:AT5G56900.2); Has 2202 Blast hits to 1747 proteins in 222 species: Archae - 2; Bacteria - 25; Metazoa - 988; Fungi - 216; Plants - 103; Viruses - 2; Other Eukaryotes - 866 (source: NCBI BLink). |
| AT1G68720 | AT1G68720.1 | CAAACCGGACCGGTTTAT | TRNA ARGININE ADENOSINE DEAMINASE (TADA); FUNCTIONS IN: hydrolase activity, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT5G28050.1); Has 19163 Blast hits to 15661 proteins in 1596 species: Archae - 115; Bacteria - 4851; Metazoa - 4895; Fungi - 796; Plants - 406; Viruses - 57; Other Eukaryotes - 8043 (source: NCBI BLink). |
| AT1G70190 | AT1G70190.1 | GTCCGGTT | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G37660.1); Has 5742 Blast hits to 5742 proteins in 1557 species: Archae - 0; Bacteria - 3189; Metazoa - 133; Fungi - 84; Plants - 174; Viruses - 0; Other Eukaryotes - 2162 (source: NCBI BLink). |
| AT1G73530 | AT1G73530.1 | CGAACCGGAC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G54580.1); Has 18350 Blast hits to 14445 proteins in 600 species: Archae - 8; Bacteria - 920; Metazoa - 11039; Fungi - 2030; Plants - 2592; Viruses - 0; Other Eukaryotes - 1761 (source: NCBI BLink). |
| AT1G79690 | AT1G79690.1 | GTCCGGTTTAG | Arabidopsis thaliana Nudix hydrolase homolog 3 (atnudt3); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: IPP1 (ISOPENTENYL DIPHOSPHATE ISOMERASE 1); isopentenyl-diphosphate delta-isomerase (TAIR:AT5G16440.1); Has 1689 Blast hits to 1689 proteins in 505 species: Archae - 17; Bacteria - 1144; Metazoa - 42; Fungi - 50; Plants - 114; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT1G80380 | AT1G80380.1 | CAAACCGGAC | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80380.2 | CAAACCGGAC | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80380.3 | CAAACCGGAC | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80620 | AT1G80620.1 | GAACCGGAC | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G15810.1); Has 5440 Blast hits to 5440 proteins in 1548 species: Archae - 0; Bacteria - 3063; Metazoa - 73; Fungi - 72; Plants - 237; Viruses - 0; Other Eukaryotes - 1995 (source: NCBI BLink). |
| AT2G06010 | AT2G06010.1 | GAACCGGAACCGGAC | encodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3. |
| AT2G06520 | AT2G06520.1 | CGAACCGGAC | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT2G14910 | AT2G14910.1 | TGAACCGGAC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink). |
| AT2G14910.2 | TGAACCGGAC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink). |
| AT2G17880 | AT2G17880.1 | CTTAACCGGAC | DNAJ heat shock protein, putative; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (J11) (TAIR:AT4G36040.1); Has 13518 Blast hits to 13518 proteins in 1859 species: Archae - 87; Bacteria - 4830; Metazoa - 2737; Fungi - 1089; Plants - 967; Viruses - 5; Other Eukaryotes - 3803 (source: NCBI BLink). |
| AT2G18465 | AT2G18465.1 | TTAAACCGGTCCGGTTA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G42080.1); Has 685 Blast hits to 685 proteins in 152 species: Archae - 6; Bacteria - 112; Metazoa - 268; Fungi - 15; Plants - 75; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink). |
| AT2G20550 | AT2G20550.1 | GTCCGGTTTG | DNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT2G20550.2 | GTCCGGTTTG | DNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT2G23080 | AT2G23080.1 | GTCCGGTTAT | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). |
| AT2G23080.2 | GTCCGGTTAT | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). |
| AT2G24310 | AT2G24310.1 | GTAAACCGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1); Has 8723 Blast hits to 1984 proteins in 278 species: Archae - 2; Bacteria - 1534; Metazoa - 1862; Fungi - 1225; Plants - 55; Viruses - 46; Other Eukaryotes - 3999 (source: NCBI BLink). |
| AT2G27900 | AT2G27900.1 | GTCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 244 Blast hits to 190 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G27900.2 | GTCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 244 Blast hits to 190 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G31810 | AT2G31810.1 | AACCGAACCGGAC | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink). |
| AT2G31810.2 | AACCGAACCGGAC | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink). |
| AT2G31810.3 | AACCGAACCGGAC | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink). |
