| Locus | Gene model | Sequence | Description |
| AT1G01470 | AT1G01470.1 | TCACACGT | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against dessication. |
| AT1G01500 | AT1G01500.1 | TCACACGTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01900 | AT1G01900.1 | TCACACGTCAC | Encodes AtSBT1.1, a subtilisin-like serine protease. Cleaves the phytosulfokine AtPSK4, a growth promoting peptide. |
| AT1G07985 | AT1G07985.1 | AACACGTGTGA | Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 33 Blast hits to 33 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G09500 | AT1G09500.1 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G09500.2 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G09500.3 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G09870 | AT1G09870.1 | ACGTGTGA | histidine acid phosphatase family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Histidine acid phosphatase, eukaryotic (InterPro:IPR016274); Has 574 Blast hits to 569 proteins in 162 species: Archae - 0; Bacteria - 75; Metazoa - 167; Fungi - 277; Plants - 29; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G09932 | AT1G09932.1 | TGACGTGTGA | phosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT1G09932.2 | TGACGTGTGA | phosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT1G11400 | AT1G11400.1 | ACGTGTGA | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G11400.2 | ACGTGTGA | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G11400.3 | ACGTGTGA | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G12250 | AT1G12250.1 | TCACACGTG | thylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink). |
| AT1G12250.2 | TCACACGTG | thylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink). |
| AT1G14730 | AT1G14730.1 | ACGTGTGA | LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome b561, eukaryote (InterPro:IPR004877), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: ACYB-1; carbon-monoxide oxygenase (TAIR:AT5G38630.1); Has 447 Blast hits to 446 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 321; Fungi - 5; Plants - 110; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G16710 | AT1G16710.1 | TCACACGTGCGACATCG | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
| AT1G17100 | AT1G17100.1 | TCACACGT | SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT1G78450.1); Has 1175 Blast hits to 1144 proteins in 91 species: Archae - 10; Bacteria - 83; Metazoa - 242; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT1G17110 | AT1G17110.1 | TAATTACGTGTGA | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. |
| AT1G19650 | AT1G19650.1 | ACGTGTGA | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT1G19650.2 | ACGTGTGA | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT1G20130 | AT1G20130.1 | ACGTGTGA | hydrolase, acting on ester bonds / lipase/ structural constituent of cell wall; FUNCTIONS IN: structural constituent of cell wall, lipase activity, hydrolase activity, acting on ester bonds; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Pistil-specific extensin-like protein (InterPro:IPR003882), Lipase, GDSL, active site (InterPro:IPR008265), Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: hydrolase, acting on ester bonds / lipase (TAIR:AT1G20132.1); Has 281578 Blast hits to 80004 proteins in 2359 species: Archae - 1215; Bacteria - 68733; Metazoa - 101691; Fungi - 27522; Plants - 27422; Viruses - 8283; Other Eukaryotes - 46712 (source: NCBI BLink). |
| AT1G22400 | AT1G22400.1 | TCACACGTGACGT | UGT85A1; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 5011 Blast hits to 4962 proteins in 308 species: Archae - 0; Bacteria - 100; Metazoa - 2040; Fungi - 16; Plants - 2764; Viruses - 58; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT1G22500 | AT1G22500.1 | TCACACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: stem, cotyledon, root, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G72200.1); Has 6507 Blast hits to 6490 proteins in 222 species: Archae - 0; Bacteria - 2; Metazoa - 2224; Fungi - 542; Plants - 2639; Viruses - 59; Other Eukaryotes - 1041 (source: NCBI BLink). |
| AT1G26150 | AT1G26150.1 | TCACACGT | PROLINE-RICH EXTENSIN-LIKE RECEPTOR KINASE 10 (PERK10); FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G68690.1); Has 437812 Blast hits to 190668 proteins in 4392 species: Archae - 931; Bacteria - 74625; Metazoa - 185213; Fungi - 57061; Plants - 50943; Viruses - 9960; Other Eukaryotes - 59079 (source: NCBI BLink). |
| AT1G26820 | AT1G26820.1 | TCACACGTCACG | Encodes ribonuclease RNS3. |
