Organism | Arabidopsis thaliana | |
ID | AtREG583 | |
Sequence | CACGTGAC | |
Annotation | ||
PPDB Motif | ACGT | bZIP-binding motif, environmental responses |
PLACE Motif | ACGT | ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis; | ACGTG | ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis; | CACGTG | "CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as transcriptional repressors of the Str promoter via direct interaction with the G-box; See S000345; Essential for expression of beta-phaseolin gene during embryogenesis in bean, tobacco, Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene expression via GCC box and non-GCC box cis-element (Myb1 (GTTAGTT) and G-box (CACGTG)); A prominent hit by in silico analysis in both induced and repressed phyA-responsive promoters (Hudson and Quail 2003); Review by Terzaghi WB, Cashmore AR. "Light-regulated transcription" in Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995); |
Total Entry Count | 192 |
Locus | Gene model | Sequence | Description |
AT1G02560 | AT1G02560.1 | AACACGTGACA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT1G02840 | AT1G02840.1 | CACGTGAC | SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.  |
AT1G02840.1 | CACGTGAC | SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.  | |
AT1G02840.2 | CACGTGAC | SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.  | |
AT1G02840.2 | CACGTGAC | SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.  | |
AT1G02840.3 | CACGTGAC | SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.  | |
AT1G02840.3 | CACGTGAC | SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.  | |
AT1G02990 | AT1G02990.1 | CACACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).  |
AT1G02990.1 | TGTCACGTGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).  | |
AT1G02990.2 | CACACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).  | |
AT1G02990.2 | TGTCACGTGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).  | |
AT1G04630 | AT1G04630.1 | CACGTGACTCCACGTGAC | maternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G04635 | AT1G04635.1 | GTCACGTGGAGTCACGTG | EMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT1G08660 | AT1G08660.1 | GTCACGTGGG | glycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 29 (InterPro:IPR001675); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 29 protein / sialyltransferase family protein (TAIR:AT3G48820.1); Has 1458 Blast hits to 1454 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 1325; Fungi - 0; Plants - 90; Viruses - 11; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT1G08660.2 | GTCACGTGGG | glycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 29 (InterPro:IPR001675); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 29 protein / sialyltransferase family protein (TAIR:AT3G48820.1); Has 1458 Blast hits to 1454 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 1325; Fungi - 0; Plants - 90; Viruses - 11; Other Eukaryotes - 32 (source: NCBI BLink).  | |
AT1G09500 | AT1G09500.1 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase  |
AT1G09500.2 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase  | |
AT1G09500.3 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase  | |
AT1G16190 | AT1G16190.1 | TGTCACGTGCG | DNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink).  |
AT1G16540 | AT1G16540.1 | TGACACGTGACACG | Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. <i>sir</i> loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.  |
AT1G16570 | AT1G16570.1 | AGACACGTGAC | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).  |
AT1G16570.2 | AGACACGTGAC | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).  | |
AT1G16590 | AT1G16590.1 | GTCACGTGTCT | putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).  |
AT1G19110 | AT1G19110.1 | GTCACGTG | inter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
AT1G19110.1 | TTGCCACGTGAC | inter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  | |
AT1G19310 | AT1G19310.1 | GTCACGTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink).  |
AT1G22270 | AT1G22270.1 | GTCACGTGGCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78190.1); Has 289 Blast hits to 289 proteins in 134 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT1G22400 | AT1G22400.1 | TCACACGTGACGT | UGT85A1; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 5011 Blast hits to 4962 proteins in 308 species: Archae - 0; Bacteria - 100; Metazoa - 2040; Fungi - 16; Plants - 2764; Viruses - 58; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT1G24460 | AT1G24460.1 | GTCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31570.1); Has 146166 Blast hits to 64397 proteins in 2264 species: Archae - 2251; Bacteria - 28256; Metazoa - 66049; Fungi - 10658; Plants - 5728; Viruses - 891; Other Eukaryotes - 32333 (source: NCBI BLink).  |