| AT2G32690 | AT2G32690.1 | GTCCGGTTTAA | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32690.2 | GTCCGGTTTAA | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32690.3 | GTCCGGTTTAA | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32690.4 | GTCCGGTTTAA | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32840 | AT2G32840.1 | TTGAACCGGACCCG | proline-rich family protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G04930.1); Has 733 Blast hits to 646 proteins in 145 species: Archae - 4; Bacteria - 102; Metazoa - 178; Fungi - 111; Plants - 168; Viruses - 37; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G32840.2 | TTGAACCGGACCCG | proline-rich family protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G04930.1); Has 733 Blast hits to 646 proteins in 145 species: Archae - 4; Bacteria - 102; Metazoa - 178; Fungi - 111; Plants - 168; Viruses - 37; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G32950 | AT2G32950.1 | TTGAACCGGAC | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. |
| AT2G36485 | AT2G36485.1 | AACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: PCFS4 (PCF11P-SIMILAR PROTEIN 4); zinc ion binding (TAIR:AT4G04885.1); Has 87 Blast hits to 87 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 33; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G44280 | AT2G44280.1 | AAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60070.1); Has 781 Blast hits to 773 proteins in 246 species: Archae - 0; Bacteria - 563; Metazoa - 99; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). |
| AT2G44280.2 | AAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60070.1); Has 781 Blast hits to 773 proteins in 246 species: Archae - 0; Bacteria - 563; Metazoa - 99; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). |
| AT2G47650 | AT2G47650.1 | GTCCGGTTTT | encodes a protein similar to UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT2G47700 | AT2G47700.1 | GTCCGGTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: transcription factor, putative / zinc finger (C3HC4 type RING finger) family protein (TAIR:AT3G05545.1); Has 360 Blast hits to 360 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 172; Fungi - 15; Plants - 110; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT2G48100 | AT2G48100.1 | CGGGTCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT2G48100.2 | CGGGTCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT2G48100.3 | CGGGTCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT2G48100.4 | CGGGTCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G04600 | AT3G04600.1 | ATAAACCGGAC | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink). |
| AT3G04600.2 | ATAAACCGGAC | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink). |
| AT3G04600.3 | ATAAACCGGAC | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink). |
| AT3G08930 | AT3G08930.1 | GTCCGGTTTAC | LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LMBR1-like conserved region (InterPro:IPR006876); BEST Arabidopsis thaliana protein match is: LMBR1 integral membrane family protein (TAIR:AT5G01460.1); Has 250 Blast hits to 249 proteins in 81 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 39; Plants - 31; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT3G11830 | AT3G11830.1 | GTCCGGTTC | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, eta subunit (InterPro:IPR012720), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: ATTCP-1; ATP binding / protein binding / unfolded protein binding (TAIR:AT3G20050.1); Has 14866 Blast hits to 14802 proteins in 2423 species: Archae - 394; Bacteria - 5781; Metazoa - 1895; Fungi - 1006; Plants - 468; Viruses - 0; Other Eukaryotes - 5322 (source: NCBI BLink). |
| AT3G12250 | AT3G12250.1 | AAAACCGGACCGGTT | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT3G12250.2 | AAAACCGGACCGGTT | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT3G12250.4 | AAAACCGGACCGGTT | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT3G17668 | AT3G17668.1 | GTCCGGTTTGG | ENHANCER OF ATNSI ACTIVITY (ENA); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 103 Blast hits to 95 proteins in 30 species: Archae - 2; Bacteria - 13; Metazoa - 34; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G18240 | AT3G18240.1 | CTAAACCGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21460.1); Has 238 Blast hits to 222 proteins in 74 species: Archae - 0; Bacteria - 50; Metazoa - 50; Fungi - 25; Plants - 30; Viruses - 2; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT3G18240.2 | CTAAACCGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21460.1); Has 238 Blast hits to 222 proteins in 74 species: Archae - 0; Bacteria - 50; Metazoa - 50; Fungi - 25; Plants - 30; Viruses - 2; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT3G23325 | AT3G23325.1 | GTCCGGTTC | splicing factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor 3B subunit 5/RDS3 complex subunit 10 (InterPro:IPR009846), Splicing factor 3B, subunit 5 (InterPro:IPR017089); BEST Arabidopsis thaliana protein match is: pre-mRNA splicing factor 10 kDa subunit, putative (TAIR:AT4G14342.1); Has 220 Blast hits to 220 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 61; Plants - 31; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT3G24315 | AT3G24315.1 | ATAAACCGGAC | AtSec20; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sec20 (InterPro:IPR005606); Has 205 Blast hits to 205 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 64; Plants - 27; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G28040 | AT3G28040.1 | CTAAACCGGAC | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT3G56370.1); Has 154227 Blast hits to 98331 proteins in 3092 species: Archae - 92; Bacteria - 12457; Metazoa - 64370; Fungi - 7122; Plants - 50297; Viruses - 226; Other Eukaryotes - 19663 (source: NCBI BLink). |
| AT3G29185 | AT3G29185.1 | GTCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G29185.2 | GTCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G44340 | AT3G44340.1 | GAACCGGAC | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
| AT3G44340.1 | GTCCGGTTC | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
| AT3G44340.2 | GAACCGGAC | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
| AT3G44340.2 | GTCCGGTTC | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
| AT3G46100 | AT3G46100.1 | TTTAACCGGAC | histidyl-tRNA synthetase |
| AT3G47340 | AT3G47340.1 | AAACCGGAC | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G47340.2 | AAACCGGAC | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G47340.3 | AAACCGGAC | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G51440 | AT3G51440.1 | GTCCGGTTA | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). |
| AT3G61060 | AT3G61060.1 | ATAAACCGGAC | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G61060.2 | ATAAACCGGAC | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00320 | AT4G00320.1 | CCGAACCGGAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein-related (TAIR:AT5G41830.1); Has 1116 Blast hits to 1083 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1116; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00320.1 | GAACCGGAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein-related (TAIR:AT5G41830.1); Has 1116 Blast hits to 1083 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1116; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02730 | AT4G02730.1 | CGAACCGGAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 78608 Blast hits to 31153 proteins in 723 species: Archae - 58; Bacteria - 7156; Metazoa - 36882; Fungi - 14702; Plants - 7512; Viruses - 12; Other Eukaryotes - 12286 (source: NCBI BLink). |
| AT4G03260 | AT4G03260.1 | GTCCGGTTTAG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). |
| AT4G03260.2 | GTCCGGTTTAG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). |
| AT4G05410 | AT4G05410.1 | GTCCGGTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink). |
| AT4G05420 | AT4G05420.1 | ACCGAACCGGAC | Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. |
| AT4G05420.2 | ACCGAACCGGAC | Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. |
| AT4G07410 | AT4G07410.1 | CGACCCGGAACCGGAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink). |
| AT4G07410.2 | CGACCCGGAACCGGAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink). |
| AT4G09620 | AT4G09620.1 | GTCCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); Has 120 Blast hits to 97 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT4G10470 | AT4G10470.1 | GTCCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33050.2); Has 23 Blast hits to 11 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14385 | AT4G14385.1 | CAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.1 | GAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.2 | CAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.2 | GAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.3 | CAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.3 | GAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14880 | AT4G14880.1 | TTAACCGGAC | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. |
| AT4G14880.2 | TTAACCGGAC | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. |
| AT4G14950 | AT4G14950.1 | GTCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G14950.2 | GTCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G14950.3 | GTCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G18593 | AT4G18593.1 | GTCCGGTTAAACCGG | dual specificity protein phosphatase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 272 Blast hits to 272 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 76; Plants - 42; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). |
| AT4G19390 | AT4G19390.1 | ATAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022348 (InterPro:IPR016804), Uncharacterised protein family UPF0114 (InterPro:IPR005134); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13720.1); Has 553 Blast hits to 553 proteins in 219 species: Archae - 18; Bacteria - 407; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT4G23800 | AT4G23800.1 | GTCCGGTT | high mobility group (HMG1/2) family protein; FUNCTIONS IN: transcription factor activity; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: high mobility group (HMG1/2) family protein (TAIR:AT4G11080.1); Has 62445 Blast hits to 32833 proteins in 1549 species: Archae - 256; Bacteria - 4440; Metazoa - 33253; Fungi - 3596; Plants - 1795; Viruses - 218; Other Eukaryotes - 18887 (source: NCBI BLink). |
| AT4G25740 | AT4G25740.1 | TAACCGGAC | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G25740.2 | TAACCGGAC | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G26630 | AT4G26630.1 | TGGTTCGGAACCGGAC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). |
| AT4G26630.2 | TGGTTCGGAACCGGAC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). |
| AT4G27300 | AT4G27300.1 | ATAAACCGGAC | S-locus protein kinase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase/ sugar binding (TAIR:AT4G27290.1); Has 88253 Blast hits to 86828 proteins in 3228 species: Archae - 49; Bacteria - 7736; Metazoa - 38596; Fungi - 6866; Plants - 19489; Viruses - 390; Other Eukaryotes - 15127 (source: NCBI BLink). |
| AT4G31460 | AT4G31460.1 | GTCCGGTTTAA | ribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink). |
| AT4G32460 | AT4G32460.1 | AAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11420.1); Has 182 Blast hits to 158 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G32460.2 | AAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11420.1); Has 182 Blast hits to 158 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G33460 | AT4G33460.1 | AAAACCGGAC | member of NAP subfamily |
| AT4G34430 | AT4G34430.1 | TTAAACCGGAC | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.2 | TTAAACCGGAC | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.3 | TTAAACCGGAC | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.4 | TTAAACCGGAC | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G35160 | AT4G35160.1 | GTCCGGTTCA | O-methyltransferase family 2 protein; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 2 protein (TAIR:AT4G35150.1); Has 2083 Blast hits to 2078 proteins in 411 species: Archae - 0; Bacteria - 596; Metazoa - 87; Fungi - 457; Plants - 875; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT4G38940 | AT4G38940.1 | ATAAACCGGAC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G10510.1); Has 722 Blast hits to 701 proteins in 54 species: Archae - 4; Bacteria - 27; Metazoa - 128; Fungi - 0; Plants - 558; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G04500 | AT5G04500.1 | TTAAACCGGAC | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT5G04910 | AT5G04910.1 | AACCGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G05000 | AT5G05000.1 | TTCGGTTTAGTCCGGTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast. |
| AT5G05000.2 | TTCGGTTTAGTCCGGTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast. |
| AT5G05000.3 | TTCGGTTTAGTCCGGTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast. |