| AT1G27350 | AT1G27350.1 | TCACACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G27461 | AT1G27461.1 | TCACACGTGTCC | unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G27760 | AT1G27760.1 | AGCCACGTGTGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G27760.2 | AGCCACGTGTGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G27760.3 | AGCCACGTGTGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G28375 | AT1G28375.1 | ACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G32460 | AT1G32460.1 | ACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 12 Blast hits to 12 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G37130 | AT1G37130.1 | ACGTGTGA | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. |
| AT1G47970 | AT1G47970.1 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink). |
| AT1G49720 | AT1G49720.1 | TCACACGT | Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses. |
| AT1G49840 | AT1G49840.1 | TCACACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19540.1); Has 110 Blast hits to 108 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G52710 | AT1G52710.1 | TCACACGTG | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial envelope; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT3G15640.2); Has 219 Blast hits to 219 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 17; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT1G56440 | AT1G56440.1 | TCACACGT | serine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). |
| AT1G56450 | AT1G56450.1 | ACGTGTGA | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds |
| AT1G64200 | AT1G64200.1 | AACACGTGTGA | VACUOLAR H+-ATPASE SUBUNIT E ISOFORM 3 (VHA-E3); FUNCTIONS IN: proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole, mitochondrial proton-transporting ATP synthase complex; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V1/A1 complex, subunit E (InterPro:IPR002842); BEST Arabidopsis thaliana protein match is: TUF (VACUOLAR ATP SYNTHASE SUBUNIT E1); proton-transporting ATPase, rotational mechanism (TAIR:AT4G11150.1); Has 579 Blast hits to 579 proteins in 214 species: Archae - 54; Bacteria - 8; Metazoa - 200; Fungi - 95; Plants - 83; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT1G65500 | AT1G65500.1 | TCACACGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65486.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G68110 | AT1G68110.1 | TCACACGTG | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G70700 | AT1G70700.1 | AACACGTGTGA | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70700.2 | AACACGTGTGA | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G73980 | AT1G73980.1 | GTGACGTGTGA | phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink). |
| AT1G73990 | AT1G73990.1 | TCACACGTCAC | Encodes a putative protease SppA (SppA). |
| AT1G77090 | AT1G77090.1 | TGACACGTGTGA | thylakoid lumenal 29.8 kDa protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 20 kDa protein (TAIR:AT3G56650.1); Has 139 Blast hits to 139 proteins in 25 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G78140 | AT1G78140.1 | CTGCCACGTGTGA | methyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT2G41040.1); Has 3459 Blast hits to 3458 proteins in 853 species: Archae - 143; Bacteria - 2524; Metazoa - 44; Fungi - 102; Plants - 117; Viruses - 0; Other Eukaryotes - 529 (source: NCBI BLink). |
| AT1G78150 | AT1G78150.1 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G78150.2 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02960 | AT2G02960.1 | TCACACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.2 | TCACACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.3 | TCACACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.4 | TCACACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.5 | TCACACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G05920 | AT2G05920.1 | CTAACGGTCACACGT | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink). |
| AT2G17350 | AT2G17350.1 | CACACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17360 | AT2G17360.1 | TCACACGTGTG | 40S ribosomal protein S4 (RPS4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT2G17790 | AT2G17790.1 | GTACACGTGTGA | VPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT2G18730 | AT2G18730.1 | TCACACGT | diacylglycerol kinase, putative; FUNCTIONS IN: diacylglycerol kinase activity; INVOLVED IN: activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol kinase, catalytic region (InterPro:IPR001206), Diacylglycerol kinase accessory region (InterPro:IPR000756), Diacylglycerol kinase, plant (InterPro:IPR016961); BEST Arabidopsis thaliana protein match is: ATDGK7 (Diacylglycerol kinase 7); diacylglycerol kinase (TAIR:AT4G30340.1); Has 1222 Blast hits to 1067 proteins in 153 species: Archae - 0; Bacteria - 98; Metazoa - 849; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT2G20260 | AT2G20260.1 | TCACACGTGTCAT | Encodes subunit E of photosystem I. |