AT1G27300 | AT1G27300.1 | TGTCACGTGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 36 Blast hits to 36 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G30290 | AT1G30290.1 | TGTCACGTGGCTT | unknown protein  |
AT1G31320 | AT1G31320.1 | TGTCACGTG | LOB DOMAIN-CONTAINING PROTEIN 4 (LBD4); INVOLVED IN: biological_process unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: ASL5; DNA binding / protein binding (TAIR:AT2G30130.1); Has 595 Blast hits to 592 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 595; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G35430 | AT1G35430.1 | CGCACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G50430 | AT1G50430.1 | CACGTGACACGTGGG | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype.  |
AT1G50430.2 | CACGTGACACGTGGG | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype.  | |
AT1G50440 | AT1G50440.1 | CCCACGTGTCACGTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT1G50440.2 | CCCACGTGTCACGTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).  | |
AT1G50440.3 | CCCACGTGTCACGTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).  | |
AT1G54100 | AT1G54100.1 | GGACACGTGACA | Aldehyde dehydrogenase  |
AT1G54100.2 | GGACACGTGACA | Aldehyde dehydrogenase  | |
AT1G59900 | AT1G59900.1 | TGTCACGTGAC | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC)  |
AT1G66500 | AT1G66500.1 | ACTGGGCCTATAAACCGTGGCCCAAAACACGTGACA | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT1G69010 | AT1G69010.1 | CACGTGAC | BES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G72650 | AT1G72650.1 | CACACGTGAC | Arabidopsis thaliana myb family transcription factor (At1g72650)  |
AT1G72650.2 | CACACGTGAC | Arabidopsis thaliana myb family transcription factor (At1g72650)  | |
AT1G76070 | AT1G76070.1 | GTCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20310.1); Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G77370 | AT1G77370.1 | TGTCACGTGTT | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink).  |
AT1G78900 | AT1G78900.1 | TGTCACGTGGCT | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.  |
AT1G78900.2 | TGTCACGTGGCT | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.  | |
AT1G79060 | AT1G79060.1 | CACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56020.1); Has 3270 Blast hits to 887 proteins in 158 species: Archae - 0; Bacteria - 617; Metazoa - 634; Fungi - 189; Plants - 72; Viruses - 8; Other Eukaryotes - 1750 (source: NCBI BLink).  |
AT1G79350 | AT1G79350.1 | GTCACGTGATGACACGTGA | embryo defective 1135 (EMB1135); FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: embryonic development ending in seed dormancy, regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, LSD1-type (InterPro:IPR005735), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: ATXR6; DNA binding / protein binding (TAIR:AT5G24330.1); Has 3516 Blast hits to 3129 proteins in 248 species: Archae - 2; Bacteria - 434; Metazoa - 2253; Fungi - 273; Plants - 285; Viruses - 34; Other Eukaryotes - 235 (source: NCBI BLink).  |
AT1G79650 | AT1G79650.1 | TGTCACGTGGAT | putative DNA repair protein RAD23  |
AT1G79650.2 | TGTCACGTGGAT | putative DNA repair protein RAD23  | |
AT1G79650.3 | TGTCACGTGGAT | putative DNA repair protein RAD23  | |
AT2G07050 | AT2G07050.1 | CACGTGACA | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol.  |
AT2G18193 | AT2G18193.1 | GTCACGTGTCAC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT2G18190.1); Has 15970 Blast hits to 14789 proteins in 1627 species: Archae - 790; Bacteria - 4301; Metazoa - 3207; Fungi - 2071; Plants - 1436; Viruses - 30; Other Eukaryotes - 4135 (source: NCBI BLink).  |
AT2G20480 | AT2G20480.1 | GTCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G20490 | AT2G20490.1 | TCACACGTGAC | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT2G20490.2 | TCACACGTGAC | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  | |
AT2G21660 | AT2G21660.1 | TGTCACGTG | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).  |
AT2G21660.2 | TGTCACGTG | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).  | |
AT2G29020 | AT2G29020.1 | TGTCACGTGCGTGGCAC | Rab5-interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rab5-interacting (InterPro:IPR010742); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59410.1); Has 144 Blast hits to 144 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT2G34650 | AT2G34650.1 | CACGTGACA | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.  |
