| Locus | Gene model | Sequence | Description |
| AT1G01710 | AT1G01710.1 | CGAACCGAGTCCACGT | acyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink). |
| AT1G03475 | AT1G03475.1 | TCGGTTCG | Encodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection. |
| AT1G06790 | AT1G06790.1 | GTTCGGTTCGGTTTAT | RNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G06790.2 | GTTCGGTTCGGTTTAT | RNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G08640 | AT1G08640.1 | CGAACCGA | unknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G08720 | AT1G08720.1 | AGTCGGTTCGG | enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum |
| AT1G11200 | AT1G11200.1 | TCGGTTCG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21570.1); Has 593 Blast hits to 589 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 256; Fungi - 128; Plants - 126; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT1G11320 | AT1G11320.1 | CGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G17490 | AT1G17490.1 | AGTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72690.1); Has 29 Blast hits to 23 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G18450 | AT1G18450.1 | GTTCGGTTCGGTT | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
| AT1G21930 | AT1G21930.1 | TCGGTTCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G42150.3); Has 24 Blast hits to 24 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G24265 | AT1G24265.1 | TCGGTTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G24265.2 | TCGGTTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G24450 | AT1G24450.1 | CGAACCGAACCA | NUCLEAR FUSION DEFECTIVE 2 (NFD2); FUNCTIONS IN: RNA binding, ribonuclease III activity; INVOLVED IN: RNA processing; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease III (InterPro:IPR000999); Has 1405 Blast hits to 1405 proteins in 451 species: Archae - 3; Bacteria - 885; Metazoa - 2; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 508 (source: NCBI BLink). |
| AT1G25350 | AT1G25350.1 | TGGTTCGGTTCG | ovule abortion 9 (OVA9); FUNCTIONS IN: glutamine-tRNA ligase activity; INVOLVED IN: glutamyl-tRNA aminoacylation, translation, ovule development; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Glutamyl/glutaminyl-tRNA synthetase, class Ic (InterPro:IPR000924), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 1 (InterPro:IPR007639), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 2 (InterPro:IPR007638), Glutaminyl-tRNA synthetase, class Ic (InterPro:IPR004514); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (E and Q) family protein (TAIR:AT5G19720.1); Has 8783 Blast hits to 8778 proteins in 1656 species: Archae - 170; Bacteria - 4659; Metazoa - 349; Fungi - 257; Plants - 97; Viruses - 0; Other Eukaryotes - 3251 (source: NCBI BLink). |
| AT1G26530 | AT1G26530.1 | TGGTTCGGTTCGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT1G28320 | AT1G28320.1 | AACCGAACCGAACC | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
| AT1G30510 | AT1G30510.1 | TCGGTTCGGTT | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30510.2 | TCGGTTCGGTT | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30510.3 | TCGGTTCGGTT | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G45474 | AT1G45474.1 | AACCGAACCGA | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G45474.2 | AACCGAACCGA | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G50500 | AT1G50500.1 | TCGGTTCGG | encodes a member of VPS53 family protein involved in the retrograde trafficking of vesicles to the late Golgi. Mutants in this gene are more sensitive to heat and osmotic stress. |
| AT1G52340 | AT1G52340.1 | TCGGTTCG | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT1G54690 | AT1G54690.1 | AAACCGAACCGA | Encodes HTA3, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT1G61450 | AT1G61450.1 | AGTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61415.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G66070 | AT1G66070.1 | TCGGTTCG | translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor eIF3 subunit (InterPro:IPR013906); BEST Arabidopsis thaliana protein match is: translation initiation factor-related (TAIR:AT5G37475.1); Has 336 Blast hits to 334 proteins in 124 species: Archae - 2; Bacteria - 9; Metazoa - 148; Fungi - 90; Plants - 45; Viruses - 1; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G66070.1 | TCGGTTCG | translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor eIF3 subunit (InterPro:IPR013906); BEST Arabidopsis thaliana protein match is: translation initiation factor-related (TAIR:AT5G37475.1); Has 336 Blast hits to 334 proteins in 124 species: Archae - 2; Bacteria - 9; Metazoa - 148; Fungi - 90; Plants - 45; Viruses - 1; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G67790 | AT1G67790.1 | TCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf apex, hypocotyl, flower; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 98 Blast hits to 57 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G67960 | AT1G67960.1 | CTAAACCGAACCGAACCGACT | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT1G68110 | AT1G68110.1 | TCGGTTCGGTTT | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G73980 | AT1G73980.1 | TCGGTTCGGT | phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink). |