| AT2G20480 | AT2G20480.1 | GTCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20490 | AT2G20490.1 | TCACACGTGAC | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G20490.2 | TCACACGTGAC | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G24360 | AT2G24360.1 | ACGTGTGA | serine/threonine/tyrosine kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G31170.3); Has 96787 Blast hits to 95023 proteins in 3525 species: Archae - 68; Bacteria - 8423; Metazoa - 42926; Fungi - 8081; Plants - 19355; Viruses - 602; Other Eukaryotes - 17332 (source: NCBI BLink). |
| AT2G28900 | AT2G28900.1 | ACGTGTGA | Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment. |
| AT2G33540 | AT2G33540.1 | TCACACGT | C-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3); FUNCTIONS IN: phosphoprotein phosphatase activity, CTD phosphatase activity; INVOLVED IN: response to salt stress; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FCP1-like phosphatase, phosphatase domain (InterPro:IPR011947), NLI interacting factor (InterPro:IPR004274), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4); phosphoprotein phosphatase (TAIR:AT5G58003.1); Has 1270 Blast hits to 886 proteins in 180 species: Archae - 0; Bacteria - 80; Metazoa - 438; Fungi - 191; Plants - 138; Viruses - 2; Other Eukaryotes - 421 (source: NCBI BLink). |
| AT2G34650 | AT2G34650.1 | TCACACGTGTCAT | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT2G36120 | AT2G36120.1 | TGTGGGCCTCAACGTGTGA | Encodes a glycine rich protein that is involved in leaf vascular patterning. dot1 mutants have an aberrant open-class venation pattern in leaves and cotyledons, as well as several other leaf development defects. |
| AT2G37100 | AT2G37100.1 | ACGTGTGA | protamine P1 family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: chromosome organization; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03110.1); Has 239 Blast hits to 225 proteins in 58 species: Archae - 0; Bacteria - 5; Metazoa - 125; Fungi - 23; Plants - 48; Viruses - 12; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G37210 | AT2G37210.1 | TCACGTGTGA | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
| AT2G38000 | AT2G38000.1 | TCACACGTGGCAAT | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G38040 | AT2G38040.1 | TCACACGT | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
| AT2G38040.2 | TCACACGT | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
| AT2G38620 | AT2G38620.1 | ACGTGTGA | Encodes a member of a plant specific family of cyclin dependent kinases. |
| AT2G38620.2 | ACGTGTGA | Encodes a member of a plant specific family of cyclin dependent kinases. |
| AT2G38650 | AT2G38650.1 | CACACGTGTGA | GALACTURONOSYLTRANSFERASE 7 (GAUT7); FUNCTIONS IN: polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: GAUT4 (Galacturonosyltransferase 4); polygalacturonate 4-alpha-galacturonosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT5G47780.1); Has 882 Blast hits to 876 proteins in 179 species: Archae - 0; Bacteria - 255; Metazoa - 131; Fungi - 43; Plants - 430; Viruses - 2; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT2G39000 | AT2G39000.1 | ACGTGTGA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 213 Blast hits to 213 proteins in 77 species: Archae - 10; Bacteria - 116; Metazoa - 3; Fungi - 4; Plants - 54; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G39000.2 | ACGTGTGA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 213 Blast hits to 213 proteins in 77 species: Archae - 10; Bacteria - 116; Metazoa - 3; Fungi - 4; Plants - 54; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G39000.3 | ACGTGTGA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 213 Blast hits to 213 proteins in 77 species: Archae - 10; Bacteria - 116; Metazoa - 3; Fungi - 4; Plants - 54; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G41110 | AT2G41110.1 | AACCGCGTGAACGTGTGA | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G41840 | AT2G41840.1 | ACGTGTGA | 40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae - 183; Bacteria - 3055; Metazoa - 2026; Fungi - 746; Plants - 385; Viruses - 17; Other Eukaryotes - 2632 (source: NCBI BLink). |
| AT2G43320 | AT2G43320.1 | ACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14000.1); Has 199 Blast hits to 194 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 98; Fungi - 25; Plants - 44; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT2G43320.2 | ACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14000.1); Has 199 Blast hits to 194 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 98; Fungi - 25; Plants - 44; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT2G43550 | AT2G43550.1 | GTGACGTGTGA | Encodes a defensin-like (DEFL) family protein. |