AT2G36885 | AT2G36885.1 | GTCACGTGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT2G36885.2 | GTCACGTGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  | |
AT2G37550 | AT2G37550.1 | CACGTGACA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
AT2G37550.2 | CACGTGACA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  | |
AT2G37750 | AT2G37750.1 | ACGCCACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G38040 | AT2G38040.1 | GTCACGTGGGCACGTGCG | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis  |
AT2G38040.2 | GTCACGTGGGCACGTGCG | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis  | |
AT2G38130 | AT2G38130.1 | TGTCACGTGTG | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  |
AT2G38130.2 | TGTCACGTGTG | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  | |
AT2G38140 | AT2G38140.1 | CACACGTGACA | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete  |
AT2G43180 | AT2G43180.1 | CACGTGACA | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).  |
AT2G43180.2 | CACGTGACA | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).  | |
AT2G43180.3 | CACGTGACA | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).  | |
AT2G43180.4 | CACGTGACA | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).  | |
AT2G43600 | AT2G43600.1 | TGTCACGTG | glycoside hydrolase family 19 protein; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, sperm cell, root; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 19 protein (TAIR:AT1G56680.1); Has 1226 Blast hits to 1219 proteins in 250 species: Archae - 0; Bacteria - 187; Metazoa - 13; Fungi - 13; Plants - 976; Viruses - 1; Other Eukaryotes - 36 (source: NCBI BLink).  |
AT3G01370 | AT3G01370.1 | CACGTGACA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing.  |
AT3G01490 | AT3G01490.1 | GTCACGTGTA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT5G50000.1); Has 94023 Blast hits to 92834 proteins in 3425 species: Archae - 65; Bacteria - 7869; Metazoa - 41728; Fungi - 7866; Plants - 18963; Viruses - 594; Other Eukaryotes - 16938 (source: NCBI BLink).  |
AT3G03210 | AT3G03210.1 | GTCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G03210.1 | GTCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G03590 | AT3G03590.1 | ACGTCGTCACGTGGCAG | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT2G35605.1); Has 852 Blast hits to 809 proteins in 169 species: Archae - 0; Bacteria - 136; Metazoa - 165; Fungi - 132; Plants - 207; Viruses - 8; Other Eukaryotes - 204 (source: NCBI BLink).  |
AT3G04940 | AT3G04940.1 | GTCCACGTGAC | Encodes cysteine synthase CysD1.  |
AT3G05630 | AT3G05630.1 | GTACACGTGACA | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning.  |
AT3G08900 | AT3G08900.1 | GTCACGTG | Encodes a reversible autoglycosylated protein peripherally associated with cell membranes. Highly expressed in roots ans suspension-cultured cells.  |
AT3G09500 | AT3G09500.1 | GTCACGTGCG | 60S ribosomal protein L35 (RPL35A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 829 Blast hits to 829 proteins in 305 species: Archae - 115; Bacteria - 131; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).  |
AT3G09690 | AT3G09690.1 | GTCACGTG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT3G09690.2 | GTCACGTG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G11910 | AT3G11910.1 | GTCACGTGTA | UBIQUITIN-SPECIFIC PROTEASE 13 (UBP13); FUNCTIONS IN: ubiquitin-specific protease activity, ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (InterPro:IPR018200), MATH (InterPro:IPR002083), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: UBP12 (UBIQUITIN-SPECIFIC PROTEASE 12); ubiquitin thiolesterase/ ubiquitin-specific protease (TAIR:AT5G06600.1); Has 5914 Blast hits to 5327 proteins in 200 species: Archae - 0; Bacteria - 15; Metazoa - 3076; Fungi - 783; Plants - 832; Viruses - 7; Other Eukaryotes - 1201 (source: NCBI BLink).  |
AT3G12300 | AT3G12300.1 | CACACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT3G12600 | AT3G12600.1 | CCCACGTGACA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT3G12600.2 | CCCACGTGACA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G19420 | AT3G19420.1 | CCCACGTGAC | ARABIDOPSIS THALIANA PTEN 2 (ATPEN2); FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity; INVOLVED IN: dephosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN3 (ARABIDOPSIS THALIANA PTEN 3); phosphatase/ protein tyrosine phosphatase/ protein tyrosine/serine/threonine phosphatase (TAIR:AT3G50110.1); Has 4513 Blast hits to 1446 proteins in 192 species: Archae - 0; Bacteria - 143; Metazoa - 819; Fungi - 446; Plants - 71; Viruses - 4; Other Eukaryotes - 3030 (source: NCBI BLink).  |