| AT1G73990 | AT1G73990.1 | ACCGAACCGA | Encodes a putative protease SppA (SppA). |
| AT1G74030 | AT1G74030.1 | CCGAACCGAACCGAACCA | enolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: in 12 processes; LOCATED IN: phosphopyruvate hydratase complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9513 Blast hits to 9495 proteins in 2259 species: Archae - 189; Bacteria - 3126; Metazoa - 1415; Fungi - 220; Plants - 154; Viruses - 0; Other Eukaryotes - 4409 (source: NCBI BLink). |
| AT1G74040 | AT1G74040.1 | TGGTTCGGTTCGGTTCG | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
| AT1G77122 | AT1G77122.1 | GAACCGGAACCGAACCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0090 (InterPro:IPR003728); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69210.1); Has 5575 Blast hits to 1500 proteins in 157 species: Archae - 0; Bacteria - 130; Metazoa - 4006; Fungi - 245; Plants - 178; Viruses - 112; Other Eukaryotes - 904 (source: NCBI BLink). |
| AT1G80670 | AT1G80670.1 | ACCCGACCCGAACCGA | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G01735 | AT2G01735.1 | CGAACCGA | encodes a RING-H2 zinc finger protein essential for seed development. |
| AT2G04360 | AT2G04360.1 | CCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 84 Blast hits to 84 proteins in 36 species: Archae - 0; Bacteria - 60; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT2G04630 | AT2G04630.1 | CCGAACCGAACCCGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
| AT2G04700 | AT2G04700.1 | CGAACCGA | ferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT2G04842 | AT2G04842.1 | CCGAACCGAAC | Encodes a dual localized threonyl-tRNA synthetase found both in the mitochondrion and the chloroplast. Plants mutated in this gene terminate as embryos in the globular stage. |
| AT2G05220 | AT2G05220.1 | TCGGTTCGGGTCAGTTCGGTT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05220.2 | TCGGTTCGGGTCAGTTCGGTT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05620 | AT2G05620.1 | CCAAACCGAACCGA | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT2G06520 | AT2G06520.1 | CGAACCGA | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT2G14460 | AT2G14460.1 | TCGGTTCGGGTCGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G16930 | AT2G16930.1 | AAACCGAACCGAACC | ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT2G16930.2 | AAACCGAACCGAACC | ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT2G16930.3 | AAACCGAACCGAACC | ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT2G18390 | AT2G18390.1 | TCGGTTCGGT | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development. |
| AT2G18390.1 | TCGGTTCGGT | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development. |
| AT2G18940 | AT2G18940.1 | TCGGTTCGGTTCGGTTTAG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G02860.1); Has 28771 Blast hits to 6230 proteins in 192 species: Archae - 4; Bacteria - 37; Metazoa - 1100; Fungi - 676; Plants - 25361; Viruses - 0; Other Eukaryotes - 1593 (source: NCBI BLink). |
| AT2G21960 | AT2G21960.1 | TCGGTTCGGTTCG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56180.1); Has 140 Blast hits to 140 proteins in 40 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT2G23080 | AT2G23080.1 | TCGGTTCG | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). |
| AT2G23080.1 | TCGGTTCG | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). |
| AT2G23080.2 | TCGGTTCG | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). |
| AT2G23080.2 | TCGGTTCG | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). |
| AT2G26910 | AT2G26910.1 | TCGGTTCGGT | PLEIOTROPIC DRUG RESISTANCE 4 (PDR4); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), Plant PDR ABC transporter associated (InterPro:IPR013581), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PDR12 (PLEIOTROPIC DRUG RESISTANCE 12); ATPase, coupled to transmembrane movement of substances (TAIR:AT1G15520.1); Has 227772 Blast hits to 156896 proteins in 2502 species: Archae - 4872; Bacteria - 164954; Metazoa - 8485; Fungi - 4883; Plants - 3129; Viruses - 4; Other Eukaryotes - 41445 (source: NCBI BLink). |
| AT2G27260 | AT2G27260.1 | TCGGTTCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); Has 584 Blast hits to 584 proteins in 25 species: Archae - 2; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 578; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G31410 | AT2G31410.1 | TTTCCGGTTCGGTTCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1826 Blast hits to 1084 proteins in 146 species: Archae - 5; Bacteria - 17; Metazoa - 730; Fungi - 159; Plants - 161; Viruses - 1; Other Eukaryotes - 753 (source: NCBI BLink). |
| AT2G38646 | AT2G38646.1 | CCGAACCGA | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT2G39650 | AT2G39650.1 | TCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 215 Blast hits to 215 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 213; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G39795 | AT2G39795.1 | CGAACCGAACCGG | mitochondrial glycoprotein family protein / MAM33 family protein; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 256 Blast hits to 256 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 81; Plants - 117; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT2G40290 | AT2G40290.1 | TCGGTTCGGT | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40290.2 | TCGGTTCGGT | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40290.3 | TCGGTTCGGT | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40800 | AT2G40800.1 | CGAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42310 | AT2G42310.1 | TCGGTTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57785.1); Has 77 Blast hits to 77 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 32; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46650 | AT2G46650.1 | TCGGTTCG | member of Cytochromes b5 |
| AT3G02480 | AT3G02480.1 | CGAACCGA | ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06080 | AT3G06080.1 | CGAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19160.1); Has 709 Blast hits to 698 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 709; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06080.2 | CGAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19160.1); Has 709 Blast hits to 698 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 709; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06610 | AT3G06610.1 | TCGGTTCGGTT | DNA-binding enhancer protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G06670 | AT3G06670.1 | CGAACCGACT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT3G07170 | AT3G07170.1 | CGAACCGA | sterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G09440 | AT3G09440.1 | CGAACCGAAC | heat shock cognate 70 kDa protein 3 (HSC70-3) (HSP70-3); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24859 Blast hits to 24560 proteins in 3087 species: Archae - 103; Bacteria - 9593; Metazoa - 3143; Fungi - 1202; Plants - 719; Viruses - 241; Other Eukaryotes - 9858 (source: NCBI BLink). |
| AT3G10850 | AT3G10850.1 | TCGGTTCGATCCGGTTTG | glyoxalase II cytoplasmic isozyme (Glx2-2) mRNA, complete |
| AT3G10860 | AT3G10860.1 | CAAACCGGATCGAACCGA | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT5G05370.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11320 | AT3G11320.1 | CCAAACCGAACCGA | organic anion transmembrane transporter; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G05820.1); Has 2042 Blast hits to 2037 proteins in 214 species: Archae - 8; Bacteria - 61; Metazoa - 646; Fungi - 307; Plants - 755; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT3G11710 | AT3G11710.1 | CAAACCGGTTCGGTTCG | ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). |
| AT3G12550 | AT3G12550.1 | CTAAACCGAACCGA | XH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G48670.2); Has 23408 Blast hits to 15451 proteins in 943 species: Archae - 218; Bacteria - 2032; Metazoa - 11697; Fungi - 1231; Plants - 587; Viruses - 80; Other Eukaryotes - 7563 (source: NCBI BLink). |
| AT3G15090 | AT3G15090.1 | TCGGTTCGGTTTGG | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). |
| AT3G20440 | AT3G20440.1 | TCGGTTCGG | EMBRYO DEFECTIVE 2729 (EMB2729); FUNCTIONS IN: cation binding, catalytic activity, alpha-amylase activity; INVOLVED IN: embryonic development ending in seed dormancy, carbohydrate metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl hydrolase, family 13, subfamily, catalytic region (InterPro:IPR006589), Glycosyl hydrolase, family 13, all-beta (InterPro:IPR013780), Immunoglobulin E-set (InterPro:IPR014756), Alpha-amylase, C-terminal all beta (InterPro:IPR006048), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic region (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: SBE2.1 (starch branching enzyme 2.1); 1,4-alpha-glucan branching enzyme (TAIR:AT2G36390.1). |
| AT3G20440.2 | TCGGTTCGG | EMBRYO DEFECTIVE 2729 (EMB2729); FUNCTIONS IN: cation binding, catalytic activity, alpha-amylase activity; INVOLVED IN: embryonic development ending in seed dormancy, carbohydrate metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl hydrolase, family 13, subfamily, catalytic region (InterPro:IPR006589), Glycosyl hydrolase, family 13, all-beta (InterPro:IPR013780), Immunoglobulin E-set (InterPro:IPR014756), Alpha-amylase, C-terminal all beta (InterPro:IPR006048), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic region (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: SBE2.1 (starch branching enzyme 2.1); 1,4-alpha-glucan branching enzyme (TAIR:AT2G36390.1). |
| AT3G21620 | AT3G21620.1 | TCGGTTCG | early-responsive to dehydration protein-related / ERD protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G15430.2); Has 985 Blast hits to 872 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 168; Fungi - 458; Plants - 260; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). |
| AT3G22220 | AT3G22220.1 | ACCGAACCGA | hAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: DNA binding / protein dimerization (TAIR:AT4G15020.2); Has 496 Blast hits to 443 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 490; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G22220.2 | ACCGAACCGA | hAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: DNA binding / protein dimerization (TAIR:AT4G15020.2); Has 496 Blast hits to 443 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 490; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G22425 | AT3G22425.1 | ACCGGTTCGGTTCGGTT | Encodes imidazoleglycerolphosphate dehydratase. |
| AT3G22425.2 | ACCGGTTCGGTTCGGTT | Encodes imidazoleglycerolphosphate dehydratase. |
| AT3G22680 | AT3G22680.1 | CCGGGTCGGGTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1950 (InterPro:IPR015270); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G23255 | AT3G23255.1 | AACCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G23255.1 | ACCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G24080 | AT3G24080.1 | CGAACCGA | KRR1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: KRR1 interacting protein 1, subgroup (InterPro:IPR007851), KRR1 interacting protein 1 (InterPro:IPR018034); Has 54369 Blast hits to 29065 proteins in 1119 species: Archae - 151; Bacteria - 2845; Metazoa - 25262; Fungi - 5868; Plants - 1850; Viruses - 350; Other Eukaryotes - 18043 (source: NCBI BLink). |
| AT3G24080.2 | CGAACCGA | KRR1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: KRR1 interacting protein 1, subgroup (InterPro:IPR007851), KRR1 interacting protein 1 (InterPro:IPR018034); Has 54369 Blast hits to 29065 proteins in 1119 species: Archae - 151; Bacteria - 2845; Metazoa - 25262; Fungi - 5868; Plants - 1850; Viruses - 350; Other Eukaryotes - 18043 (source: NCBI BLink). |
| AT3G24500 | AT3G24500.1 | AACCGAACCGA | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT3G42950 | AT3G42950.1 | TCGGTTCG | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT1G19170.1); Has 2496 Blast hits to 2489 proteins in 316 species: Archae - 2; Bacteria - 615; Metazoa - 8; Fungi - 925; Plants - 839; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G42950.1 | TCGGTTCGGTTT | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT1G19170.1); Has 2496 Blast hits to 2489 proteins in 316 species: Archae - 2; Bacteria - 615; Metazoa - 8; Fungi - 925; Plants - 839; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G47120 | AT3G47120.1 | AAACCGAACCGA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). |
| AT3G47120.1 | AACCGAACCGACCCGAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). |
| AT3G47670 | AT3G47670.1 | CCGAACCGA | enzyme inhibitor/ pectinesterase/ pectinesterase inhibitor; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: ATPME1; pectinesterase (TAIR:AT1G53840.1); Has 480 Blast hits to 475 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 480; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G50690 | AT3G50690.1 | AACCCGACCCGAACCGA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink). |
| AT3G52200 | AT3G52200.1 | TCGGTTCG | dihydrolipoamide S-acetyltransferase (LTA3) mRNA, nuclear |
| AT3G53110 | AT3G53110.1 | CGAACCGA | Encodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA. |
| AT3G56750 | AT3G56750.1 | TCGGTTCGGTTTAATTAAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 71 Blast hits to 71 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G59800 | AT3G59800.1 | TCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G43795.2); Has 15087 Blast hits to 7528 proteins in 371 species: Archae - 2; Bacteria - 376; Metazoa - 7762; Fungi - 1206; Plants - 781; Viruses - 48; Other Eukaryotes - 4912 (source: NCBI BLink). |
| AT3G59810 | AT3G59810.1 | CGAACCGA | small nuclear ribonucleoprotein F, putative / U6 snRNA-associated Sm-like protein, putative / Sm protein F, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein F, putative / U6 snRNA-associated Sm-like protein, putative / Sm protein F, putative (TAIR:AT2G43810.2); Has 852 Blast hits to 852 proteins in 207 species: Archae - 243; Bacteria - 0; Metazoa - 218; Fungi - 185; Plants - 74; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT3G60900 | AT3G60900.1 | CGGTTCGGTTCGGTT | FLA10; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA8 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8) (TAIR:AT2G45470.1); Has 12081 Blast hits to 6122 proteins in 671 species: Archae - 102; Bacteria - 3569; Metazoa - 1134; Fungi - 757; Plants - 1832; Viruses - 697; Other Eukaryotes - 3990 (source: NCBI BLink). |
| AT3G61360 | AT3G61360.1 | TCGGTTCGGTTCG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02420.1); Has 11229 Blast hits to 4504 proteins in 162 species: Archae - 1; Bacteria - 22; Metazoa - 203; Fungi - 245; Plants - 10371; Viruses - 0; Other Eukaryotes - 387 (source: NCBI BLink). |
| AT4G00355 | AT4G00355.1 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.2 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.3 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.4 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00740 | AT4G00740.1 | AAACCGAACCGAACCGAAC | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 538 Blast hits to 531 proteins in 57 species: Archae - 2; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 461; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G01550 | AT4G01550.1 | TCGGTTCG | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G01550.2 | TCGGTTCG | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02730 | AT4G02730.1 | CGAACCGAACCGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 78608 Blast hits to 31153 proteins in 723 species: Archae - 58; Bacteria - 7156; Metazoa - 36882; Fungi - 14702; Plants - 7512; Viruses - 12; Other Eukaryotes - 12286 (source: NCBI BLink). |
| AT4G03410 | AT4G03410.1 | TCGGTTCGG | peroxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G03410.2 | TCGGTTCGG | peroxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G04630 | AT4G04630.1 | TCGGTTCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 212 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G05460 | AT4G05460.1 | TCGGTTCG | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G05460.1 | TCGGTTCGGTTTAT | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G08310 | AT4G08310.1 | CGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink). |
| AT4G08310.1 | CGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink). |
| AT4G08580 | AT4G08580.1 | CGAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17900.1); Has 39042 Blast hits to 22601 proteins in 1140 species: Archae - 179; Bacteria - 2955; Metazoa - 18595; Fungi - 3264; Plants - 1100; Viruses - 245; Other Eukaryotes - 12704 (source: NCBI BLink). |
| AT4G09340 | AT4G09340.1 | AAACCGAACCGA | SPla/RYanodine receptor (SPRY) domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT1G35470.2); Has 922 Blast hits to 864 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 443; Fungi - 205; Plants - 109; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT4G09720 | AT4G09720.1 | AAACCGAACCGA | ATRABG3A; FUNCTIONS IN: protein binding, GTP binding, GTPase activity; INVOLVED IN: intracellular protein transport, signal transduction, nucleocytoplasmic transport, protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran GTPase (InterPro:IPR002041), Ras (InterPro:IPR013753), Ras small GTPase, Ras type (InterPro:IPR003577), Ras small GTPase, Rho type (InterPro:IPR003578), Small GTP-binding protein (InterPro:IPR005225), Ras GTPase (InterPro:IPR001806), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3B; GTP binding (TAIR:AT1G22740.1). |
| AT4G09720.2 | AAACCGAACCGA | ATRABG3A; FUNCTIONS IN: protein binding, GTP binding, GTPase activity; INVOLVED IN: intracellular protein transport, signal transduction, nucleocytoplasmic transport, protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran GTPase (InterPro:IPR002041), Ras (InterPro:IPR013753), Ras small GTPase, Ras type (InterPro:IPR003577), Ras small GTPase, Rho type (InterPro:IPR003578), Small GTP-binding protein (InterPro:IPR005225), Ras GTPase (InterPro:IPR001806), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3B; GTP binding (TAIR:AT1G22740.1). |
| AT4G09720.3 | AAACCGAACCGA | ATRABG3A; FUNCTIONS IN: protein binding, GTP binding, GTPase activity; INVOLVED IN: intracellular protein transport, signal transduction, nucleocytoplasmic transport, protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran GTPase (InterPro:IPR002041), Ras (InterPro:IPR013753), Ras small GTPase, Ras type (InterPro:IPR003577), Ras small GTPase, Rho type (InterPro:IPR003578), Small GTP-binding protein (InterPro:IPR005225), Ras GTPase (InterPro:IPR001806), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3B; GTP binding (TAIR:AT1G22740.1). |
| AT4G10180 | AT4G10180.1 | CCGAACCGA | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. |
| AT4G11380 | AT4G11380.1 | TGGTTCGGTTCGGTT | beta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). |
| AT4G15830 | AT4G15830.1 | GTAAACCGAACCGA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT4G15840 | AT4G15840.1 | TCGGTTCGGTTTAC | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT4G16630 | AT4G16630.1 | TCGGTTCGGTTT | DEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink). |
| AT4G25130 | AT4G25130.1 | CGAACCGA | peptide methionine sulfoxide reductase, putative; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: protein modification process, protein metabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase A (InterPro:IPR002569); BEST Arabidopsis thaliana protein match is: PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / peptide-methionine-(S)-S-oxide reductase (TAIR:AT5G61640.1); Has 7185 Blast hits to 7183 proteins in 1356 species: Archae - 86; Bacteria - 3332; Metazoa - 164; Fungi - 91; Plants - 129; Viruses - 1; Other Eukaryotes - 3382 (source: NCBI BLink). |
| AT4G25140 | AT4G25140.1 | TCGGTTCG | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT4G25550 | AT4G25550.1 | TCGGTTCGG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT4G30900 | AT4G30900.1 | TCGGTTCGGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); Has 408 Blast hits to 408 proteins in 132 species: Archae - 4; Bacteria - 213; Metazoa - 1; Fungi - 69; Plants - 10; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT4G30900.2 | TCGGTTCGGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); Has 408 Blast hits to 408 proteins in 132 species: Archae - 4; Bacteria - 213; Metazoa - 1; Fungi - 69; Plants - 10; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT4G31290 | AT4G31290.1 | CGAACCGAAACGACGCCGTT | ChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink). |
| AT4G34190 | AT4G34190.1 | CGAACCGA | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
| AT4G38940 | AT4G38940.1 | ACCGAACCGAACCGAACCGA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G10510.1); Has 722 Blast hits to 701 proteins in 54 species: Archae - 4; Bacteria - 27; Metazoa - 128; Fungi - 0; Plants - 558; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G03830 | AT5G03830.1 | CCGAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G03940 | AT5G03940.1 | AACCGAACCGA | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
| AT5G05450 | AT5G05450.1 | ACCGAACCGA | DEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae - 410; Bacteria - 10515; Metazoa - 4736; Fungi - 3110; Plants - 1301; Viruses - 7; Other Eukaryotes - 5946 (source: NCBI BLink). |
| AT5G05920 | AT5G05920.1 | CGAACCGAACCA | Encodes a deoxyhypusine synthase. |
| AT5G05920.2 | CGAACCGAACCA | Encodes a deoxyhypusine synthase. |
| AT5G06265 | AT5G06265.1 | TCGGTTCGGTTT | hyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G06265.1 | TCGGTTCGGTTT | hyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G06265.2 | TCGGTTCGGTTT | hyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G06265.2 | TCGGTTCGGTTT | hyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G07890 | AT5G07890.1 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07890.2 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07890.3 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07900 | AT5G07900.1 | GGTCGGGTCGGTTCGGGTCAAA | mitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G08360 | AT5G08360.1 | ACGTGTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23380.1); Has 132 Blast hits to 132 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 131; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G09900 | AT5G09900.1 | TCGGTTCG | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G09900.2 | TCGGTTCG | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G09900.3 | TCGGTTCG | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G11980 | AT5G11980.1 | AACCGAACCGA | conserved oligomeric Golgi complex component-related / COG complex component-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved oligomeric Golgi complex, COG8 (InterPro:IPR016632), Dor1-like protein (InterPro:IPR007255); Has 311 Blast hits to 311 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 82; Plants - 28; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G12230 | AT5G12230.1 | TCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19480.2); Has 22700 Blast hits to 10061 proteins in 421 species: Archae - 37; Bacteria - 1646; Metazoa - 10568; Fungi - 2003; Plants - 1402; Viruses - 41; Other Eukaryotes - 7003 (source: NCBI BLink). |
| AT5G13030 | AT5G13030.1 | TCGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0061 (InterPro:IPR003846); Has 4055 Blast hits to 4018 proteins in 759 species: Archae - 4; Bacteria - 1451; Metazoa - 102; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 2390 (source: NCBI BLink). |
| AT5G16310 | AT5G16310.1 | TCGGTTCGGTTCGGTTCG | UCH1; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: shoot development, shoot morphogenesis, leaf development, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, intracellular, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578), Ubiquitinyl hydrolase, UCH37 type (InterPro:IPR017390); BEST Arabidopsis thaliana protein match is: UCH2; ubiquitin thiolesterase/ ubiquitin-specific protease (TAIR:AT1G65650.1); Has 931 Blast hits to 925 proteins in 172 species: Archae - 0; Bacteria - 2; Metazoa - 511; Fungi - 225; Plants - 76; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G16320 | AT5G16320.1 | CGAACCGAACCGAACCGA | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004884 |
| AT5G16830 | AT5G16830.1 | CGAACCGA | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT5G17900 | AT5G17900.1 | CCGAACCGAACCGACCCGTAAACCGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). |
| AT5G17900.1 | TCGGTTCGGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). |
| AT5G18200 | AT5G18200.1 | TCGGTTCG | encodes an adenylyltransferase |
| AT5G18900 | AT5G18900.1 | GCCGGTTCGGTTCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123), Metridin-like ShK toxin (InterPro:IPR003582); BEST Arabidopsis thaliana protein match is: AT-P4H-2 (A. THALIANA P4H ISOFORM 2); oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors / procollagen-proline 4-dioxygenase (TAIR:AT3G06300.1); Has 1919 Blast hits to 1907 proteins in 225 species: Archae - 0; Bacteria - 196; Metazoa - 982; Fungi - 69; Plants - 224; Viruses - 14; Other Eukaryotes - 434 (source: NCBI BLink). |
| AT5G18900.1 | TCGGTTCGG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123), Metridin-like ShK toxin (InterPro:IPR003582); BEST Arabidopsis thaliana protein match is: AT-P4H-2 (A. THALIANA P4H ISOFORM 2); oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors / procollagen-proline 4-dioxygenase (TAIR:AT3G06300.1); Has 1919 Blast hits to 1907 proteins in 225 species: Archae - 0; Bacteria - 196; Metazoa - 982; Fungi - 69; Plants - 224; Viruses - 14; Other Eukaryotes - 434 (source: NCBI BLink). |
| AT5G20040 | AT5G20040.1 | TCGGTTCG | Encodes tRNA isopentenyltransferase AtIPT9. |
| AT5G20040.2 | TCGGTTCG | Encodes tRNA isopentenyltransferase AtIPT9. |
| AT5G20090 | AT5G20090.1 | AACCGAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.2 | AACCGAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.3 | AACCGAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20140 | AT5G20140.1 | CCAAACCGAACCGA | SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink). |
| AT5G21070 | AT5G21070.1 | TGGTTCGGTTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 17 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G22360 | AT5G22360.1 | CGAACCGAACCGGAT | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT5G24020 | AT5G24020.1 | TCGGTTCG | Encodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. |
| AT5G24340 | AT5G24340.1 | GTTCGGTTCGGTTCAA | 3'-5' exonuclease domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF82 (InterPro:IPR002782), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein (TAIR:AT1G56310.1); Has 1357 Blast hits to 1334 proteins in 434 species: Archae - 55; Bacteria - 507; Metazoa - 272; Fungi - 104; Plants - 81; Viruses - 0; Other Eukaryotes - 338 (source: NCBI BLink). |
| AT5G26820 | AT5G26820.1 | CGAACCGAACCA | IRON-REGULATED PROTEIN 3 (ATIREG3); LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATIREG2 (IRON-REGULATED PROTEIN 2); nickel ion transmembrane transporter (TAIR:AT5G03570.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 84; Fungi - 42; Plants - 43; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G27980 | AT5G27980.1 | AAACCGAACCGA | seed maturation family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Seed maturation protein (InterPro:IPR007011); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G22490.1); Has 103 Blast hits to 86 proteins in 19 species: Archae - 0; Bacteria - 11; Metazoa - 2; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G39600 | AT5G39600.1 | TCGGTTCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G40150 | AT5G40150.1 | CGAACCGA | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G28200.1); Has 3213 Blast hits to 3199 proteins in 258 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 351; Plants - 2806; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT5G40155 | AT5G40155.1 | TCGGTTCG | Encodes a defensin-like (DEFL) family protein. |
| AT5G41330 | AT5G41330.1 | ACCGAACCGA | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT3G09030.1); Has 474 Blast hits to 473 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 378; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT5G42240 | AT5G42240.1 | TTGAACCGAACCGA | serine carboxypeptidase-like 42 (scpl42); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl41 (serine carboxypeptidase-like 41); serine-type carboxypeptidase (TAIR:AT5G42230.1); Has 2511 Blast hits to 2467 proteins in 315 species: Archae - 0; Bacteria - 202; Metazoa - 566; Fungi - 565; Plants - 882; Viruses - 0; Other Eukaryotes - 296 (source: NCBI BLink). |