| AT2G43945 | AT2G43945.1 | TCACACGTGTGA | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59870.1); Has 245 Blast hits to 245 proteins in 63 species: Archae - 0; Bacteria - 102; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G46020 | AT2G46020.1 | TCACACGTGTCT | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT2G46020.2 | TCACACGTGTCT | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT2G46110 | AT2G46110.1 | CACGTCATCTCACACGTGTG | Encodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. |
| AT3G02910 | AT3G02910.1 | TCACACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Butirosin biosynthesis, BtrG-like (InterPro:IPR013024), AIG2-like (InterPro:IPR009288); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46720.1); Has 210 Blast hits to 210 proteins in 66 species: Archae - 2; Bacteria - 27; Metazoa - 122; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G04470 | AT3G04470.1 | TCACACGTGTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G04780.1); Has 842 Blast hits to 642 proteins in 95 species: Archae - 0; Bacteria - 6; Metazoa - 523; Fungi - 26; Plants - 165; Viruses - 4; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G06760 | AT3G06760.1 | TACACGTGTGA | INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: HRB1 (HYPERSENSITIVE TO RED AND BLUE); protein binding (TAIR:AT5G49230.1). |
| AT3G06760.2 | TACACGTGTGA | INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: HRB1 (HYPERSENSITIVE TO RED AND BLUE); protein binding (TAIR:AT5G49230.1). |
| AT3G06780 | AT3G06780.1 | TCACGTGTGA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4026 Blast hits to 2251 proteins in 290 species: Archae - 2; Bacteria - 737; Metazoa - 1865; Fungi - 196; Plants - 741; Viruses - 43; Other Eukaryotes - 442 (source: NCBI BLink). |
| AT3G10570 | AT3G10570.1 | TCACACGT | member of CYP77A |
| AT3G11150 | AT3G11150.1 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 262 Blast hits to 262 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 262; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G14590 | AT3G14590.1 | TCACACGTGTCTGACACGT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT3G14590.2 | TCACACGTGTCTGACACGT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT3G14810 | AT3G14810.1 | TCACACGT | MECHANOSENSITIVE CHANNEL OF SMALL CONDUCTANCE-LIKE 5 (MSL5); LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Membrane protein, At2g17000, predicted (InterPro:IPR016688), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: MSL4 (MECHANOSENSITIVE CHANNEL OF SMALL CONDUCTANCE-LIKE 4) (TAIR:AT1G53470.1); Has 2543 Blast hits to 2539 proteins in 750 species: Archae - 103; Bacteria - 1829; Metazoa - 6; Fungi - 124; Plants - 84; Viruses - 0; Other Eukaryotes - 397 (source: NCBI BLink). |
| AT3G15640 | AT3G15640.1 | TCACACGTACCGGTTAA | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G15640.2 | TCACACGTACCGGTTAA | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G15940 | AT3G15940.1 | AACACGTGTGA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G52420.1); Has 6481 Blast hits to 6467 proteins in 933 species: Archae - 176; Bacteria - 3946; Metazoa - 40; Fungi - 36; Plants - 110; Viruses - 0; Other Eukaryotes - 2173 (source: NCBI BLink). |
| AT3G15940.1 | TCACACGT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G52420.1); Has 6481 Blast hits to 6467 proteins in 933 species: Archae - 176; Bacteria - 3946; Metazoa - 40; Fungi - 36; Plants - 110; Viruses - 0; Other Eukaryotes - 2173 (source: NCBI BLink). |
| AT3G16520 | AT3G16520.1 | ACGTGTGA | UDP-GLUCOSYL TRANSFERASE 88A1 (UGT88A1); FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT72B3 (UDP-GLUCOSYL TRANSFERASE 72B3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G01420.1); Has 4707 Blast hits to 4683 proteins in 326 species: Archae - 0; Bacteria - 102; Metazoa - 1777; Fungi - 12; Plants - 2672; Viruses - 113; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT3G16520.2 | ACGTGTGA | UDP-GLUCOSYL TRANSFERASE 88A1 (UGT88A1); FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT72B3 (UDP-GLUCOSYL TRANSFERASE 72B3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G01420.1); Has 4707 Blast hits to 4683 proteins in 326 species: Archae - 0; Bacteria - 102; Metazoa - 1777; Fungi - 12; Plants - 2672; Viruses - 113; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT3G16520.3 | ACGTGTGA | UDP-GLUCOSYL TRANSFERASE 88A1 (UGT88A1); FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT72B3 (UDP-GLUCOSYL TRANSFERASE 72B3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G01420.1); Has 4707 Blast hits to 4683 proteins in 326 species: Archae - 0; Bacteria - 102; Metazoa - 1777; Fungi - 