AT3G19553 | AT3G19553.1 | CACGTGACA | amino acid permease family protein; FUNCTIONS IN: cationic amino acid transmembrane transporter activity; INVOLVED IN: amino acid transport, transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid/polyamine transporter I (InterPro:IPR002293), Amino acid permease-associated region (InterPro:IPR004841); BEST Arabidopsis thaliana protein match is: amino acid permease family protein (TAIR:AT1G31830.2); Has 9165 Blast hits to 9158 proteins in 1063 species: Archae - 186; Bacteria - 7195; Metazoa - 728; Fungi - 324; Plants - 200; Viruses - 0; Other Eukaryotes - 532 (source: NCBI BLink).  |
AT3G19590 | AT3G19590.1 | ACGTCACGTGGCAAT | WD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).  |
AT3G23230 | AT3G23230.1 | GTCACGTG | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.  |
AT3G25110 | AT3G25110.1 | GTCACGTG | Encodes a FatA acyl-ACP thioesterase  |
AT3G26618 | AT3G26618.1 | GTCACGTGTT | eukaryotic release factor 1-3 (ERF1-3); FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube, leaf; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: eRF1 domain 2 (InterPro:IPR005141), eRF1 domain 3 (InterPro:IPR005142), eRF1 domain 1 (InterPro:IPR005140), Peptide chain release factor eRF/aRF subunit 1 (InterPro:IPR004403); BEST Arabidopsis thaliana protein match is: ERF1-2 (EUKARYOTIC RELEASE FACTOR 1-2); translation release factor (TAIR:AT1G12920.1); Has 801 Blast hits to 799 proteins in 274 species: Archae - 191; Bacteria - 2; Metazoa - 164; Fungi - 97; Plants - 79; Viruses - 1; Other Eukaryotes - 267 (source: NCBI BLink).  |
AT3G27210 | AT3G27210.1 | GTGCCACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 132 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 65; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G27416 | AT3G27416.1 | GTCACGTGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 389 Blast hits to 362 proteins in 51 species: Archae - 0; Bacteria - 37; Metazoa - 207; Fungi - 19; Plants - 4; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).  |
AT3G32030 | AT3G32030.1 | ACCACGTGACA | terpene synthase/cyclase family protein; FUNCTIONS IN: lyase activity, magnesium ion binding; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Terpene synthase, metal-binding domain (InterPro:IPR005630), Terpenoid synthase (InterPro:IPR008949), Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Terpene synthase-like (InterPro:IPR001906); BEST Arabidopsis thaliana protein match is: terpene synthase/cyclase family protein (TAIR:AT3G14490.1); Has 1079 Blast hits to 1068 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1074; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT3G46620 | AT3G46620.1 | TGTCACGTGTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF1117 (InterPro:IPR010543); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G59550.1); Has 5953 Blast hits to 5931 proteins in 209 species: Archae - 0; Bacteria - 6; Metazoa - 2088; Fungi - 498; Plants - 2518; Viruses - 31; Other Eukaryotes - 812 (source: NCBI BLink).  |
AT3G48560 | AT3G48560.1 | GTCACGTG | Catalyzes the formation of acetolactate from pyruvate, the first step in valine and isoleucine biosynthesis. Requires FAD, thiamine pyrophosphate and Mg. Inhibited by the sulphonylurea herbicide, chlorsulphuron, and the imidazolinone herbicide, imazapyr. The obtained crystal structure of acetohydroxyacid synthase AHAS, EC 2.2.1.6)in complex with herbicides of the sulphonylurea and imidazolinone family reveals the molecular basis for substrate/inhibitor binding.  |
AT3G49260 | AT3G49260.1 | AACGGCGTTTAACCGAACCCCACGTGAC | IQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT3G49260.2 | AACGGCGTTTAACCGAACCCCACGTGAC | IQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  | |
AT3G51880 | AT3G51880.1 | GTCACGTG | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  |
AT3G51880.2 | GTCACGTG | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  | |
AT3G51880.3 | GTCACGTG | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  | |
AT3G54500 | AT3G54500.1 | CACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G54500.2 | CACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT3G54650 | AT3G54650.1 | ACCACGTGACGTG | FBL17; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: embryonic development, generative cell mitosis, seed development, pollen development, ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 1265 Blast hits to 887 proteins in 101 species: Archae - 0; Bacteria - 21; Metazoa - 649; Fungi - 49; Plants - 355; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  |
