Organism | Arabidopsis thaliana | |
ID | AtREG582 | |
Sequence | CCGACTTA | |
Annotation | ||
PPDB Motif | CCGAC | DRE core, stress response |
PLACE Motif | CCGAC | Core of low temperature responsive element (LTRE) of cor15a gene in Arabidopsis (A.t.); A portion of repeat-C (C-repeat), TGGCCGAC, which is repeated twice in cor15a promoter (Baker et al., 1994); ABA responsiveness; Involved in cold induction of BN115 gene from winter Brassica napus; LTRE; See S000157, S000152; Light signaling mediated by phytochrome is necessary for cold- or drought- induced gene expression through the C/DRE in Arabidopsis; See S000152; |
Total Entry Count | 62 |
Locus | Gene model | Sequence | Description |
AT1G02660 | AT1G02660.1 | TAAGTCGG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink).  |
AT1G07170 | AT1G07170.1 | TAGCCCATATTAAGTCGG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT1G07170.2 | TAGCCCATATTAAGTCGG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT1G08840 | AT1G08840.1 | GACCGACTTA | embryo defective 2411 (emb2411); FUNCTIONS IN: ATP-dependent DNA helicase activity, DNA binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA replication factor Dna2 (InterPro:IPR014808); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G03270.1); Has 4081 Blast hits to 3639 proteins in 571 species: Archae - 158; Bacteria - 979; Metazoa - 1088; Fungi - 747; Plants - 269; Viruses - 30; Other Eukaryotes - 810 (source: NCBI BLink).  |
AT1G08845 | AT1G08845.1 | TAAGTCGGTC | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: endomembrane system, ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G22450.1).  |
AT1G15420 | AT1G15420.1 | TAAGTCGGCCCAACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function NUC189, C-terminal (InterPro:IPR012979); Has 698 Blast hits to 572 proteins in 149 species: Archae - 0; Bacteria - 42; Metazoa - 236; Fungi - 117; Plants - 61; Viruses - 27; Other Eukaryotes - 215 (source: NCBI BLink).  |
AT1G16840 | AT1G16840.1 | TAAGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78890.1); Has 50 Blast hits to 50 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G16840.2 | TAAGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78890.1); Has 50 Blast hits to 50 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G16840.3 | TAAGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78890.1); Has 50 Blast hits to 50 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G16840.4 | TAAGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78890.1); Has 50 Blast hits to 50 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G19835 | AT1G19835.1 | CCGACTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF869, plant (InterPro:IPR008587); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47900.1); Has 44906 Blast hits to 23790 proteins in 1265 species: Archae - 546; Bacteria - 4089; Metazoa - 24989; Fungi - 3566; Plants - 1950; Viruses - 103; Other Eukaryotes - 9663 (source: NCBI BLink).  |
AT1G22985 | AT1G22985.1 | TAAGTCGGTT | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.  |
AT1G25370 | AT1G25370.1 | CCGACTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68340.1); Has 144 Blast hits to 144 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 143; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G48745 | AT1G48745.1 | TAAGTCGG | unknown protein; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G49160 | AT1G49160.1 | TAAGTCGG | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its  |
AT1G49160.2 | TAAGTCGG | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its  | |
AT1G61620 | AT1G61620.1 | CCGACTTA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Nitric oxide synthase-interacting (InterPro:IPR016818), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 380 Blast hits to 380 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 84; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT1G75950 | AT1G75950.1 | GACCGACTTA | SKP1 is core component of the SCF family of E3 ubiquitin ligases and serves to tether the rest of the complex to an F-box protein, which provides specificity in binding to ubiquitin ligase substrate proteins. Predominately expressed from leptotene to pachytene. Negatively regulates recombination. Interacts with P0, a silencing suppressor protein encoded by poleroviruses by means of a conserved minimal F-box motif.  |
AT1G77180 | AT1G77180.1 | TTAAACCGACTTA | Encodes a protein with a putative role in mRNA splicing.  |
AT1G77180.2 | TTAAACCGACTTA | Encodes a protein with a putative role in mRNA splicing.  | |
AT1G80410 | AT1G80410.1 | TAAGTCGGTT | EMBRYO DEFECTIVE 2753 (EMB2753); FUNCTIONS IN: binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 3255 Blast hits to 2440 proteins in 375 species: Archae - 356; Bacteria - 819; Metazoa - 489; Fungi - 174; Plants - 61; Viruses - 3; Other Eukaryotes - 1353 (source: NCBI BLink).  |
AT2G17380 | AT2G17380.1 | TAAGTCGGACCGTCAGA | Encodes clathrin assembly protein AP19.  |
AT2G35900 | AT2G35900.1 | TAAGTCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G43980 | AT2G43980.1 | CCGACTTA | inositol 1,3,4-trisphosphate 5/6-kinase 4 (AtITPK4); FUNCTIONS IN: magnesium ion binding, inositol-1,3,4-trisphosphate 5/6-kinase activity, catalytic activity, ATP binding, inositol tetrakisphosphate 1-kinase activity; INVOLVED IN: inositol trisphosphate metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATP-grasp fold (InterPro:IPR011761), Inositol-tetrakisphosphate 1-kinase, uncharacterised-N-terminal (InterPro:IPR017418), Inositol 1, 3, 4-trisphosphate 56-kinase (InterPro:IPR008656); BEST Arabidopsis thaliana protein match is: inositol 1,3,4-trisphosphate 5/6-kinase family protein (TAIR:AT4G08170.2); Has 282 Blast hits to 279 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 0; Plants - 168; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT2G43990 | AT2G43990.1 | TAAGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; Has 1359 Blast hits to 445 proteins in 113 species: Archae - 0; Bacteria - 186; Metazoa - 289; Fungi - 92; Plants - 21; Viruses - 2; Other Eukaryotes - 769 (source: NCBI BLink).  |
AT2G44578 | AT2G44578.1 | TAAGTCGG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G44581.1); Has 6429 Blast hits to 6413 proteins in 213 species: Archae - 0; Bacteria - 6; Metazoa - 2026; Fungi - 558; Plants - 2747; Viruses - 34; Other Eukaryotes - 1058 (source: NCBI BLink).  |
AT2G45150 | AT2G45150.3 | TAAGTCGG | phosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: phosphatidate cytidylyltransferase family protein (TAIR:AT3G60620.1); Has 4805 Blast hits to 4802 proteins in 1406 species: Archae - 0; Bacteria - 2678; Metazoa - 155; Fungi - 91; Plants - 82; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  |
AT2G46520 | AT2G46520.1 | AATAGCCCATTTAACCGACTTA | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT2G47840 | AT2G47840.1 | TAAGTCGGCCCAATTA | tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT3G07740 | AT3G07740.1 | CCGACTTA | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1  |
AT3G07740.2 | CCGACTTA | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1  | |
AT3G07740.3 | CCGACTTA | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1  | |
AT3G07750 | AT3G07750.1 | TAAGTCGG | 3' exoribonuclease family domain 1-containing protein; FUNCTIONS IN: 3'-5'-exoribonuclease activity, RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247); BEST Arabidopsis thaliana protein match is: RRP45a (Ribonuclease PH45a); 3'-5'-exoribonuclease/ RNA binding (TAIR:AT3G12990.2); Has 1078 Blast hits to 1076 proteins in 235 species: Archae - 205; Bacteria - 31; Metazoa - 296; Fungi - 206; Plants - 93; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT3G07750.2 | TAAGTCGG | 3' exoribonuclease family domain 1-containing protein; FUNCTIONS IN: 3'-5'-exoribonuclease activity, RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247); BEST Arabidopsis thaliana protein match is: RRP45a (Ribonuclease PH45a); 3'-5'-exoribonuclease/ RNA binding (TAIR:AT3G12990.2); Has 1078 Blast hits to 1076 proteins in 235 species: Archae - 205; Bacteria - 31; Metazoa - 296; Fungi - 206; Plants - 93; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT3G11590 | AT3G11590.1 | TTCGGTTTAAGTCGGTTTAC | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink).  |
AT3G19170 | AT3G19170.1 | CCGACTTA | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers  |
AT3G19580 | AT3G19580.1 | GACCGACTTA | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor.  |
AT3G19580.2 | GACCGACTTA | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor.  | |
AT3G26922 | AT3G26922.1 | CCGACTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G52680.2).  |
AT3G27380 | AT3G27380.1 | TAAGTCGG | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth.  |
AT3G27380.2 | TAAGTCGG | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth.  | |
AT3G51840 | AT3G51840.1 | CCGACTTAACCGGGTCGG | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis.  |
AT4G10050 | AT4G10050.1 | TAAGTCGG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073), Protein phosphatase methylesterase, eukaryotic (InterPro:IPR016812); Has 5040 Blast hits to 5015 proteins in 887 species: Archae - 30; Bacteria - 3229; Metazoa - 308; Fungi - 169; Plants - 67; Viruses - 7; Other Eukaryotes - 1230 (source: NCBI BLink).  |
AT4G14890 | AT4G14890.1 | TTCGGTTTAAGTCGGTTTTCGGTTT | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink).  |
AT4G32480 | AT4G32480.1 | CCGACTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20670.1); Has 203 Blast hits to 203 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 201; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G35730 | AT4G35730.1 | TAAGTCGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT4G38170 | AT4G38170.1 | AATAGGCCCGACTTA | FAR1-related sequence 9 (FRS9); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS5 (FAR1-related sequence 5); zinc ion binding (TAIR:AT4G38180.1); Has 575 Blast hits to 561 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 571; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10790 | AT5G10790.1 | TAAGTCGGTC | Encodes a ubiquitin-specific protease.  |
AT5G13650 | AT5G13650.1 | TAAGTCGG | elongation factor family protein; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein TypA (InterPro:IPR006298), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor family protein (TAIR:AT2G31060.2); Has 52040 Blast hits to 46861 proteins in 4222 species: Archae - 904; Bacteria - 26711; Metazoa - 3006; Fungi - 1714; Plants - 1188; Viruses - 0; Other Eukaryotes - 18517 (source: NCBI BLink).  |
AT5G13650.2 | TAAGTCGG | elongation factor family protein; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein TypA (InterPro:IPR006298), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor family protein (TAIR:AT2G31060.2); Has 52040 Blast hits to 46861 proteins in 4222 species: Archae - 904; Bacteria - 26711; Metazoa - 3006; Fungi - 1714; Plants - 1188; Viruses - 0; Other Eukaryotes - 18517 (source: NCBI BLink).  | |
AT5G27030 | AT5G27030.1 | TAAGTCGG | TOPLESS-RELATED 3 (TPR3); INVOLVED IN: primary shoot apical meristem specification; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594); BEST Arabidopsis thaliana protein match is: TPR2 (TOPLESS-RELATED 2) (TAIR:AT3G16830.1); Has 10032 Blast hits to 6372 proteins in 376 species: Archae - 24; Bacteria - 2655; Metazoa - 3380; Fungi - 1755; Plants - 716; Viruses - 0; Other Eukaryotes - 1502 (source: NCBI BLink).  |
AT5G27270 | AT5G27270.1 | AACCGACTTA | EMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink).  |
AT5G37780 | AT5G37780.1 | CCGACTTA | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness.  |
AT5G37780.2 | CCGACTTA | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness.  | |
AT5G37780.3 | CCGACTTA | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness.  | |
AT5G58020 | AT5G58020.1 | TAAGTCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF602 (InterPro:IPR006735); Has 270 Blast hits to 270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 71; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
AT5G60860 | AT5G60860.1 | TAAGTCGG | Arabidopsis Rab GTPase homolog A1f (AtRABA1f); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1g (Arabidopsis Rab GTPase homolog A1g); GTP binding (TAIR:AT3G15060.1); Has 21819 Blast hits to 21779 proteins in 607 species: Archae - 23; Bacteria - 103; Metazoa - 12072; Fungi - 2821; Plants - 1861; Viruses - 19; Other Eukaryotes - 4920 (source: NCBI BLink).  |
AT5G62130 | AT5G62130.1 | CCGACTTA | Per1-like protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like family protein (TAIR:AT1G16560.3); Has 243 Blast hits to 235 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 97; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G62910 | AT5G62910.1 | CCGACTTA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G48070.2); Has 652 Blast hits to 540 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 264; Fungi - 175; Plants - 76; Viruses - 4; Other Eukaryotes - 127 (source: NCBI BLink).  |
AT5G64310 | AT5G64310.1 | TAAGTCGGTC | Encodes arabinogalactan-protein (AGP1).  |
AT5G64500 | AT5G64500.1 | GACCGACTTA | membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: transporter-related (TAIR:AT2G22730.1); Has 8955 Blast hits to 8930 proteins in 1105 species: Archae - 134; Bacteria - 6267; Metazoa - 491; Fungi - 956; Plants - 74; Viruses - 0; Other Eukaryotes - 1033 (source: NCBI BLink).  |
AT5G67520 | AT5G67520.1 | CCGACTTA | adenylylsulfate kinase, putative; FUNCTIONS IN: kinase activity, transferase activity, transferring phosphorus-containing groups, ATP binding; INVOLVED IN: sulfate assimilation; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Adenylylsulphate kinase, C-terminal (InterPro:IPR002891); BEST Arabidopsis thaliana protein match is: AKN2 (APS-kinase 2); ATP binding / adenylylsulfate kinase/ kinase/ transferase, transferring phosphorus-containing groups (TAIR:AT4G39940.1); Has 3571 Blast hits to 3571 proteins in 926 species: Archae - 35; Bacteria - 1801; Metazoa - 220; Fungi - 202; Plants - 70; Viruses - 2; Other Eukaryotes - 1241 (source: NCBI BLink).  |