12; Plants - 2672; Viruses - 113; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT3G18710 | AT3G18710.1 | TCACACGTGTA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G21380 | AT3G21380.1 | ACGTGTGA | LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 1279 Blast hits to 507 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1276; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G24503 | AT3G24503.1 | GCTGACGTGTGA | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT3G30300 | AT3G30300.1 | TCACACGTGTCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: EDA30 (embryo sac development arrest 30) (TAIR:AT3G03810.1); Has 512 Blast hits to 417 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 512; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G45730 | AT3G45730.1 | TCACACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G45740 | AT3G45740.1 | TCACACGTGTCT | hydrolase family protein / HAD-superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIA, CECR5 (InterPro:IPR006353), HAD-superfamily hydrolase, subfamily IIA (InterPro:IPR006357); Has 367 Blast hits to 355 proteins in 105 species: Archae - 5; Bacteria - 2; Metazoa - 102; Fungi - 197; Plants - 14; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT3G52220 | AT3G52220.1 | ACGACACGTGTCACACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink). |
| AT3G52230 | AT3G52230.1 | AGACACGTGTGACACGTGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G53000 | AT3G53000.1 | TCACACGTCAC | Phloem protein 2-A15 (AtPP2-A15); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 289 Blast hits to 286 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G53450 | AT3G53450.1 | TCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37210.1); Has 3213 Blast hits to 3211 proteins in 782 species: Archae - 6; Bacteria - 1871; Metazoa - 10; Fungi - 79; Plants - 196; Viruses - 0; Other Eukaryotes - 1051 (source: NCBI BLink). |
| AT3G56800 | AT3G56800.1 | CCGCGTGAACGTGTGA | encodes a calmodulin |
| AT3G57860 | AT3G57860.1 | CACACGTGTGA | Plant specific-protein of unknown function, shares 62% homology with UVI4 at aa level. |
| AT3G58490 | AT3G58490.1 | TCACACGT | phosphatidic acid phosphatase family protein / PAP2 family protein; FUNCTIONS IN: sphingosine-1-phosphate phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to abscisic acid stimulus; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); Has 773 Blast hits to 773 proteins in 254 species: Archae - 11; Bacteria - 397; Metazoa - 113; Fungi - 97; Plants - 18; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT3G58490.2 | TCACACGT | phosphatidic acid phosphatase family protein / PAP2 family protein; FUNCTIONS IN: sphingosine-1-phosphate phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to abscisic acid stimulus; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); Has 773 Blast hits to 773 proteins in 254 species: Archae - 11; Bacteria - 397; Metazoa - 113; Fungi - 97; Plants - 18; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT3G59500 | AT3G59500.1 | TCACACGTGCG | integral membrane HRF1 family protein; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT1G30890.2); Has 337 Blast hits to 337 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 90; Plants - 38; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT3G59770 | AT3G59770.1 | TCACACGTGTCGT | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT4G01970 | AT4G01970.1 | ACGTGTGA | Encodes a putative stachyose synthetase. |
| AT4G02020 | AT4G02020.1 | TCACACGTGTG | Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleus endosperm proliferation within the FG. |
| AT4G03210 | AT4G03210.1 | TCACACGT | encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
| AT4G03210.2 | TCACACGT | encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
| AT4G11910 | AT4G11910.1 | TTAAAGCCACGTGTGA | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: NYE1 (NON-YELLOWING 1) (TAIR:AT4G22920.1); Has 130 Blast hits to 128 proteins in 45 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G11980 | AT4G11980.1 | TACACGTGTGA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 14 (ATNUDX14); FUNCTIONS IN: hydrolase activity, ADP-sugar diphosphatase activity, ADP-ribose pyrophosphohydrolase activity, ADP-glucose pyrophosphohydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 845 Blast hits to 845 proteins in 388 species: Archae - 4; Bacteria - 636; Metazoa - 8; Fungi - 51; Plants - 17; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT4G14270 | AT4G14270.1 | TCACACGTGGC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14270.2 | TCACACGTGGC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G16050 | AT4G16050.1 | TCACACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51538.1); Has 8168 Blast hits to 6033 proteins in 387 species: Archae - 10; Bacteria - 314; Metazoa - 2568; Fungi - 1035; Plants - 902; Viruses - 101; Other Eukaryotes - 3238 (source: NCBI BLink). |