AT3G54960 | AT3G54960.1 | ATCCACGTGAC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.  |
AT3G54960.2 | ATCCACGTGAC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.  | |
AT3G55140 | AT3G55140.1 | GTCCACGTGAC | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT3G55140.2 | GTCCACGTGAC | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  | |
AT3G56010 | AT3G56010.1 | TGTCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9 Blast hits to 9 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G58700 | AT3G58700.1 | GTCACGTG | 60S ribosomal protein L11 (RPL11B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L11 (RPL11D) (TAIR:AT5G45775.2); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  |
AT3G59020 | AT3G59020.1 | TGTCACGTG | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Exportin-1/Importin-beta-like (InterPro:IPR013598), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: SAD2 (SUPER SENSITIVE TO ABA AND DROUGHT2); binding / protein transporter (TAIR:AT2G31660.1); Has 8195 Blast hits to 4966 proteins in 380 species: Archae - 40; Bacteria - 609; Metazoa - 2702; Fungi - 1410; Plants - 478; Viruses - 192; Other Eukaryotes - 2764 (source: NCBI BLink).  |
AT3G59020.2 | TGTCACGTG | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Exportin-1/Importin-beta-like (InterPro:IPR013598), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: SAD2 (SUPER SENSITIVE TO ABA AND DROUGHT2); binding / protein transporter (TAIR:AT2G31660.1); Has 8195 Blast hits to 4966 proteins in 380 species: Archae - 40; Bacteria - 609; Metazoa - 2702; Fungi - 1410; Plants - 478; Viruses - 192; Other Eukaryotes - 2764 (source: NCBI BLink).  | |
AT3G59340 | AT3G59340.1 | TGTCACGTGTTTCCACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink).  |
AT3G60410 | AT3G60410.1 | GTCACGTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 157 Blast hits to 157 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 2; Plants - 143; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G60410.2 | GTCACGTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 157 Blast hits to 157 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 2; Plants - 143; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G60410.3 | GTCACGTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 157 Blast hits to 157 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 2; Plants - 143; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G62110 | AT3G62110.1 | ACGCCACGTGTCACGTG | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT4G33440.1); Has 2594 Blast hits to 2590 proteins in 344 species: Archae - 2; Bacteria - 575; Metazoa - 8; Fungi - 1060; Plants - 840; Viruses - 2; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT3G63170 | AT3G63170.1 | GTCACGTG | chalcone isomerase; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase (InterPro:IPR016087); BEST Arabidopsis thaliana protein match is: chalcone isomerase (TAIR:AT2G26310.1); Has 67 Blast hits to 67 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G00026 | AT4G00026.1 | GTCACGTGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); Has 168 Blast hits to 168 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 52; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G00030 | AT4G00030.1 | AGACACGTGAC | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 126 Blast hits to 126 proteins in 26 species: Archae - 0; Bacteria - 11; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G01410 | AT4G01410.1 | GTCACGTG | harpin-induced family protein / HIN1 family protein / harpin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: hairpin-responsive protein, putative (HIN1) (TAIR:AT5G06330.1); Has 643 Blast hits to 643 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 643; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02425 | AT4G02425.1 | GTCACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 16 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02430 | AT4G02430.1 | GTCACGTG | pre-mRNA splicing factor, putative / SR1 protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SR1; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT1G02840.3); Has 21454 Blast hits to 14252 proteins in 615 species: Archae - 10; Bacteria - 760; Metazoa - 14239; Fungi - 1994; Plants - 2024; Viruses - 303; Other Eukaryotes - 2124 (source: NCBI BLink).  |