| AT5G05010 | AT5G05010.1 | AACCGGACTAAACCGAA | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT5G05010.2 | AACCGGACTAAACCGAA | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT5G09760 | AT5G09760.1 | CTTAACCGGAC | pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, chloroplast, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G64640.1); Has 1447 Blast hits to 1415 proteins in 271 species: Archae - 0; Bacteria - 416; Metazoa - 1; Fungi - 117; Plants - 911; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G10070 | AT5G10070.1 | GTCCGGTTTT | RNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT5G10070.2 | GTCCGGTTTT | RNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT5G10200 | AT5G10200.1 | ACCGAACCGGACTTAAACCGGAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT5G43120.1); Has 1566 Blast hits to 1469 proteins in 175 species: Archae - 0; Bacteria - 3; Metazoa - 907; Fungi - 260; Plants - 202; Viruses - 4; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT5G10270 | AT5G10270.1 | GACCGGTTCAAACCGGAC | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G12110 | AT5G12110.1 | GTAAACCGGAC | elongation factor 1B alpha-subunit 1 (eEF1Balpha1); FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: eukaryotic translation elongation factor 1 complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1B alpha-subunit 2 (eEF1Balpha2) (TAIR:AT5G19510.1); Has 715 Blast hits to 715 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 374; Fungi - 104; Plants - 110; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT5G13340 | AT5G13340.1 | GTCCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10890.1); Has 84499 Blast hits to 39808 proteins in 1650 species: Archae - 415; Bacteria - 7950; Metazoa - 42451; Fungi - 5813; Plants - 2221; Viruses - 437; Other Eukaryotes - 25212 (source: NCBI BLink). |
| AT5G13350 | AT5G13350.1 | TTAACCGGAC | auxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: auxin-responsive GH3 family protein (TAIR:AT5G13370.1); Has 800 Blast hits to 739 proteins in 112 species: Archae - 0; Bacteria - 240; Metazoa - 51; Fungi - 2; Plants - 218; Viruses - 0; Other Eukaryotes - 289 (source: NCBI BLink). |
| AT5G14590 | AT5G14590.1 | AACCGGAC | isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative (TAIR:AT1G65930.1); Has 4142 Blast hits to 4125 proteins in 584 species: Archae - 19; Bacteria - 563; Metazoa - 433; Fungi - 160; Plants - 265; Viruses - 0; Other Eukaryotes - 2702 (source: NCBI BLink). |
| AT5G14600 | AT5G14600.1 | GTCCGGTT | tRNA (adenine-N1-)-methyltransferase; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 1145 Blast hits to 1142 proteins in 382 species: Archae - 132; Bacteria - 313; Metazoa - 135; Fungi - 115; Plants - 30; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). |
| AT5G15920 | AT5G15920.1 | ATAACCGGAC | structural maintenance of chromosomes (SMC) family protein (MSS2); FUNCTIONS IN: ATP binding; INVOLVED IN: chromosome segregation; LOCATED IN: chromosome, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); BEST Arabidopsis thaliana protein match is: MIM (hypersensitive to MMS, irradiation and MMC); ATP binding (TAIR:AT5G61460.1); Has 53696 Blast hits to 28151 proteins in 1680 species: Archae - 715; Bacteria - 7485; Metazoa - 25639; Fungi - 3625; Plants - 1389; Viruses - 117; Other Eukaryotes - 14726 (source: NCBI BLink). |
| AT5G16290 | AT5G16290.1 | GTCCGGTTAT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink). |
| AT5G16290.2 | GTCCGGTTAT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink). |
| AT5G16300 | AT5G16300.1 | TAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G16300.1 | TTTAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G16300.2 | TAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G16300.2 | TTTAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G16300.3 | TAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G16300.3 | TTTAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G16830 | AT5G16830.1 | GTCCGGTTTAC | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT5G17400 | AT5G17400.1 | GTCCGGTTTT | This gene is predicted to encode an ER-localized adenine nucleotide transporter with six putative transmembrane helices. It appears to act as a ATP:ADP antiporter when expressed in E.coli plasma membranes. Transcript levels for several ER-localized chaperones (e.g. BIP1/2) and other ATP-requiring ER proteins (e.g. CPK2) are reduced in er-ant1 knock-out lines, suggesting a lack of adequate ATP transport into the ER in these mutants. They also have reduced seed oil and seed protein levels. |
| AT5G17410 | AT5G17410.1 | AAAACCGGAC | tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT5G17410.2 | AAAACCGGAC | tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT5G17840 | AT5G17840.1 | CCGGTATAGTCCGGTTAT | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G18810 | AT5G18810.1 | GAACCGGAC | encodes an SC35-like splicing factor of 28 kD localized to the nuclear specks. |
| AT5G37850 | AT5G37850.2 | CGGGTCCGGTTTAC | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
| AT5G39590 | AT5G39590.1 | GTCCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571); Has 144 Blast hits to 144 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 9; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT5G43190 | AT5G43190.1 | GTCCGGTTTAT | F-box family protein (FBX6); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 2 (InterPro:IPR011498), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G15710.1); Has 336 Blast hits to 336 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 332; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G44610 | AT5G44610.1 | TGAACCGGAC | Encodes a protein of unknown function with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. |
| AT5G45900 | AT5G45900.1 | GTCCGGTTAA | Component of autophagy conjugation pathway. Required for proper senescence. |
| AT5G50020 | AT5G50020.1 | AAACCGGAC | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: receptor/ zinc ion binding (TAIR:AT4G24630.1); Has 3792 Blast hits to 3785 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1903; Fungi - 491; Plants - 389; Viruses - 0; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT5G50020.1 | GTCCGGTTTT | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: receptor/ zinc ion binding (TAIR:AT4G24630.1); Has 3792 Blast hits to 3785 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1903; Fungi - 491; Plants - 389; Viruses - 0; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT5G50810 | AT5G50810.1 | GTCCGGTTTT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT5G53450 | AT5G53450.1 | GTCCGGTTTAG | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G53450.2 | GTCCGGTTTAG | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G55330 | AT5G55330.1 | GTCCGGTT | membrane bound O-acyl transferase (MBOAT) family protein / wax synthase-related; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Wax synthase (InterPro:IPR017088), Membrane bound O-acyl transferase, MBOAT (InterPro:IPR004299); BEST Arabidopsis thaliana protein match is: long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein (TAIR:AT5G55340.1); Has 529 Blast hits to 527 proteins in 187 species: Archae - 0; Bacteria - 348; Metazoa - 0; Fungi - 14; Plants - 113; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT5G56100 | AT5G56100.1 | GTCCGGTTCAA | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G60170 | AT5G60170.1 | AAACCGAACCGGAC | RNA binding / nucleic acid binding / nucleotide binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition, region 1 (InterPro:IPR003954); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G45630.1); Has 1060 Blast hits to 628 proteins in 173 species: Archae - 0; Bacteria - 202; Metazoa - 240; Fungi - 159; Plants - 78; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink). |
| AT5G60750 | AT5G60750.1 | GTCCGGTTAAG | CAAX amino terminal protease family protein; FUNCTIONS IN: endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT1G14270.1); Has 2314 Blast hits to 2314 proteins in 559 species: Archae - 36; Bacteria - 1888; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 319 (source: NCBI BLink). |
| AT5G63910 | AT5G63910.1 | AAAACCGGAC | encodes for a farnesylcysteine lyase (EC 1.8.3.5 - prenylcysteine oxidase) involved in a salvage pathway of farnesyl diphosphate. |
| AT5G66400 | AT5G66400.1 | AAACCGGAC | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. ABA- and drought-induced glycine-rice dehydrin protein. The ABA-induced expression of RAB18 was reduced following ACC application, indicating that ethylene inhibits the ABA signaling pathway. RAB18 is also expressed in response to the formation of the phospholipid diacylglycerol pyrophosphate. COR47 and RAB18 double overexpressor plants are cold tolerant. Expressed in guard cells. |
| AT5G66400.2 | AAACCGGAC | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. ABA- and drought-induced glycine-rice dehydrin protein. The ABA-induced expression of RAB18 was reduced following ACC application, indicating that ethylene inhibits the ABA signaling pathway. RAB18 is also expressed in response to the formation of the phospholipid diacylglycerol pyrophosphate. COR47 and RAB18 double overexpressor plants are cold tolerant. Expressed in guard cells. |