| AT4G16660 | AT4G16660.1 | TCACACGTGGAA | heat shock protein 70, putative / HSP70, putative; FUNCTIONS IN: ATP binding; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: heat shock protein, putative (TAIR:AT1G11660.1); Has 18930 Blast hits to 18189 proteins in 2776 species: Archae - 119; Bacteria - 6307; Metazoa - 3629; Fungi - 1186; Plants - 638; Viruses - 97; Other Eukaryotes - 6954 (source: NCBI BLink). |
| AT4G16970 | AT4G16970.1 | TCACACGT | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: casein kinase II alpha chain, putative (TAIR:AT2G23070.1); Has 28325 Blast hits to 23063 proteins in 766 species: Archae - 4; Bacteria - 1025; Metazoa - 12500; Fungi - 3604; Plants - 4846; Viruses - 36; Other Eukaryotes - 6310 (source: NCBI BLink). |
| AT4G17560 | AT4G17560.1 | TCACACGTGCG | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink). |
| AT4G17615 | AT4G17615.1 | TCACACGTGCG | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT4G17970 | AT4G17970.1 | TCACACGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46610.1); Has 461 Blast hits to 451 proteins in 136 species: Archae - 0; Bacteria - 214; Metazoa - 0; Fungi - 11; Plants - 209; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G18010 | AT4G18010.1 | TCACACGT | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT4G18010.2 | TCACACGT | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT4G19003 | AT4G19003.1 | ACGTGTGA | VPS25; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; CONTAINS InterPro DOMAIN/s: ESCRT-II complex, vps25 subunit, N-terminal winged helix (InterPro:IPR014041), ESCRT-II complex, vps25 subunit, C-terminal winged helix (InterPro:IPR014040), ESCRT-II complex, vps25 subunit (InterPro:IPR008570); Has 237 Blast hits to 237 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 79; Plants - 22; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G19003.2 | ACGTGTGA | VPS25; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; CONTAINS InterPro DOMAIN/s: ESCRT-II complex, vps25 subunit, N-terminal winged helix (InterPro:IPR014041), ESCRT-II complex, vps25 subunit, C-terminal winged helix (InterPro:IPR014040), ESCRT-II complex, vps25 subunit (InterPro:IPR008570); Has 237 Blast hits to 237 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 79; Plants - 22; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G19010 | AT4G19010.1 | TGTCACGTGTCACACGTGA | 4-coumarate--CoA ligase family protein / 4-coumaroyl-CoA synthase family protein; FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: OPCL1 (OPC-8:0 COA LIGASE1); 4-coumarate-CoA ligase (TAIR:AT1G20510.1); Has 54010 Blast hits to 49832 proteins in 2259 species: Archae - 568; Bacteria - 29489; Metazoa - 2956; Fungi - 3088; Plants - 1314; Viruses - 1; Other Eukaryotes - 16594 (source: NCBI BLink). |
| AT4G19020 | AT4G19020.1 | TCACGTGTGACACGTGACA | chromomethylase 2 (CMT2); FUNCTIONS IN: chromatin binding, DNA binding; INVOLVED IN: chromatin assembly or disassembly, DNA methylation; LOCATED IN: chromatin, nucleus; CONTAINS InterPro DOMAIN/s: C-5 cytosine-specific DNA methylase (InterPro:IPR001525), Bromo adjacent region (InterPro:IPR001025), Chromo domain-like (InterPro:IPR016197), Chromo domain (InterPro:IPR000953); BEST Arabidopsis thaliana protein match is: CMT3 (chromomethylase 3); DNA (cytosine-5-)-methyltransferase (TAIR:AT1G69770.1); Has 3518 Blast hits to 3037 proteins in 617 species: Archae - 106; Bacteria - 1441; Metazoa - 665; Fungi - 229; Plants - 237; Viruses - 21; Other Eukaryotes - 819 (source: NCBI BLink). |
| AT4G20820 | AT4G20820.1 | ACGTGTGA | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44440.1); Has 2842 Blast hits to 2745 proteins in 457 species: Archae - 31; Bacteria - 1093; Metazoa - 31; Fungi - 1138; Plants - 356; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT4G21790 | AT4G21790.1 | ACGTGTGA | encodes a host factor that is required for TMV virus multiplication. |
| AT4G21850 | AT4G21850.1 | ACGTGTGA | methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G21830.1); Has 5873 Blast hits to 5872 proteins in 1229 species: Archae - 51; Bacteria - 2684; Metazoa - 217; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2727 (source: NCBI BLink). |
| AT4G21850.2 | ACGTGTGA | methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G21830.1); Has 5873 Blast hits to 5872 proteins in 1229 species: Archae - 51; Bacteria - 2684; Metazoa - 217; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2727 (source: NCBI BLink). |
| AT4G22810 | AT4G22810.1 | ACGTGTGA | DNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT4G12050.1); Has 474 Blast hits to 472 proteins in 38 species: Archae - 0; Bacteria - 4; Metazoa - 34; Fungi - 2; Plants - 424; Viruses - 2; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT4G23410 | AT4G23410.1 | ACGTGTGA | Member of TETRASPANIN family |
| AT4G24000 | AT4G24000.1 | TCACACGTGTCT | encodes a protein similar to cellulose synthase |
| AT4G24240 | AT4G24240.1 | TCACACGTGTA | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT4G30260 | AT4G30260.1 | TCACACGT | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT2G18840.1); Has 733 Blast hits to 718 proteins in 145 species: Archae - 0; Bacteria - 8; Metazoa - 377; Fungi - 147; Plants - 99; Viruses - 4; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G32050 | AT4G32050.1 | ACGTGTGA | neurochondrin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Neurochondrin (InterPro:IPR008709); Has 126 Blast hits to 126 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 5; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G32400 | AT4G32400.1 | TCACACGTGA | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT4G32640 | AT4G32640.1 | TGACGTGTGA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 78573 Blast hits to 39320 proteins in 1269 species: Archae - 50; Bacteria - 9353; Metazoa - 41001; Fungi - 10869; Plants - 6189; Viruses - 1516; Other Eukaryotes - 9595 (source: NCBI BLink). |
| AT4G32640.2 | TGACGTGTGA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 78573 Blast hits to 39320 proteins in 1269 species: Archae - 50; Bacteria - 9353; Metazoa - 41001; Fungi - 10869; Plants - 6189; Viruses - 1516; Other Eukaryotes - 9595 (source: NCBI BLink). |
| AT4G33890 | AT4G33890.1 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14850.1); Has 70 Blast hits to 68 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G33890.2 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14850.1); Has 70 Blast hits to 68 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G34380 | AT4G34380.1 | ACCACGTGTGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G18950.1); Has 22712 Blast hits to 12420 proteins in 443 species: Archae - 16; Bacteria - 3157; Metazoa - 9533; Fungi - 4921; Plants - 1930; Viruses - 0; Other Eukaryotes - 3155 (source: NCBI BLink). |
| AT4G36780 | AT4G36780.1 | TCACACGTGTA | transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BES1 (BRI1-EMS-SUPPRESSOR 1); protein binding / transcription factor/ transcription regulator (TAIR:AT1G19350.6); Has 110 Blast hits to 110 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G39800 | AT4G39800.1 | TCACGTGTGA | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G03204 | AT5G03204.1 | ACGTGTGA | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT5G03204.1 | TCACACGTGTT | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT5G03210 | AT5G03210.1 | ACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03210.1 | TCACACGTGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05600 | AT5G05600.1 | TCACACGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: response to salt stress; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G11180.1); Has 6078 Blast hits to 6039 proteins in 692 species: Archae - 0; Bacteria - 730; Metazoa - 123; Fungi - 674; Plants - 3117; Viruses - 0; Other Eukaryotes - 1434 (source: NCBI BLink). |
| AT5G07730 | AT5G07730.1 | ACGGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61360.1); Has 12 Blast hits to 12 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 7; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G08680 | AT5G08680.1 | TCACACGTGTCG | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G12110 | AT5G12110.1 | ACGTGTGA | elongation factor 1B alpha-subunit 1 (eEF1Balpha1); FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: eukaryotic translation elongation factor 1 complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1B alpha-subunit 2 (eEF1Balpha2) (TAIR:AT5G19510.1); Has 715 Blast hits to 715 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 374; Fungi - 104; Plants - 110; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT5G15800 | AT5G15800.1 | TCACACGTG | Encodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. |
| AT5G15800.2 | TCACACGTG | Encodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. |
| AT5G16750 | AT5G16750.1 | ACGTGTGA | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
| AT5G16760 | AT5G16760.1 | TCACACGT | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. |