AT4G02430.2 | GTCACGTG | pre-mRNA splicing factor, putative / SR1 protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SR1; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT1G02840.3); Has 21454 Blast hits to 14252 proteins in 615 species: Archae - 10; Bacteria - 760; Metazoa - 14239; Fungi - 1994; Plants - 2024; Viruses - 303; Other Eukaryotes - 2124 (source: NCBI BLink).  | |
AT4G05180 | AT4G05180.1 | AGCCACGTGACA | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  |
AT4G08230 | AT4G08230.1 | ATGCCACGTGACA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; Has 13979 Blast hits to 5534 proteins in 565 species: Archae - 19; Bacteria - 2070; Metazoa - 5921; Fungi - 772; Plants - 3540; Viruses - 122; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G11220 | AT4G11220.1 | TACACGTGAC | VIRB2-INTERACTING PROTEIN 2 (BTI2); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: BTI1 (VIRB2-INTERACTING PROTEIN 1) (TAIR:AT4G23630.1); Has 982 Blast hits to 982 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 664; Fungi - 12; Plants - 283; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT4G11240 | AT4G11240.1 | TGTCACGTGAC | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers.  |
AT4G11570 | AT4G11570.1 | ACACGTGAC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
AT4G11570.2 | ACACGTGAC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  | |
AT4G13050 | AT4G13050.1 | GTCACGTG | acyl-(acyl carrier protein) thioesterase, putative / acyl-ACP thioesterase, putative / oleoyl-(acyl-carrier protein) hydrolase, putative / S-acyl fatty acid synthase thioesterase, putative; FUNCTIONS IN: acyl carrier activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-ACP thioesterase (InterPro:IPR002864); BEST Arabidopsis thaliana protein match is: AtFaTA (Arabidopsis FatA acyl-ACP thioesterase); acyl carrier/ acyl-[acyl-carrier-protein] hydrolase (TAIR:AT3G25110.1); Has 601 Blast hits to 601 proteins in 228 species: Archae - 0; Bacteria - 383; Metazoa - 2; Fungi - 0; Plants - 209; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT4G13160 | AT4G13160.1 | TGTCACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13630.1); Has 3849 Blast hits to 2651 proteins in 230 species: Archae - 12; Bacteria - 138; Metazoa - 1303; Fungi - 201; Plants - 240; Viruses - 104; Other Eukaryotes - 1851 (source: NCBI BLink).  |
AT4G16500 | AT4G16500.1 | GTACACGTGAC | cysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G17640 | AT4G17640.1 | GTCACGTG | Encodes casein kinase II beta (regulatory) subunit.  |
AT4G18230 | AT4G18230.1 | GTCACGTGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Oligosaccharide biosynthesis protein Alg14 like (InterPro:IPR013969); Has 453 Blast hits to 453 proteins in 176 species: Archae - 4; Bacteria - 199; Metazoa - 76; Fungi - 83; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT4G18950 | AT4G18950.1 | CACGTGACA | ankyrin protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: regulation of signal transduction, protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Integrin-linked protein kinase (InterPro:IPR016253), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin protein kinase, putative (TAIR:AT3G58760.1); Has 116131 Blast hits to 99643 proteins in 3446 species: Archae - 96; Bacteria - 9447; Metazoa - 52988; Fungi - 8496; Plants - 19258; Viruses - 634; Other Eukaryotes - 25212 (source: NCBI BLink).  |
AT4G19010 | AT4G19010.1 | TGTCACGTGTCACACGTGA | 4-coumarate--CoA ligase family protein / 4-coumaroyl-CoA synthase family protein; FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: OPCL1 (OPC-8:0 COA LIGASE1); 4-coumarate-CoA ligase (TAIR:AT1G20510.1); Has 54010 Blast hits to 49832 proteins in 2259 species: Archae - 568; Bacteria - 29489; Metazoa - 2956; Fungi - 3088; Plants - 1314; Viruses - 1; Other Eukaryotes - 16594 (source: NCBI BLink).  |
AT4G19020 | AT4G19020.1 | TCACGTGTGACACGTGACA | chromomethylase 2 (CMT2); FUNCTIONS IN: chromatin binding, DNA binding; INVOLVED IN: chromatin assembly or disassembly, DNA methylation; LOCATED IN: chromatin, nucleus; CONTAINS InterPro DOMAIN/s: C-5 cytosine-specific DNA methylase (InterPro:IPR001525), Bromo adjacent region (InterPro:IPR001025), Chromo domain-like (InterPro:IPR016197), Chromo domain (InterPro:IPR000953); BEST Arabidopsis thaliana protein match is: CMT3 (chromomethylase 3); DNA (cytosine-5-)-methyltransferase (TAIR:AT1G69770.1); Has 3518 Blast hits to 3037 proteins in 617 species: Archae - 106; Bacteria - 1441; Metazoa - 665; Fungi - 229; Plants - 237; Viruses - 21; Other Eukaryotes - 819 (source: NCBI BLink).  |
AT4G25140 | AT4G25140.1 | TGACACGTGAC | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds.  |
AT4G25260 | AT4G25260.1 | GTCACGTG | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: shade avoidance; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein / DC 1.2 homolog (FL5-2I22) (TAIR:AT5G62350.1); Has 406 Blast hits to 401 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 406; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G26840 | AT4G26840.1 | CACGTCACGTG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets.  |
AT4G28440 | AT4G28440.1 | TGACACGTGACA | DNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT2G33845.1); Has 124 Blast hits to 124 proteins in 29 species: Archae - 14; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT4G29740 | AT4G29740.1 | CACGTGACA | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.  |
AT4G29740.2 | CACGTGACA | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.  | |
AT4G30650 | AT4G30650.1 | GTCACGTG | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: response to salt stress, hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT4G30660.2); Has 838 Blast hits to 838 proteins in 286 species: Archae - 0; Bacteria - 373; Metazoa - 44; Fungi - 213; Plants - 182; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT4G31290 | AT4G31290.1 | GTCACGTGAC | ChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink).  |
AT4G32272 | AT4G32272.1 | AACACGTGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  |
AT4G35000 | AT4G35000.1 | GTCACGTG | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein.  |
AT4G37420 | AT4G37420.1 | GTGCCACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27200.1); Has 141 Blast hits to 141 proteins in 46 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT4G37460 | AT4G37460.1 | GTCACGTGAC | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity.  |
AT5G01300 | AT5G01300.1 | GTCACGTGGCGT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT5G01300.2 | GTCACGTGGCGT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  | |
AT5G02770 | AT5G02770.1 | GTCACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).  |
AT5G03630 | AT5G03630.1 | TGTCACGTGTT | ATMDAR2; FUNCTIONS IN: monodehydroascorbate reductase (NADH) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), FAD/NAD-linked reductase, dimerisation (InterPro:IPR016156); BEST Arabidopsis thaliana protein match is: MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) (TAIR:AT3G09940.1); Has 15548 Blast hits to 15528 proteins in 1711 species: Archae - 317; Bacteria - 10742; Metazoa - 673; Fungi - 378; Plants - 332; Viruses - 0; Other Eukaryotes - 3106 (source: NCBI BLink).  |
AT5G04830 | AT5G04830.1 | TGTCACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 53 Blast hits to 51 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 21; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G04830.2 | TGTCACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 53 Blast hits to 51 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 21; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G05480 | AT5G05480.1 | CACACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14920.1); Has 138 Blast hits to 128 proteins in 53 species: Archae - 12; Bacteria - 7; Metazoa - 0; Fungi - 66; Plants - 50; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G05540 | AT5G05540.1 | GTCACGTG | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT5G05540.2 | GTCACGTG | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  | |
AT5G10950 | AT5G10950.1 | GTCACGTGTCGTT | cylicin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31880.1); Has 53385 Blast hits to 29505 proteins in 1133 species: Archae - 108; Bacteria - 5328; Metazoa - 20730; Fungi - 6690; Plants - 2205; Viruses - 416; Other Eukaryotes - 17908 (source: NCBI BLink).  |
