| Locus | Gene model | Sequence | Description |
| AT1G01500 | AT1G01500.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02850 | AT1G02850.1 | AAAAAGCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.2 | AAAAAGCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.3 | AAAAAGCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.4 | AAAAAGCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.5 | AAAAAGCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G03040 | AT1G03040.1 | AAAAAGCCCACT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G03106 | AT1G03106.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G04120 | AT1G04120.1 | AAAAAGCCCAAA | member of MRP subfamily |
| AT1G04510 | AT1G04510.1 | AAAAAGCC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04510.2 | AAAAAGCC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G05410 | AT1G05410.1 | CCGACCCGACCCGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G05410.2 | CCGACCCGACCCGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G06670 | AT1G06670.1 | TGGCCCAAAAGGCCCAAAAAGCCCAAAA | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins |
| AT1G07170 | AT1G07170.1 | AAAAAGCCCATCA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT1G07170.2 | AAAAAGCCCATCA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT1G07200 | AT1G07200.2 | GGCTTTTT | ATP-dependent Clp protease ClpB protein-related; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT2G29970.1); Has 8745 Blast hits to 8618 proteins in 1498 species: Archae - 9; Bacteria - 6193; Metazoa - 69; Fungi - 201; Plants - 318; Viruses - 0; Other Eukaryotes - 1955 (source: NCBI BLink). |
| AT1G07645 | AT1G07645.1 | AAAAAGCC | DESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G07660 | AT1G07660.1 | GGCTTTTT | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07660.2 | GGCTTTTT | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07920 | AT1G07920.1 | GGCTTTTT | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, nucleolus, plasma membrane, chloroplast, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink). |
| AT1G08050 | AT1G08050.1 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G60710.1); Has 2554 Blast hits to 2543 proteins in 408 species: Archae - 24; Bacteria - 857; Metazoa - 700; Fungi - 139; Plants - 381; Viruses - 4; Other Eukaryotes - 449 (source: NCBI BLink). |
| AT1G08320 | AT1G08320.1 | AAAAAGCC | bZIP family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT5G06839.1); Has 758 Blast hits to 757 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 28; Plants - 577; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT1G08320.3 | AAAAAGCC | bZIP family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT5G06839.1); Has 758 Blast hits to 757 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 28; Plants - 577; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT1G08380 | AT1G08380.1 | GGCTTTTT | Encodes subunit O of photosystem I. |
| AT1G08610 | AT1G08610.1 | AAAAAGCCCAAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink). |
| AT1G08830 | AT1G08830.1 | CTGACGTGGCTTTTT | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. |
| AT1G08830.2 | CTGACGTGGCTTTTT | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. |
| AT1G09570 | AT1G09570.1 | AAAAAGCC | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
| AT1G09630 | AT1G09630.1 | GGCTTTTT | Encodes a putative GTP-binding protein. Associates with organelles on a pathway from the Golgi to the plasma membrane in interphase. In dividing cells acts at the cell plate. |
| AT1G09640 | AT1G09640.1 | AAAAAGCC | elongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell, pollen tube, leaf, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G57720.2); Has 6774 Blast hits to 6759 proteins in 920 species: Archae - 2; Bacteria - 2995; Metazoa - 1594; Fungi - 400; Plants - 499; Viruses - 0; Other Eukaryotes - 1284 (source: NCBI BLink). |
| AT1G11400 | AT1G11400.1 | AAAAAGCC | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G11400.2 | AAAAAGCC | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G11400.3 | AAAAAGCC | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G13195 | AT1G13195.1 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G24440.1); Has 629 Blast hits to 628 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 311; Fungi - 15; Plants - 172; Viruses - 16; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT1G13195.2 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G24440.1); Has 629 Blast hits to 628 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 311; Fungi - 15; Plants - 172; Viruses - 16; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT1G13690 | AT1G13690.1 | AAAAAGCCCATTTA | AtE1 - stimulates the ATPase activity of DnaK/DnaJ |
| AT1G14170 | AT1G14170.1 | AAAAAGCC | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT5G15270.2); Has 4545 Blast hits to 1932 proteins in 148 species: Archae - 0; Bacteria - 11; Metazoa - 3518; Fungi - 325; Plants - 523; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT1G14170.2 | AAAAAGCC | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT5G15270.2); Has 4545 Blast hits to 1932 proteins in 148 species: Archae - 0; Bacteria - 11; Metazoa - 3518; Fungi - 325; Plants - 523; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT1G14170.3 | AAAAAGCC | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT5G15270.2); Has 4545 Blast hits to 1932 proteins in 148 species: Archae - 0; Bacteria - 11; Metazoa - 3518; Fungi - 325; Plants - 523; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT1G14260 | AT1G14260.1 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G02960.4); Has 1265 Blast hits to 1265 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 607; Fungi - 81; Plants - 327; Viruses - 49; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G14260.2 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G02960.4); Has 1265 Blast hits to 1265 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 607; Fungi - 81; Plants - 327; Viruses - 49; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G16310 | AT1G16310.1 | GGCTTTTT | cation efflux family protein; FUNCTIONS IN: cation transmembrane transporter activity; INVOLVED IN: cation transport; LOCATED IN: membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT1G79520.1); Has 2870 Blast hits to 2866 proteins in 995 species: Archae - 100; Bacteria - 2206; Metazoa - 40; Fungi - 192; Plants - 103; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT1G17130 | AT1G17130.1 | CAAGCCCAAAAAAGCCC | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17130.2 | CAAGCCCAAAAAAGCCC | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17650 | AT1G17650.1 | GGCTTTTT | Glyoxylate reductase located in chloroplasts. |
| AT1G19480 | AT1G19480.1 | GGCTGGGCTTTTT | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). |
| AT1G19480.2 | GGCTGGGCTTTTT | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). |
| AT1G19835 | AT1G19835.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF869, plant (InterPro:IPR008587); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47900.1); Has 44906 Blast hits to 23790 proteins in 1265 species: Archae - 546; Bacteria - 4089; Metazoa - 24989; Fungi - 3566; Plants - 1950; Viruses - 103; Other Eukaryotes - 9663 (source: NCBI BLink). |
| AT1G20620 | AT1G20620.4 | TAGGGCTTTTT | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. |
| AT1G21450 | AT1G21450.1 | GGCTTTTT | Encodes a scarecrow-like protein (SCL1). Member of GRAS gene family. |
| AT1G21980 | AT1G21980.1 | GTGGGCTTTTT | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
| AT1G22520 | AT1G22520.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). |
| AT1G22520.2 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). |
| AT1G22880 | AT1G22880.1 | AAAAAGCC | CELLULASE 5 (CEL5); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cell wall, plasma membrane, plant-type cell wall; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Six-hairpin glycosidase (InterPro:IPR012341), Glycoside hydrolase, family 9, active site (InterPro:IPR018221), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 9 (InterPro:IPR001701); BEST Arabidopsis thaliana protein match is: ATCEL3 (ARABIDOPSIS THALIANA CELLULASE 3); catalytic/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G71380.1); Has 1107 Blast hits to 1103 proteins in 187 species: Archae - 0; Bacteria - 309; Metazoa - 137; Fungi - 14; Plants - 621; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G22880.2 | AAAAAGCC | CELLULASE 5 (CEL5); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cell wall, plasma membrane, plant-type cell wall; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Six-hairpin glycosidase (InterPro:IPR012341), Glycoside hydrolase, family 9, active site (InterPro:IPR018221), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 9 (InterPro:IPR001701); BEST Arabidopsis thaliana protein match is: ATCEL3 (ARABIDOPSIS THALIANA CELLULASE 3); catalytic/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G71380.1); Has 1107 Blast hits to 1103 proteins in 187 species: Archae - 0; Bacteria - 309; Metazoa - 137; Fungi - 14; Plants - 621; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G23280 | AT1G23280.1 | TTTTGGGCTTTTT | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink). |
| AT1G23290 | AT1G23290.1 | AAAAAGCCCAAAA | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. |
| AT1G23970 | AT1G23970.1 | AAAAAGCCCAACTGAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23950.2); Has 75 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G23970.2 | AAAAAGCCCAACTGAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23950.2); Has 75 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G24180 | AT1G24180.1 | GGCTTTTT | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900 |
| AT1G27100 | AT1G27100.1 | GGCTTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69900.1); Has 184 Blast hits to 118 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 8; Plants - 166; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G27390 | AT1G27390.1 | AAAAAGCCCAATTA | Form of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins |
| AT1G27400 | AT1G27400.1 | TAATTGGGCTTTTT | 60S ribosomal protein L17 (RPL17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17B) (TAIR:AT1G67430.1); Has 1647 Blast hits to 1647 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink). |
| AT1G27840 | AT1G27840.1 | GGCTTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G27840.2 | GGCTTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G27840.3 | GGCTTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G29060 | AT1G29060.1 | ATCGGCCCGTTAAAAAAGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G30360 | AT1G30360.1 | AAAAAGCC | early-responsive to dehydration 4 (ERD4); INVOLVED IN: response to water deprivation; LOCATED IN: plasma membrane, chloroplast, vacuole, membrane, chloroplast envelope; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT1G32090.1); Has 875 Blast hits to 823 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 159; Fungi - 414; Plants - 234; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT1G30450 | AT1G30450.1 | CCCAATTAAAAAGCCCATTT | member of Cation-chloride co-transporter family |
| AT1G30450.2 | CCCAATTAAAAAGCCCATTT | member of Cation-chloride co-transporter family |
| AT1G30450.3 | CCCAATTAAAAAGCCCATTT | member of Cation-chloride co-transporter family |