| AT5G19120 | AT5G19120.1 | TCACACGTG | aspartic-type endopeptidase; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03220.1); Has 701 Blast hits to 699 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20070 | AT5G20070.1 | TGACACGTGTGA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 19 (ATNUDX19); FUNCTIONS IN: hydrolase activity, metal ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc ribbon, NADH pyrophosphatase (InterPro:IPR015376), NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 3177 Blast hits to 3177 proteins in 828 species: Archae - 24; Bacteria - 2086; Metazoa - 110; Fungi - 80; Plants - 32; Viruses - 2; Other Eukaryotes - 843 (source: NCBI BLink). |
| AT5G20940 | AT5G20940.1 | TCACACGT | glycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT5G20950.2); Has 5962 Blast hits to 5603 proteins in 865 species: Archae - 20; Bacteria - 2970; Metazoa - 6; Fungi - 880; Plants - 280; Viruses - 0; Other Eukaryotes - 1806 (source: NCBI BLink). |
| AT5G22580 | AT5G22580.1 | TCACACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: HS1 (HEAT STABLE PROTEIN 1) (TAIR:AT3G17210.1); Has 231 Blast hits to 231 proteins in 57 species: Archae - 0; Bacteria - 89; Metazoa - 0; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT5G24830 | AT5G24830.1 | TCACACGTG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae - 6; Bacteria - 14; Metazoa - 418; Fungi - 405; Plants - 20611; Viruses - 0; Other Eukaryotes - 881 (source: NCBI BLink). |
| AT5G25210 | AT5G25210.1 | TCACACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32030.1); Has 20 Blast hits to 20 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G35320 | AT5G35320.1 | TGACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G42990 | AT5G42990.1 | TAAACGACACGTGTGA | ubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink). |
| AT5G46420 | AT5G46420.1 | TCACACGTGA | 16S rRNA processing protein RimM family; FUNCTIONS IN: ribosome binding, nucleotidyltransferase activity; INVOLVED IN: metabolic process, rRNA processing, ribosome biogenesis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRC-barrel (InterPro:IPR007903), UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618), RimM protein (InterPro:IPR002676), 16S rRNA processing protein RimM (InterPro:IPR011961); BEST Arabidopsis thaliana protein match is: UDP-N-acetylglucosamine pyrophosphorylase-related (TAIR:AT1G31070.2); Has 3596 Blast hits to 3596 proteins in 1249 species: Archae - 0; Bacteria - 2487; Metazoa - 162; Fungi - 86; Plants - 59; Viruses - 0; Other Eukaryotes - 802 (source: NCBI BLink). |
| AT5G47530 | AT5G47530.1 | GGACACGTGTGA | auxin-responsive protein, putative; INVOLVED IN: multicellular organismal development; LOCATED IN: membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, C globular stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17280.1); Has 390 Blast hits to 390 proteins in 77 species: Archae - 0; Bacteria - 8; Metazoa - 85; Fungi - 33; Plants - 251; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT5G49230 | AT5G49230.1 | TCACACGTGTGA | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
| AT5G52990 | AT5G52990.1 | CACGTGTGA | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G56210 | AT5G56210.1 | TCACACGT | WPP-domain Interacting Protein 2 (WIP2); FUNCTIONS IN: protein heterodimerization activity, protein homodimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, cell plate; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 2090 Blast hits to 1631 proteins in 257 species: Archae - 16; Bacteria - 128; Metazoa - 915; Fungi - 176; Plants - 118; Viruses - 11; Other Eukaryotes - 726 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | AACACGTGTGA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | AACACGTGTGA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57785 | AT5G57785.1 | TCACACGTGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59910 | AT5G59910.1 | GTCACGTGTGA | HTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink). |
| AT5G61410 | AT5G61410.1 | TCACACGTGGCGG | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
| AT5G61410.2 | TCACACGTGGCGG | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
| AT5G61890 | AT5G61890.1 | TCACACGT | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G62910 | AT5G62910.1 | TCACACGTG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G48070.2); Has 652 Blast hits to 540 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 264; Fungi - 175; Plants - 76; Viruses - 4; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT5G64120 | AT5G64120.1 | TCACACGTCAT | encodes a cell wall bound peroxidase that is induced by hypo-osmolarity |
| AT5G65300 | AT5G65300.1 | TCACACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65340 | AT5G65340.1 | ACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G22460.1); Has 132 Blast hits to 132 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |