| Locus | Gene model | Sequence | Description |
| AT1G01510 | AT1G01510.1 | GATGACGT | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. |
| AT1G03140 | AT1G03140.1 | GATGACGT | splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT1G03150 | AT1G03150.1 | ACGTCATC | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT1G04410 | AT1G04410.1 | GATGACGTGGCGG | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink). |
| AT1G04420 | AT1G04420.1 | CCGCCACGTCATC | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink). |
| AT1G05570 | AT1G05570.1 | GATGACGTGGCAG | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT1G06010 | AT1G06010.1 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G07070 | AT1G07070.1 | GATGACGT | 60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G07820 | AT1G07820.1 | ATCCACGTCATC | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07820.2 | ATCCACGTCATC | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07830 | AT1G07830.1 | GATGACGTGGAT | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G11890 | AT1G11890.1 | AGCCACGTCATC | member of SEC22 Gene Family |
| AT1G12050 | AT1G12050.1 | GATGACGT | fumarylacetoacetase, putative; FUNCTIONS IN: fumarylacetoacetase activity, catalytic activity; INVOLVED IN: aromatic amino acid family metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234), Fumarylacetoacetase, N-terminal (InterPro:IPR015377), Fumarylacetoacetase (InterPro:IPR005959); Has 2908 Blast hits to 2904 proteins in 587 species: Archae - 79; Bacteria - 1504; Metazoa - 254; Fungi - 107; Plants - 28; Viruses - 0; Other Eukaryotes - 936 (source: NCBI BLink). |
| AT1G12200 | AT1G12200.1 | GTGACACGTCATC | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62580.1); Has 9107 Blast hits to 8683 proteins in 970 species: Archae - 28; Bacteria - 4021; Metazoa - 1067; Fungi - 1001; Plants - 456; Viruses - 0; Other Eukaryotes - 2534 (source: NCBI BLink). |
| AT1G16790 | AT1G16790.1 | TGACACGTCATC | ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G16870 | AT1G16870.1 | ACGTCATC | mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT1G17710 | AT1G17710.1 | ACGTCATC | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G17710.2 | ACGTCATC | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G19660 | AT1G19660.1 | CACGTCATC | wound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G19660.2 | CACGTCATC | wound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G19890 | AT1G19890.1 | CCACGTCATC | histone 3.3, male-gamete-specific expression |
| AT1G20030 | AT1G20030.1 | CCACGTCATC | pathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1058 Blast hits to 1048 proteins in 144 species: Archae - 0; Bacteria - 24; Metazoa - 48; Fungi - 45; Plants - 930; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G20030.2 | CCACGTCATC | pathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1058 Blast hits to 1048 proteins in 144 species: Archae - 0; Bacteria - 24; Metazoa - 48; Fungi - 45; Plants - 930; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G20696 | AT1G20696.1 | GATGACGTGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G20696.2 | GATGACGTGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G20696.3 | GATGACGTGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G21670 | AT1G21670.1 | ATCCACGTCATC | INVOLVED IN: proteolysis; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Peptidase S9B, dipeptidylpeptidase IV N-terminal (InterPro:IPR002469), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21680.1); Has 6126 Blast hits to 3685 proteins in 788 species: Archae - 47; Bacteria - 3362; Metazoa - 27; Fungi - 47; Plants - 58; Viruses - 0; Other Eukaryotes - 2585 (source: NCBI BLink). |
| AT1G21680 | AT1G21680.1 | GATGACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21670.1); Has 6869 Blast hits to 3873 proteins in 790 species: Archae - 41; Bacteria - 3697; Metazoa - 41; Fungi - 39; Plants - 64; Viruses - 0; Other Eukaryotes - 2987 (source: NCBI BLink). |
| AT1G22740 | AT1G22740.1 | GATGACGT | GTP-binding protein Rab7 |
| AT1G25375 | AT1G25375.1 | GATGACGT | metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 3890 Blast hits to 3889 proteins in 863 species: Archae - 83; Bacteria - 2082; Metazoa - 121; Fungi - 86; Plants - 75; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink). |
| AT1G25400 | AT1G25400.1 | CCACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68440.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29330 | AT1G29330.1 | ATTGCCACGTCATC | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT1G30110 | AT1G30110.1 | ACGTCATC | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 25 (ATNUDX25); FUNCTIONS IN: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: diadenosine tetraphosphate catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 4194 Blast hits to 4194 proteins in 805 species: Archae - 14; Bacteria - 2251; Metazoa - 23; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1859 (source: NCBI BLink). |
| AT1G30520 | AT1G30520.1 | CTGCCACGTCATC | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G32130 | AT1G32130.1 | GATGACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink). |
| AT1G32220 | AT1G32220.1 | GATGACGTCGTTTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT1G43130 | AT1G43130.1 | GATGACGTGTCG | LIKE COV 2 (LCV2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: stem vascular tissue pattern formation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1946 Blast hits to 1946 proteins in 369 species: Archae - 4; Bacteria - 692; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 1166 (source: NCBI BLink). |
| AT1G44750 | AT1G44750.1 | GATGACGTGG | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G48410 | AT1G48410.1 | TTCCACGTCATC | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT1G48410.2 | TTCCACGTCATC | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT1G48620 | AT1G48620.1 | AAAACGCCACGTCATC | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT1G50450 | AT1G50450.1 | ACACGTCATC | binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase (InterPro:IPR005097), NAD(P)-binding (InterPro:IPR016040); Has 934 Blast hits to 931 proteins in 259 species: Archae - 13; Bacteria - 434; Metazoa - 33; Fungi - 62; Plants - 25; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink). |
| AT1G50480 | AT1G50480.1 | ACGTCATC | 10-formyltetrahydrofolate synthetase (THFS) mRNA, complete |
| AT1G52590 | AT1G52590.1 | GATGACGTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). |
| AT1G52600 | AT1G52600.1 | CCACGTCATC | signal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT1G62180 | AT1G62180.1 | TCGCCACGTCATC | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
| AT1G63290 | AT1G63290.1 | GTGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink). |
| AT1G63900 | AT1G63900.1 | GCCACGTCATC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 2665 Blast hits to 2573 proteins in 206 species: Archae - 0; Bacteria - 8; Metazoa - 1654; Fungi - 30; Plants - 409; Viruses - 201; Other Eukaryotes - 363 (source: NCBI BLink). |
| AT1G68310 | AT1G68310.1 | GATGACGTGTCG | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. |
| AT1G68310.2 | GATGACGTGTCG | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. |
| AT1G75810 | AT1G75810.1 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76680 | AT1G76680.1 | ACGTCATC | Encodes a a member of an alpha/beta barrel fold family of FMN-containing oxidoreductases. One of two closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Up-regulated by senescence and jasmonic acid. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT1G76680.2 | ACGTCATC | Encodes a a member of an alpha/beta barrel fold family of FMN-containing oxidoreductases. One of two closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Up-regulated by senescence and jasmonic acid. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT1G79790 | AT1G79790.1 | CCACGTCATC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT1G79790.2 | CCACGTCATC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT1G80850 | AT1G80850.1 | GATGACGTGTCA | methyladenine glycosylase family protein; FUNCTIONS IN: DNA-3-methyladenine glycosylase I activity, catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Methyladenine glycosylase (InterPro:IPR005019); BEST Arabidopsis thaliana protein match is: methyladenine glycosylase family protein (TAIR:AT1G15970.1); Has 1956 Blast hits to 1956 proteins in 800 species: Archae - 7; Bacteria - 1545; Metazoa - 4; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT1G80910 | AT1G80910.1 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16020.2); Has 140 Blast hits to 140 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G01590 | AT2G01590.1 | ACGTCATC | Likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity. |
| AT2G03890 | AT2G03890.1 | GATGACGTGTCAT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT2G03890.2 | GATGACGTGTCAT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT2G05380 | AT2G05380.1 | GATGACGT | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete |
| AT2G05380.2 | GATGACGT | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete |
| AT2G18370 | AT2G18370.1 | ACACGTCATC | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT2G20260 | AT2G20260.1 | TTGCCACGTCATC | Encodes subunit E of photosystem I. |
| AT2G22010 | AT2G22010.1 | ACGTCATCAGCCACGTCATC | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT2G22170 | AT2G22170.1 | AAAACGACCACGTCATC | lipid-associated family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT4G39730.1); Has 113 Blast hits to 108 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G23670 | AT2G23670.1 | GATGACGTGTCACGT | Arabidopsis homolog of Synechocystis YCF37 (YCF37); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G24250 | AT2G24250.1 | AAAACGACGTCATC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24250.2 | AAAACGACGTCATC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24490 | AT2G24490.1 | ACGTCATC | Encodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1. |
| AT2G24490.2 | ACGTCATC | Encodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1. |
| AT2G25430 | AT2G25430.1 | TCGCCACGTCATC | epsin N-terminal homology (ENTH) domain-containing protein; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT4G32285.2); Has 1419 Blast hits to 1078 proteins in 187 species: Archae - 4; Bacteria - 130; Metazoa - 620; Fungi - 114; Plants - 393; Viruses - 2; Other Eukaryotes - 156 (source: NCBI BLink). |
| AT2G28940 | AT2G28940.1 | TCGCCACGTCATC | protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G39110.1); Has 81015 Blast hits to 80048 proteins in 2308 species: Archae - 40; Bacteria - 6913; Metazoa - 35685; Fungi - 6155; Plants - 18356; Viruses - 328; Other Eukaryotes - 13538 (source: NCBI BLink). |
| AT2G29530 | AT2G29530.1 | GATGACGTGGCGT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT2G29530.2 | GATGACGTGGCGT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT2G29530.3 | GATGACGTGGCGT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT2G29540 | AT2G29540.1 | ACGCCACGTCATC | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT2G29540.2 | ACGCCACGTCATC | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT2G29540.3 | ACGCCACGTCATC | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT2G32600 | AT2G32600.1 | GATGACGT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, intracellular, spliceosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 17385 Blast hits to 7765 proteins in 482 species: Archae - 26; Bacteria - 1475; Metazoa - 7274; Fungi - 1847; Plants - 3510; Viruses - 897; Other Eukaryotes - 2356 (source: NCBI BLink). |
| AT2G32990 | AT2G32990.1 | CACGTCATC | Arabidopsis thaliana glycosyl hydrolase 9B8 (AtGH9B8); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Six-hairpin glycosidase (InterPro:IPR012341), Glycoside hydrolase, family 9, active site (InterPro:IPR018221), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 9 (InterPro:IPR001701); BEST Arabidopsis thaliana protein match is: AtGH9C2 (Arabidopsis thaliana glycosyl hydrolase 9C2); carbohydrate binding / catalytic/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G64390.1); Has 1108 Blast hits to 1103 proteins in 191 species: Archae - 0; Bacteria - 304; Metazoa - 140; Fungi - 14; Plants - 622; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT2G34650 | AT2G34650.1 | ACGTCATC | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT2G36145 | AT2G36145.1 | ACACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; Has 27 Blast hits to 27 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G39170 | AT2G39170.1 | GATGACGTGGAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G39445 | AT2G39445.1 | ACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: PIG-P (InterPro:IPR013717), Phosphatidylinositol N-acetylglucosaminyltransferase, GPI19/PIG-P subunit (InterPro:IPR016542); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61280.1); Has 228 Blast hits to 228 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 60; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT2G41945 | AT2G41945.1 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1). |
| AT2G41945.2 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1). |
| AT2G41945.3 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1). |
| AT2G43400 | AT2G43400.1 | TTGCCACGTCATC | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
| AT2G45000 | AT2G45000.1 | GTACACGTCATC | EMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink). |
| AT2G46110 | AT2G46110.1 | CACGTCATCTCACACGTGTG | Encodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. |
| AT2G46500 | AT2G46500.1 | ACGTCATC | phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink). |
| AT2G46500.2 | ACGTCATC | phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink). |
| AT2G47700 | AT2G47700.1 | CCACGTCATC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: transcription factor, putative / zinc finger (C3HC4 type RING finger) family protein (TAIR:AT3G05545.1); Has 360 Blast hits to 360 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 172; Fungi - 15; Plants - 110; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT2G47710 | AT2G47710.1 | AGCCACGTCATC | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49050.1); Has 1402 Blast hits to 1369 proteins in 323 species: Archae - 50; Bacteria - 850; Metazoa - 46; Fungi - 22; Plants - 381; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G01850 | AT3G01850.1 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
| AT3G01850.2 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
| AT3G01990 | AT3G01990.1 | GTGCCACGTCATC | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
| AT3G04460 | AT3G04460.1 | GATGACGTGGAC | RING finger protein involved in peroxisome biogenesis. |
| AT3G04460.1 | GATGACGTGGCT | RING finger protein involved in peroxisome biogenesis. |
| AT3G05260 | AT3G05260.1 | GTACACGTCATC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: binding / catalytic/ oxidoreductase (TAIR:AT1G54870.1); Has 80754 Blast hits to 80610 proteins in 2221 species: Archae - 465; Bacteria - 44840; Metazoa - 4442; Fungi - 3990; Plants - 1473; Viruses - 7; Other Eukaryotes - 25537 (source: NCBI BLink). |
| AT3G06340 | AT3G06340.1 | ACGTCATC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G18750.1); Has 24187 Blast hits to 14794 proteins in 1885 species: Archae - 90; Bacteria - 12845; Metazoa - 4177; Fungi - 1376; Plants - 1002; Viruses - 32; Other Eukaryotes - 4665 (source: NCBI BLink). |
| AT3G06340.2 | ACGTCATC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G18750.1); Has 24187 Blast hits to 14794 proteins in 1885 species: Archae - 90; Bacteria - 12845; Metazoa - 4177; Fungi - 1376; Plants - 1002; Viruses - 32; Other Eukaryotes - 4665 (source: NCBI BLink). |
| AT3G06480 | AT3G06480.1 | ACGTCATC | DEAD box RNA helicase, putative; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 109211 Blast hits to 62170 proteins in 2363 species: Archae - 554; Bacteria - 31458; Metazoa - 36250; Fungi - 10201; Plants - 9855; Viruses - 839; Other Eukaryotes - 20054 (source: NCBI BLink). |
| AT3G06860 | AT3G06860.1 | ACGTCATC | Encodes a multifunctional protein. Involved in peroxisomal fatty acid beta oxidation. Loss-of-function mutant lacks hydroxyacyl-CoA dehydrogenase activity and have reduced levels of long-chain enoyl-CoA hydratase activity. The mutant has fewer but larger peroxisomes. |
| AT3G08590 | AT3G08590.1 | CCACGTCATC | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08590.2 | CCACGTCATC | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G10220 | AT3G10220.1 | ACGTCATC | tubulin folding cofactor B; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: tubulin complex assembly; LOCATED IN: nucleus, phragmoplast, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytoskeleton-associated protein, CAP-Gly (InterPro:IPR000938); Has 1412 Blast hits to 1124 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 1093; Fungi - 181; Plants - 31; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G11397 | AT3G11397.1 | CTGCCACGTCATC | PRENYLATED RAB ACCEPTOR 1.A3 (PRA1.A3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum, membrane; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 234 Blast hits to 234 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G12130 | AT3G12130.1 | ACGTCATC | KH domain-containing protein / zinc finger (CCCH type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein / zinc finger (CCCH type) family protein (TAIR:AT5G06770.1); Has 951 Blast hits to 736 proteins in 106 species: Archae - 0; Bacteria - 4; Metazoa - 647; Fungi - 21; Plants - 174; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G14180 | AT3G14180.1 | CACGTCATTCCACGTCATC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT3G14910 | AT3G14910.1 | GATGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G14990 | AT3G14990.1 | ACGTCATC | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
| AT3G14990.2 | ACGTCATC | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
| AT3G14990.3 | ACGTCATC | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
| AT3G15940 | AT3G15940.1 | ACGTCATC | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G52420.1); Has 6481 Blast hits to 6467 proteins in 933 species: Archae - 176; Bacteria - 3946; Metazoa - 40; Fungi - 36; Plants - 110; Viruses - 0; Other Eukaryotes - 2173 (source: NCBI BLink). |
| AT3G17940 | AT3G17940.1 | GATGACGT | aldose 1-epimerase family protein; FUNCTIONS IN: isomerase activity, carbohydrate binding, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, hexose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Aldose-1-epimerase (InterPro:IPR015443), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT3G47800.1); Has 2630 Blast hits to 2627 proteins in 708 species: Archae - 12; Bacteria - 1382; Metazoa - 249; Fungi - 162; Plants - 126; Viruses - 0; Other Eukaryotes - 699 (source: NCBI BLink). |
| AT3G18750 | AT3G18750.1 | ACGTCATCAATTGGG | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G18750.2 | ACGTCATCAATTGGG | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G18850 | AT3G18850.1 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.2 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.3 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.4 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.5 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18860 | AT3G18860.1 | CGACACGTCATC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G18860.2 | CGACACGTCATC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G22410 | AT3G22410.1 | ACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05370.1); Has 1032 Blast hits to 1032 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 245; Fungi - 243; Plants - 390; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink). |
| AT3G22440 | AT3G22440.1 | CCACGTCATC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT3G22780 | AT3G22780.1 | GATGACGT | putative DNA binding protein (tso1) mRNA, tso1-3 allele, |
| AT3G23080 | AT3G23080.1 | AAGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14500.1); Has 247 Blast hits to 246 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G23080.2 | AAGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14500.1); Has 247 Blast hits to 246 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G46020 | AT3G46020.1 | TTCCACGTCATC | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink). |
| AT3G46030 | AT3G46030.1 | TTCCACGTCATC | HTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT3G47470 | AT3G47470.1 | CCACGTCATC | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT3G50690 | AT3G50690.1 | ACGCCACGTCATC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink). |
| AT3G50820 | AT3G50820.1 | CACGTCATC | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In <i>Arabidopsis thaliana</i> the PsbO proteins are encoded by two genes: <i>psbO1</i> and <i>psbO2</i>. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT3G50860 | AT3G50860.1 | GATGACGTCATC | clathrin adaptor complex small chain family protein; FUNCTIONS IN: protein transporter activity, protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin vesicle coat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex, sigma subunit (InterPro:IPR016635), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT2G19790.1); Has 1471 Blast hits to 1469 proteins in 183 species: Archae - 0; Bacteria - 0; Metazoa - 751; Fungi - 281; Plants - 166; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink). |
| AT3G51250 | AT3G51250.1 | ACGCCACGTCATC | senescence/dehydration-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Senescence-associated (InterPro:IPR009686); BEST Arabidopsis thaliana protein match is: ERD7 (EARLY-RESPONSIVE TO DEHYDRATION 7) (TAIR:AT2G17840.1); Has 204 Blast hits to 204 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G51730 | AT3G51730.1 | GATGACGTGG | saposin B domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139), Saposin-like (InterPro:IPR011001), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138); BEST Arabidopsis thaliana protein match is: saposin B domain-containing protein (TAIR:AT5G01800.1); Has 852 Blast hits to 399 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 693; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G51980 | AT3G51980.1 | GATGACGTGT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 470 Blast hits to 470 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT3G53020 | AT3G53020.1 | GCTGACGTCATC | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20. |
| AT3G53030 | AT3G53030.1 | GATGACGTCAGC | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
| AT3G60490 | AT3G60490.1 | ACGTCATC | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G62130 | AT3G62130.1 | GATGACGT | epimerase-related; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase, class V/Cysteine desulfurase (InterPro:IPR000192), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: catalytic/ pyridoxal phosphate binding (TAIR:AT5G26600.2); Has 2894 Blast hits to 2894 proteins in 687 species: Archae - 60; Bacteria - 1379; Metazoa - 26; Fungi - 139; Plants - 61; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G63030 | AT3G63030.1 | ACGTCATC | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT4G00370 | AT4G00370.1 | ACGTCATC | Encodes an inorganic phosphate transporter (PHT4;4). |
| AT4G03150 | AT4G03150.1 | ACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 30 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G08685 | AT4G08685.1 | ATCCACGTCATCAAATACCCC | Encodes a protein, expressed in leaves, with similarity to pollen allergens. |
| AT4G09750 | AT4G09750.1 | AAAAAGCCACGTCATC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G24050.1); Has 49720 Blast hits to 49652 proteins in 1938 species: Archae - 292; Bacteria - 27546; Metazoa - 4870; Fungi - 3259; Plants - 1240; Viruses - 0; Other Eukaryotes - 12513 (source: NCBI BLink). |
| AT4G10100 | AT4G10100.1 | ACGTCATC | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.1 | GATGACGT | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.2 | ACGTCATC | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.2 | GATGACGT | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.3 | ACGTCATC | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.3 | GATGACGT | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G11600 | AT4G11600.1 | GATGACGT | Encodes glutathione peroxidase. |
| AT4G14500 | AT4G14500.1 | CGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G14500.2 | CGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G14900 | AT4G14900.1 | ATCCACGTCATC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G15530 | AT4G15530.2 | GATGACGT | pyruvate orthophosphate dikinase (PPDK); FUNCTIONS IN: pyruvate, phosphate dikinase activity, kinase activity; INVOLVED IN: response to absence of light, phosphorylation; LOCATED IN: cytosol, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PEP-utilising enzyme, mobile region (InterPro:IPR008279), ATP-grasp fold, subdomain 1 (InterPro:IPR013815), Pyruvate, phosphate dikinase (InterPro:IPR010121), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate phosphate dikinase, PEP/pyruvate-binding (InterPro:IPR002192), PEP-utilising enzyme, mobile region, conserved site (InterPro:IPR018274), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), PEP-utilizing enzyme (InterPro:IPR000121); Has 10398 Blast hits to 10351 proteins in 1379 species: Archae - 188; Bacteria - 5300; Metazoa - 4; Fungi - 14; Plants - 89; Viruses - 0; Other Eukaryotes - 4803 (source: NCBI BLink). |
| AT4G15530.3 | GATGACGT | pyruvate orthophosphate dikinase (PPDK); FUNCTIONS IN: pyruvate, phosphate dikinase activity, kinase activity; INVOLVED IN: response to absence of light, phosphorylation; LOCATED IN: cytosol, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PEP-utilising enzyme, mobile region (InterPro:IPR008279), ATP-grasp fold, subdomain 1 (InterPro:IPR013815), Pyruvate, phosphate dikinase (InterPro:IPR010121), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate phosphate dikinase, PEP/pyruvate-binding (InterPro:IPR002192), PEP-utilising enzyme, mobile region, conserved site (InterPro:IPR018274), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), PEP-utilizing enzyme (InterPro:IPR000121); Has 10398 Blast hits to 10351 proteins in 1379 species: Archae - 188; Bacteria - 5300; Metazoa - 4; Fungi - 14; Plants - 89; Viruses - 0; Other Eukaryotes - 4803 (source: NCBI BLink). |
| AT4G19490 | AT4G19490.1 | GATGACGTGGAT | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
| AT4G19490.2 | GATGACGTGGAT | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
| AT4G19540 | AT4G19540.1 | GATGACGT | IND1(IRON-SULFUR PROTEIN REQUIRED FOR NADH DEHYDROGENASE)-LIKE (INDL); LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: HCF101 (HIGH-CHLOROPHYLL-FLUORESCENCE 101); ATP binding (TAIR:AT3G24430.1); Has 9217 Blast hits to 9199 proteins in 1435 species: Archae - 352; Bacteria - 4208; Metazoa - 319; Fungi - 279; Plants - 117; Viruses - 0; Other Eukaryotes - 3942 (source: NCBI BLink). |
| AT4G20070 | AT4G20070.1 | CCACGTCATC | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. |
| AT4G25620 | AT4G25620.1 | GATGACGTGGCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink). |
| AT4G29905 | AT4G29905.1 | TTGCCACGTCATC | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 41 Blast hits to 41 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31330 | AT4G31330.1 | ATGCCACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10580.1); Has 252 Blast hits to 252 proteins in 85 species: Archae - 0; Bacteria - 139; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G32480 | AT4G32480.1 | TGACACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20670.1); Has 203 Blast hits to 203 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 201; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G33430 | AT4G33430.1 | GTCCACGTCATC | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. |
| AT4G39660 | AT4G39660.1 | TGACACGTCATC | alanine:glyoxylate aminotransferase 2 homolog (AGT2) mRNA, |
| AT5G03290 | AT5G03290.1 | GATGACGT | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G03940 | AT5G03940.1 | TACTGGGCCACGTCATC | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
| AT5G04020 | AT5G04020.1 | ACGTCATC | calmodulin binding; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin-binding, plant (InterPro:IPR012417); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein-related (TAIR:AT2G38800.1); Has 3773 Blast hits to 2797 proteins in 304 species: Archae - 14; Bacteria - 265; Metazoa - 1415; Fungi - 238; Plants - 248; Viruses - 14; Other Eukaryotes - 1579 (source: NCBI BLink). |
| AT5G06750 | AT5G06750.1 | CACGTCATC | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT5G66080.1); Has 3459 Blast hits to 3458 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1097; Fungi - 381; Plants - 1276; Viruses - 5; Other Eukaryotes - 696 (source: NCBI BLink). |
| AT5G06750.3 | CACGTCATC | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT5G66080.1); Has 3459 Blast hits to 3458 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1097; Fungi - 381; Plants - 1276; Viruses - 5; Other Eukaryotes - 696 (source: NCBI BLink). |
| AT5G07190 | AT5G07190.1 | GATGACGTGTCA | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT5G07190.2 | GATGACGTGTCA | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT5G10980 | AT5G10980.1 | AGCCACGTCATC | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3.2 (TAIR:AT4G40040.2); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). |
| AT5G11860 | AT5G11860.1 | GATGACGTCATC | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G11860.2 | GATGACGTCATC | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G11860.3 | GATGACGTCATC | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G11860.4 | GATGACGTCATC | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G14800 | AT5G14800.1 | ATCCACGTCATC | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
| AT5G14800.2 | ATCCACGTCATC | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
| AT5G15860 | AT5G15860.1 | ACGTCATC | Encodes a protein with prenylcysteine methylesterase activity. |
| AT5G15860.2 | ACGTCATC | Encodes a protein with prenylcysteine methylesterase activity. |
| AT5G18850 | AT5G18850.1 | GATGACGTGGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19140 | AT5G19140.1 | GATGACGT | AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink). |
| AT5G19140.2 | GATGACGT | AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink). |
| AT5G24810 | AT5G24810.1 | GATGACGTGGCCCATTG | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). |
| AT5G24850 | AT5G24850.1 | GATGACGT | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
| AT5G27520 | AT5G27520.1 | GATGACGT | encodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth. |
| AT5G28540 | AT5G28540.1 | GTCCACGTCATC | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. |
| AT5G40670 | AT5G40670.1 | ATGACACGTCATC | PQ-loop repeat family protein / transmembrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Lysosomal cystine transporter (InterPro:IPR005282); Has 261 Blast hits to 261 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G40950 | AT5G40950.1 | GATGACGTGT | RIBOSOMAL PROTEIN LARGE SUBUNIT 27 (RPL27); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, ribosome, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5099 Blast hits to 5099 proteins in 1536 species: Archae - 0; Bacteria - 2975; Metazoa - 83; Fungi - 94; Plants - 70; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT5G42020 | AT5G42020.1 | GTCCACGTCATC | luminal binding protein (BiP) |
| AT5G42020.2 | GTCCACGTCATC | luminal binding protein (BiP) |
| AT5G42570 | AT5G42570.1 | GATGACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11905.1); Has 311 Blast hits to 268 proteins in 81 species: Archae - 2; Bacteria - 2; Metazoa - 134; Fungi - 41; Plants - 73; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT5G45800 | AT5G45800.1 | ATCCACGTCATC | maternal effect embryo arrest 62 (MEE62); FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G24230.1); Has 55296 Blast hits to 36416 proteins in 1147 species: Archae - 36; Bacteria - 3164; Metazoa - 17246; Fungi - 1111; Plants - 30254; Viruses - 106; Other Eukaryotes - 3379 (source: NCBI BLink). |
| AT5G47180 | AT5G47180.1 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G47180.2 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G51400 | AT5G51400.1 | ACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45010.1); Has 288 Blast hits to 287 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 4; Plants - 275; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G52430 | AT5G52430.1 | GATGACGTGGCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G25620.1); Has 849 Blast hits to 464 proteins in 107 species: Archae - 2; Bacteria - 43; Metazoa - 236; Fungi - 114; Plants - 84; Viruses - 9; Other Eukaryotes - 361 (source: NCBI BLink). |
| AT5G54080 | AT5G54080.1 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase |
| AT5G54080.2 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase |
| AT5G54540 | AT5G54540.1 | GCTGACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP012943 (InterPro:IPR016606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25170.1); Has 60 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G54860 | AT5G54860.1 | GATGACGTGT | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT1G64890.1); Has 636 Blast hits to 542 proteins in 109 species: Archae - 2; Bacteria - 124; Metazoa - 4; Fungi - 2; Plants - 156; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). |
| AT5G55180 | AT5G55180.1 | AGACACGTCATC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1). |
| AT5G55180.2 | AGACACGTCATC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1). |
| AT5G59960 | AT5G59960.1 | ACACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G61380 | AT5G61380.1 | GATGACGTGGCCTTTT | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. |
| AT5G61380.1 | GTCCACGTCATC | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. |
| AT5G63190 | AT5G63190.1 | GATGACGTGTAC | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT5G63190.2 | GATGACGTGTAC | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT5G64040 | AT5G64040.1 | GTCCACGTCATC | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. |
| AT5G64040.2 | GTCCACGTCATC | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. |
| AT5G64080 | AT5G64080.1 | ACGTCATC | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT2G13820.1); Has 745 Blast hits to 741 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G64080.2 | ACGTCATC | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT2G13820.1); Has 745 Blast hits to 741 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G64970 | AT5G64970.1 | GATGACGTGTCA | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G78180.1); Has 18195 Blast hits to 9659 proteins in 353 species: Archae - 0; Bacteria - 0; Metazoa - 9099; Fungi - 4929; Plants - 2524; Viruses - 0; Other Eukaryotes - 1643 (source: NCBI BLink). |
| AT5G65110 | AT5G65110.1 | AACGACGTGTCCACGTCATC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65110.2 | AACGACGTGTCCACGTCATC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65260 | AT5G65260.1 | GATGACGTGTCT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink). |
| AT5G65270 | AT5G65270.1 | AGACACGTCATC | Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae - 17; Bacteria - 108; Metazoa - 12691; Fungi - 2978; Plants - 2157; Viruses - 19; Other Eukaryotes - 5059 (source: NCBI BLink). |
| AT5G66910 | AT5G66910.1 | GATGACGT | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). |
| ATMG01370 | ATMG01370.1 | GATGACGT | hypothetical protein |