AT5G12980 | AT5G12980.1 | CACGTGACA | rcd1-like cell differentiation protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cell differentiation, Rcd1-like (InterPro:IPR007216); BEST Arabidopsis thaliana protein match is: rcd1-like cell differentiation protein, putative (TAIR:AT3G20800.1); Has 356 Blast hits to 353 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 87; Plants - 65; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT5G12980.1 | GTCACGTG | rcd1-like cell differentiation protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cell differentiation, Rcd1-like (InterPro:IPR007216); BEST Arabidopsis thaliana protein match is: rcd1-like cell differentiation protein, putative (TAIR:AT3G20800.1); Has 356 Blast hits to 353 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 87; Plants - 65; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT5G12980.1 | GTCACGTG | rcd1-like cell differentiation protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cell differentiation, Rcd1-like (InterPro:IPR007216); BEST Arabidopsis thaliana protein match is: rcd1-like cell differentiation protein, putative (TAIR:AT3G20800.1); Has 356 Blast hits to 353 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 87; Plants - 65; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT5G13880 | AT5G13880.1 | GTCACGTGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47920.1); Has 35 Blast hits to 35 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G16210 | AT5G16210.1 | AACACGTGACA | HEAT repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), LisH dimerisation motif (InterPro:IPR006594), Armadillo-type fold (InterPro:IPR016024); Has 5435 Blast hits to 4228 proteins in 406 species: Archae - 36; Bacteria - 578; Metazoa - 2571; Fungi - 341; Plants - 173; Viruses - 14; Other Eukaryotes - 1722 (source: NCBI BLink).  |
AT5G17650 | AT5G17650.1 | GTCACGTGAC | glycine/proline-rich protein; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; Has 8612 Blast hits to 5536 proteins in 501 species: Archae - 4; Bacteria - 1051; Metazoa - 4454; Fungi - 1160; Plants - 1109; Viruses - 38; Other Eukaryotes - 796 (source: NCBI BLink).  |
AT5G26600 | AT5G26600.1 | GTCACGTG | catalytic/ pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase, class V/Cysteine desulfurase (InterPro:IPR000192), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: epimerase-related (TAIR:AT3G62130.1); Has 3925 Blast hits to 3925 proteins in 952 species: Archae - 92; Bacteria - 2185; Metazoa - 19; Fungi - 114; Plants - 63; Viruses - 1; Other Eukaryotes - 1451 (source: NCBI BLink).  |
AT5G26600.2 | GTCACGTG | catalytic/ pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase, class V/Cysteine desulfurase (InterPro:IPR000192), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: epimerase-related (TAIR:AT3G62130.1); Has 3925 Blast hits to 3925 proteins in 952 species: Archae - 92; Bacteria - 2185; Metazoa - 19; Fungi - 114; Plants - 63; Viruses - 1; Other Eukaryotes - 1451 (source: NCBI BLink).  | |
AT5G43750 | AT5G43750.1 | TTCCACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G47090 | AT5G47090.1 | TGTCACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2052, coiled-coil (InterPro:IPR018613); Has 8880 Blast hits to 4216 proteins in 240 species: Archae - 24; Bacteria - 100; Metazoa - 5830; Fungi - 499; Plants - 280; Viruses - 264; Other Eukaryotes - 1883 (source: NCBI BLink).  |
AT5G48385 | AT5G48385.1 | CACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 987 Blast hits to 921 proteins in 78 species: Archae - 0; Bacteria - 16; Metazoa - 58; Fungi - 7; Plants - 873; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT5G49440 | AT5G49440.1 | TGTCACGTGTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, inflorescence meristem, root; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G50840 | AT5G50840.1 | GTCACGTG | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT5G59210.1); Has 48881 Blast hits to 26998 proteins in 1148 species: Archae - 400; Bacteria - 3488; Metazoa - 25141; Fungi - 2545; Plants - 1208; Viruses - 169; Other Eukaryotes - 15930 (source: NCBI BLink).  |
AT5G50840.2 | GTCACGTG | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT5G59210.1); Has 48881 Blast hits to 26998 proteins in 1148 species: Archae - 400; Bacteria - 3488; Metazoa - 25141; Fungi - 2545; Plants - 1208; Viruses - 169; Other Eukaryotes - 15930 (source: NCBI BLink).  | |
AT5G54110 | AT5G54110.1 | AACACGTGAC | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking.  |
AT5G54930 | AT5G54930.1 | CACGTGAC | AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G54930.2 | CACGTGAC | AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G54960 | AT5G54960.1 | GTCACGTGGT | pyruvate decarboxylase-2  |
AT5G59910 | AT5G59910.1 | GTCACGTGTGA | HTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink).  |
AT5G60410 | AT5G60410.1 | CACGTGAC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
AT5G60410.2 | CACGTGAC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G60410.3 | CACGTGAC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G60410.4 | CACGTGAC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G60410.5 | CACGTGAC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |