Organism | Arabidopsis thaliana | |
ID | AtREG580 | |
Sequence | AACCCGAC | |
Annotation | ||
PPDB Motif | CCGAC | DRE core, stress response |
PLACE Motif | CCGAC | Core of low temperature responsive element (LTRE) of cor15a gene in Arabidopsis (A.t.); A portion of repeat-C (C-repeat), TGGCCGAC, which is repeated twice in cor15a promoter (Baker et al., 1994); ABA responsiveness; Involved in cold induction of BN115 gene from winter Brassica napus; LTRE; See S000157, S000152; Light signaling mediated by phytochrome is necessary for cold- or drought- induced gene expression through the C/DRE in Arabidopsis; See S000152; |
Total Entry Count | 100 |
Locus | Gene model | Sequence | Description |
AT1G02560 | AT1G02560.1 | AACCCGACCCGA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT1G03250 | AT1G03250.1 | GGTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 29; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT1G04790 | AT1G04790.1 | AACCCGACCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).  |
AT1G06400 | AT1G06400.1 | AACCCGAC | small GTP-binding protein (ara-2)  |
AT1G07170 | AT1G07170.1 | AACCCGAC | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT1G07170.2 | AACCCGAC | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT1G09130 | AT1G09130.1 | AACCCGACCC | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).  |
AT1G09130.2 | AACCCGACCC | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).  | |
AT1G09420 | AT1G09420.1 | AACCCGAC | Encodes a protein similar to glucose-6-phosphate dehydrogenase but, based on amino acid differences in the active site and lack of activity, does not encode a functional G6PDH. The amino acid sequence for the consensus sequence of the G6PDH active site (DHYLGKE) differs in three places in this protein. gc exon splice site at 20574 is based on protein alignment, and is not confirmed experimentally.  |
AT1G09430 | AT1G09430.1 | GTCGGGTT | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity.  |
AT1G09940 | AT1G09940.1 | AACCCGACCCGG | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins  |
AT1G11630 | AT1G11630.1 | GTCGGGTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PPR336 (pentatricopeptide repeat 336) (TAIR:AT1G61870.1); Has 12390 Blast hits to 3643 proteins in 147 species: Archae - 4; Bacteria - 8; Metazoa - 197; Fungi - 174; Plants - 11635; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).  |
AT1G11650 | AT1G11650.1 | AACCCGAC | RBP45B; FUNCTIONS IN: RNA binding; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 22877 Blast hits to 14020 proteins in 588 species: Archae - 14; Bacteria - 1484; Metazoa - 13266; Fungi - 2464; Plants - 3532; Viruses - 0; Other Eukaryotes - 2117 (source: NCBI BLink).  |
AT1G11650.2 | AACCCGAC | RBP45B; FUNCTIONS IN: RNA binding; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 22877 Blast hits to 14020 proteins in 588 species: Archae - 14; Bacteria - 1484; Metazoa - 13266; Fungi - 2464; Plants - 3532; Viruses - 0; Other Eukaryotes - 2117 (source: NCBI BLink).  | |
AT1G13180 | AT1G13180.1 | GTCGGGTT | Mutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype.  |
AT1G14230 | AT1G14230.1 | AACCCGACCCGGT | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
AT1G14680 | AT1G14680.1 | GTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09060.1); Has 7013 Blast hits to 5372 proteins in 466 species: Archae - 108; Bacteria - 388; Metazoa - 3676; Fungi - 303; Plants - 203; Viruses - 23; Other Eukaryotes - 2312 (source: NCBI BLink).  |
AT1G14850 | AT1G14850.1 | AACCCGACCCGGG | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport  |
AT1G15440 | AT1G15440.1 | GTCGGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).  |
AT1G15440.2 | GTCGGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).  | |
AT1G16020 | AT1G16020.1 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G16020.2 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  | |
AT1G17455 | AT1G17455.1 | CGGGTCGGGTT | ELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G17455.2 | CGGGTCGGGTT | ELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G17490 | AT1G17490.1 | GTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72690.1); Has 29 Blast hits to 23 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G18450 | AT1G18450.1 | AACCCGAC | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes.  |
AT1G19430 | AT1G19430.1 | AACCCGACC | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT5G64030.1); Has 7615 Blast hits to 5355 proteins in 417 species: Archae - 11; Bacteria - 419; Metazoa - 2915; Fungi - 818; Plants - 766; Viruses - 126; Other Eukaryotes - 2560 (source: NCBI BLink).  |
AT1G20460 | AT1G20460.1 | AACCCGACCCGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G20830 | AT1G20830.1 | AACCCGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G24560 | AT1G24560.1 | AACCCGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49055.1); Has 56279 Blast hits to 28796 proteins in 1542 species: Archae - 818; Bacteria - 6598; Metazoa - 28656; Fungi - 4716; Plants - 2272; Viruses - 181; Other Eukaryotes - 13038 (source: NCBI BLink).  |
AT1G25290 | AT1G25290.1 | AACCCGAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 10 (ATRBL10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610); BEST Arabidopsis thaliana protein match is: ATRBL5 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 5) (TAIR:AT1G52580.1); Has 3072 Blast hits to 3072 proteins in 967 species: Archae - 65; Bacteria - 1888; Metazoa - 196; Fungi - 96; Plants - 174; Viruses - 0; Other Eukaryotes - 653 (source: NCBI BLink).  |
AT1G29510 | AT1G29510.1 | GTCGGGTT | SMALL AUXIN UPREGULATED 68 (SAUR68); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29440.1); Has 358 Blast hits to 348 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 358; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G63290 | AT1G63290.1 | GGGTCGGGTT | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).  |
AT1G63470 | AT1G63470.1 | AACCCGAC | DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: DNA-binding family protein (TAIR:AT1G63480.1); Has 668 Blast hits to 666 proteins in 58 species: Archae - 0; Bacteria - 22; Metazoa - 173; Fungi - 26; Plants - 435; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G72280 | AT1G72280.1 | ATAAGCCCAACCCGACCC | endoplasmic reticulum oxidoreductin  |
AT1G80850 | AT1G80850.1 | GTCGGGTT | methyladenine glycosylase family protein; FUNCTIONS IN: DNA-3-methyladenine glycosylase I activity, catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Methyladenine glycosylase (InterPro:IPR005019); BEST Arabidopsis thaliana protein match is: methyladenine glycosylase family protein (TAIR:AT1G15970.1); Has 1956 Blast hits to 1956 proteins in 800 species: Archae - 7; Bacteria - 1545; Metazoa - 4; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).  |
AT2G04540 | AT2G04540.1 | GTCGGGTT | 3-oxoacyl-(acyl-carrier-protein) synthase II, putative; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, fatty-acid synthase activity, catalytic activity; INVOLVED IN: biosynthetic process, fatty acid biosynthetic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-ketoacyl synthase (InterPro:IPR000794), Thiolase-like (InterPro:IPR016039), Beta-ketoacyl synthase, C-terminal (InterPro:IPR014031), 3-oxoacyl-[acyl-carrier-protein] synthase 2 (InterPro:IPR017568), Beta-ketoacyl synthase, N-terminal (InterPro:IPR014030), Thiolase-like, subgroup (InterPro:IPR016038), Beta-ketoacyl synthase, active site (InterPro:IPR018201); BEST Arabidopsis thaliana protein match is: FAB1 (FATTY ACID BIOSYNTHESIS 1); 3-oxoacyl-[acyl-carrier-protein] synthase/ fatty-acid synthase (TAIR:AT1G74960.2); Has 19605 Blast hits to 17878 proteins in 2069 species: Archae - 5; Bacteria - 11810; Metazoa - 457; Fungi - 1652; Plants - 223; Viruses - 0; Other Eukaryotes - 5458 (source: NCBI BLink).  |
AT2G04630 | AT2G04630.1 | CCGAACCGAACCCGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  |
AT2G19080 | AT2G19080.1 | AACCCGACCGACT | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G24940 | AT2G24940.1 | AACCCGAC | Arabidopsis thaliana membrane-associated progesterone binding protein 2 (AtMAPR2); FUNCTIONS IN: heme binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Cytochrome b5, heme-binding site (InterPro:IPR018506), Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: MSBP1 (membrane steroid binding protein 1); steroid binding (TAIR:AT5G52240.1); Has 795 Blast hits to 795 proteins in 140 species: Archae - 2; Bacteria - 9; Metazoa - 377; Fungi - 218; Plants - 121; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT2G31725 | AT2G31725.1 | AACCCGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05730.1); Has 199 Blast hits to 199 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT2G40800 | AT2G40800.1 | AACCCGACCCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G46180 | AT2G46180.1 | AACCCGACCCGTCCGA | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.  |
AT2G46540 | AT2G46540.1 | ATTTGGGCCCAGTAACCCGACCCGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G47930 | AT2G47930.1 | AACCCGAC | ARABINOGALACTAN PROTEIN 26 (AGP26); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1560 Blast hits to 376 proteins in 91 species: Archae - 2; Bacteria - 52; Metazoa - 102; Fungi - 48; Plants - 148; Viruses - 60; Other Eukaryotes - 1148 (source: NCBI BLink).  |
AT3G06150 | AT3G06150.1 | GTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19060.1); Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G09000 | AT3G09000.1 | AACCCGAC | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40070.2); Has 63160 Blast hits to 33955 proteins in 1341 species: Archae - 167; Bacteria - 7271; Metazoa - 25356; Fungi - 13055; Plants - 2649; Viruses - 1731; Other Eukaryotes - 12931 (source: NCBI BLink).  |
AT3G09630 | AT3G09630.1 | GTCGGGTT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  |
AT3G09630.2 | GTCGGGTT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  | |
AT3G10340 | AT3G10340.1 | AACCCGAC | Phenylalanine ammonia-lyase 4 (PAL4); FUNCTIONS IN: ammonia-lyase activity, ammonia ligase activity, catalytic activity; INVOLVED IN: L-phenylalanine catabolic process, biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phenylalanine/histidine ammonia-lyase (InterPro:IPR001106), L-Aspartase-like (InterPro:IPR008948), Phenylalanine ammonia-lyase (InterPro:IPR005922); BEST Arabidopsis thaliana protein match is: pal1 (Phe ammonia lyase 1); phenylalanine ammonia-lyase (TAIR:AT2G37040.1); Has 3125 Blast hits to 3120 proteins in 832 species: Archae - 21; Bacteria - 1672; Metazoa - 68; Fungi - 91; Plants - 781; Viruses - 0; Other Eukaryotes - 492 (source: NCBI BLink).  |
AT3G11050 | AT3G11050.1 | GGGTCGGGTT | ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT3G11130 | AT3G11130.1 | AACCCGACCCG | clathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G08530.1); Has 1310 Blast hits to 1193 proteins in 365 species: Archae - 0; Bacteria - 34; Metazoa - 776; Fungi - 123; Plants - 60; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).  |
AT3G12620 | AT3G12620.1 | GTCGGGTT | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2C (PP2C6) (TAIR:AT3G55050.2); Has 3612 Blast hits to 3610 proteins in 218 species: Archae - 0; Bacteria - 8; Metazoa - 1241; Fungi - 382; Plants - 1246; Viruses - 2; Other Eukaryotes - 733 (source: NCBI BLink).  |
AT3G12620.2 | GTCGGGTT | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2C (PP2C6) (TAIR:AT3G55050.2); Has 3612 Blast hits to 3610 proteins in 218 species: Archae - 0; Bacteria - 8; Metazoa - 1241; Fungi - 382; Plants - 1246; Viruses - 2; Other Eukaryotes - 733 (source: NCBI BLink).  | |
AT3G13677 | AT3G13677.1 | CCCGGGTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G13677.2 | CCCGGGTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G17660 | AT3G17660.1 | GTCGGGTT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14.  |
AT3G19515 | AT3G19515.2 | AACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23935.1); Has 489 Blast hits to 360 proteins in 69 species: Archae - 0; Bacteria - 3; Metazoa - 215; Fungi - 17; Plants - 81; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).  |
AT3G19810 | AT3G19810.1 | AACCCGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF177 (InterPro:IPR003772); Has 362 Blast hits to 362 proteins in 133 species: Archae - 0; Bacteria - 259; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT3G21290 | AT3G21290.1 | TTCGGGTCGGGTT | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink).  |
AT3G26340 | AT3G26340.1 | AACCCGACCCG | 20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
AT3G47500 | AT3G47500.1 | AACCCGACAACCCGACCCGGT | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.  |
AT3G48420 | AT3G48420.1 | AACCCGACCCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G39970.1); Has 7388 Blast hits to 7387 proteins in 1159 species: Archae - 34; Bacteria - 5445; Metazoa - 112; Fungi - 80; Plants - 209; Viruses - 3; Other Eukaryotes - 1505 (source: NCBI BLink).  |
AT3G50590 | AT3G50590.1 | AACCCGACCC | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G50690 | AT3G50690.1 | AACCCGACCCGAACCGA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink).  |
AT3G51130 | AT3G51130.1 | AACCCGACCCG | unknown protein; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0183 (InterPro:IPR005373); Has 201 Blast hits to 198 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 55; Plants - 18; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT3G57400 | AT3G57400.1 | AACCCGACCCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52500.1); Has 23 Blast hits to 23 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61060 | AT3G61060.1 | AACCCGACCCGACCCGA | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61060.2 | AACCCGACCCGACCCGA | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G62600 | AT3G62600.1 | GTACACGTAACCCGACC | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.  |
AT4G00090 | AT4G00090.1 | AACCCGACCCGACCCGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).  |
AT4G00320 | AT4G00320.1 | CCCATTTAACCCGACGGTTTAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein-related (TAIR:AT5G41830.1); Has 1116 Blast hits to 1083 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1116; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02920 | AT4G02920.1 | GTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03340.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02920.2 | GTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03340.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G08310 | AT4G08310.1 | TTTAACCGAACCCGACCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink).  |
AT4G11010 | AT4G11010.1 | AACCCGACCCGAA | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria  |
AT4G14600 | AT4G14600.1 | CCCATTAACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G15240 | AT4G15240.1 | AACCCGACC | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G17300 | AT4G17300.1 | GGTCGGGTT | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis.  |
AT4G18780 | AT4G18780.1 | AACCCGACCCGAATAAACCGGAT | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling.  |
AT4G22380 | AT4G22380.1 | AACCCGACCCGA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1361 Blast hits to 1361 proteins in 295 species: Archae - 226; Bacteria - 7; Metazoa - 464; Fungi - 191; Plants - 162; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink).  |
AT4G22850 | AT4G22850.1 | AACCCGACCCGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  |
AT4G22850.2 | AACCCGACCCGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  | |
AT4G29120 | AT4G29120.1 | AACCCGACGTCGTT | 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, phosphogluconate dehydrogenase (decarboxylating) activity, binding, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 12459 Blast hits to 12442 proteins in 1308 species: Archae - 93; Bacteria - 6200; Metazoa - 393; Fungi - 342; Plants - 184; Viruses - 2; Other Eukaryotes - 5245 (source: NCBI BLink).  |
AT4G31200 | AT4G31200.1 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  |
AT4G31200.2 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31200.3 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31210 | AT4G31210.1 | AACCCGACCCGAA | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink).  |
AT5G11090 | AT5G11090.1 | AACCCGAC | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1617 Blast hits to 241 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 631; Fungi - 53; Plants - 88; Viruses - 0; Other Eukaryotes - 841 (source: NCBI BLink).  |
AT5G13850 | AT5G13850.1 | AACCCGAC | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT3G12390.1); Has 794 Blast hits to 784 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 341; Fungi - 176; Plants - 104; Viruses - 14; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT5G45390 | AT5G45390.1 | AACCCGACCCG | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT5G46840 | AT5G46840.2 | AACCCGACCCGGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink).  |
AT5G48240 | AT5G48240.1 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
AT5G48240.2 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  | |
AT5G48240.3 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  | |
AT5G57120 | AT5G57120.1 | CCGGGTCGGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  |
AT5G63400 | AT5G63400.1 | AACCCGACCCGGT | encodes a protein similar to adenylate kinase.  |
AT5G63400.2 | AACCCGACCCGGT | encodes a protein similar to adenylate kinase.  | |
AT5G64990 | AT5G64990.1 | GTCGGGTT | Arabidopsis Rab GTPase homolog H1a (AtRABH1a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab6-related (InterPro:IPR015600); BEST Arabidopsis thaliana protein match is: AtRABH1e (Arabidopsis Rab GTPase homolog H1e); GTP binding (TAIR:AT5G10260.1); Has 20677 Blast hits to 20650 proteins in 589 species: Archae - 19; Bacteria - 94; Metazoa - 11535; Fungi - 2391; Plants - 1785; Viruses - 19; Other Eukaryotes - 4834 (source: NCBI BLink).  |
AT5G67270 | AT5G67270.1 | GTCGGGTT | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis.  |