| AT5G48550 | AT5G48550.1 | AAACCGAACCGA | F-box family protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: leaf whorl; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G47730.1); Has 160 Blast hits to 160 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G48920 | AT5G48920.1 | TCGGTTCGGTTCGG | TRACHEARY ELEMENT DIFFERENTIATION-RELATED 7 (TED7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: secondary cell wall biogenesis; EXPRESSED IN: vessel member; BEST Arabidopsis thaliana protein match is: TED6 (TRACHEARY ELEMENT DIFFERENTIATION-RELATED 6) (TAIR:AT1G43790.1); Has 84677 Blast hits to 30384 proteins in 1394 species: Archae - 153; Bacteria - 11649; Metazoa - 31808; Fungi - 10466; Plants - 14952; Viruses - 3042; Other Eukaryotes - 12607 (source: NCBI BLink). |
| AT5G52180 | AT5G52180.1 | AAACCGAACCGAACCGGAA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G52190 | AT5G52190.1 | AAACCGAACCGAACCGGAA | sugar isomerase (SIS) domain-containing protein; FUNCTIONS IN: sugar binding; INVOLVED IN: carbohydrate metabolic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Sugar isomerase (SIS) (InterPro:IPR001347); Has 410 Blast hits to 410 proteins in 146 species: Archae - 96; Bacteria - 262; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT5G52580 | AT5G52580.1 | TGGTTCGGTTCGGTTCGGTT | RAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT4G27100.2); Has 4077 Blast hits to 3776 proteins in 168 species: Archae - 0; Bacteria - 0; Metazoa - 2490; Fungi - 593; Plants - 357; Viruses - 0; Other Eukaryotes - 637 (source: NCBI BLink). |
| AT5G53050 | AT5G53050.1 | AAACCGAACCGAACCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G53050.2 | AAACCGAACCGAACCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G53050.3 | AAACCGAACCGAACCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G55500 | AT5G55500.1 | TCGGTTCGGTTTAA | Encodes a beta-1,2-xylosyltransferase that is glycosylated at two positions. |
| AT5G56520 | AT5G56520.1 | ACCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55365.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57930 | AT5G57930.1 | TCGGTTCG | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G57930.2 | TCGGTTCG | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G58060 | AT5G58060.1 | CTAAACCGAACCGA | member of YKT6 Gene Family |
| AT5G58060.2 | CTAAACCGAACCGA | member of YKT6 Gene Family |
| AT5G60640 | AT5G60640.1 | TCGGTTCGGTTTAG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT5G60640.2 | TCGGTTCGGTTTAG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT5G60670 | AT5G60670.1 | CGAACCGA | 60S ribosomal protein L12 (RPL12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12B) (TAIR:AT3G53430.1); Has 1062 Blast hits to 1062 proteins in 383 species: Archae - 208; Bacteria - 187; Metazoa - 292; Fungi - 110; Plants - 81; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT5G60980 | AT5G60980.1 | CTTGGGCCGAACCGAAC | nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G25150.1); Has 32736 Blast hits to 13928 proteins in 925 species: Archae - 9; Bacteria - 11373; Metazoa - 9852; Fungi - 2838; Plants - 4351; Viruses - 467; Other Eukaryotes - 3846 (source: NCBI BLink). |
| AT5G60980.2 | CTTGGGCCGAACCGAAC | nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G25150.1); Has 32736 Blast hits to 13928 proteins in 925 species: Archae - 9; Bacteria - 11373; Metazoa - 9852; Fungi - 2838; Plants - 4351; Viruses - 467; Other Eukaryotes - 3846 (source: NCBI BLink). |
| AT5G62540 | AT5G62540.1 | CGAACCGA | Encodes a protein predicted to be an E2 ubiquitin conjugating enzyme. It appears homologous to the RAD6 protein in yeast implicated in histone ubiquitination, but, UBC3 has not been experimentally associated with this process. |
| AT5G64813 | AT5G64813.1 | CCGAACCGA | The LIP1 gene encodes a small GTPase that influences the light input pathway of the plant circadian network. An MBP:LIP1 fusion protein has GTP hydrolyzing abilities in vitro. In plants, LIP1 seems to play a negative role in regulating circadian period that can be suppressed by light. LIP1 also seems to negatively affect light-pulse-dependent resetting of the clock, especially during the first portion of the subjective evening. LIP1 expression levels are not significantly affected by the circadian clock in seedlings grown under LL conditions. The levels of the YFP:LIP1 protein expressed under the control of the 35S promoter, shows a low amplitude variation, with protein levels peaking near the beginning of subjective night under LL conditions. In hypocotyl epidermal cells of dark and light-grown seedlings, a YFP:LIP1 fusion protein can be seen in the cytoplasm and the nucleus, and does not cluster in nuclear speckles. LIP1 may also be involved in photomorphogenesis. |
| AT5G64830 | AT5G64830.1 | AACCGAACCGAACCA | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G64830.2 | AACCGAACCGAACCA | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| ATCG00640 | ATCG00640.1 | TGGTTCGGTTCG | encodes a chloroplast ribosomal protein L33, a constituent of the large subunit of the ribosomal complex |
| ATCG00650 | ATCG00650.1 | TGGTTCGGTTCG | chloroplast-encoded ribosomal protein S18 |