| AT1G31830 | AT1G31830.1 | AAAAAGCC | amino acid permease family protein; FUNCTIONS IN: cationic amino acid transmembrane transporter activity; INVOLVED IN: transport, amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid/polyamine transporter I (InterPro:IPR002293), Amino acid permease-associated region (InterPro:IPR004841); BEST Arabidopsis thaliana protein match is: amino acid permease family protein (TAIR:AT1G31820.1); Has 14358 Blast hits to 14353 proteins in 1181 species: Archae - 249; Bacteria - 11483; Metazoa - 903; Fungi - 728; Plants - 243; Viruses - 0; Other Eukaryotes - 752 (source: NCBI BLink). |
| AT1G31830.2 | AAAAAGCC | amino acid permease family protein; FUNCTIONS IN: cationic amino acid transmembrane transporter activity; INVOLVED IN: transport, amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid/polyamine transporter I (InterPro:IPR002293), Amino acid permease-associated region (InterPro:IPR004841); BEST Arabidopsis thaliana protein match is: amino acid permease family protein (TAIR:AT1G31820.1); Has 14358 Blast hits to 14353 proteins in 1181 species: Archae - 249; Bacteria - 11483; Metazoa - 903; Fungi - 728; Plants - 243; Viruses - 0; Other Eukaryotes - 752 (source: NCBI BLink). |
| AT1G31850 | AT1G31850.1 | AAAAAGCC | dehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G31850.1 | AAAAAGCC | dehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G31850.2 | AAAAAGCC | dehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G31850.2 | AAAAAGCC | dehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G31850.3 | AAAAAGCC | dehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G31850.3 | AAAAAGCC | dehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G31870 | AT1G31870.1 | GGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2050, pre-mRNA-splicing factor (InterPro:IPR018609); Has 11793 Blast hits to 8312 proteins in 386 species: Archae - 8; Bacteria - 320; Metazoa - 6710; Fungi - 1763; Plants - 711; Viruses - 126; Other Eukaryotes - 2155 (source: NCBI BLink). |
| AT1G31870.2 | GGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2050, pre-mRNA-splicing factor (InterPro:IPR018609); Has 11793 Blast hits to 8312 proteins in 386 species: Archae - 8; Bacteria - 320; Metazoa - 6710; Fungi - 1763; Plants - 711; Viruses - 126; Other Eukaryotes - 2155 (source: NCBI BLink). |
| AT1G32730 | AT1G32730.1 | TTGGGCTTTTTTTGGGCTTAT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G32920 | AT1G32920.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32928.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G33170 | AT1G33170.1 | GGCTTTTT | dehydration-responsive family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 559 Blast hits to 552 proteins in 56 species: Archae - 2; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G33810 | AT1G33810.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G34320 | AT1G34320.1 | AAAAAGCC | unknown protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF668 (InterPro:IPR007700); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08660.1); Has 160 Blast hits to 124 proteins in 13 species: Archae - 0; Bacteria - 1; Metazoa - 3; Fungi - 0; Plants - 156; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G34430 | AT1G34430.1 | AAAAAGCCCAATA | embryo defective 3003 (EMB3003); FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosolic ribosome, plasma membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: LTA2; dihydrolipoyllysine-residue acetyltransferase (TAIR:AT3G25860.1); Has 15590 Blast hits to 14171 proteins in 1332 species: Archae - 64; Bacteria - 7001; Metazoa - 632; Fungi - 308; Plants - 200; Viruses - 0; Other Eukaryotes - 7385 (source: NCBI BLink). |
| AT1G47230 | AT1G47230.1 | AAAAAGCCC | CYCLIN A3;4 (CYCA3;4); FUNCTIONS IN: cyclin-dependent protein kinase regulator activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367), Cyclin (InterPro:IPR006670), G2/mitotic-specific cyclin A (InterPro:IPR015453), Cyclin-like (InterPro:IPR011028), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin, A/B/D/E (InterPro:IPR014400); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT1G47210.2); Has 3253 Blast hits to 3252 proteins in 293 species: Archae - 0; Bacteria - 0; Metazoa - 1697; Fungi - 357; Plants - 705; Viruses - 32; Other Eukaryotes - 462 (source: NCBI BLink). |
| AT1G47230.2 | AAAAAGCCC | CYCLIN A3;4 (CYCA3;4); FUNCTIONS IN: cyclin-dependent protein kinase regulator activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367), Cyclin (InterPro:IPR006670), G2/mitotic-specific cyclin A (InterPro:IPR015453), Cyclin-like (InterPro:IPR011028), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin, A/B/D/E (InterPro:IPR014400); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT1G47210.2); Has 3253 Blast hits to 3252 proteins in 293 species: Archae - 0; Bacteria - 0; Metazoa - 1697; Fungi - 357; Plants - 705; Viruses - 32; Other Eukaryotes - 462 (source: NCBI BLink). |
| AT1G48770 | AT1G48770.1 | GTGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18295.1); Has 142 Blast hits to 142 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48920 | AT1G48920.1 | AAAAAGCCCACTA | Encodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. |
| AT1G53590 | AT1G53590.1 | GGCTTTTT | NTMC2T6.1; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14590.2); Has 4658 Blast hits to 3860 proteins in 257 species: Archae - 0; Bacteria - 64; Metazoa - 2751; Fungi - 514; Plants - 693; Viruses - 7; Other Eukaryotes - 629 (source: NCBI BLink). |
| AT1G53670 | AT1G53670.1 | AAAAAGCCCAATAA | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53670.2 | AAAAAGCCCAATAA | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53750 | AT1G53750.1 | AAAAAGCCCATTTTACACGTGGG | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT1G55175 | AT1G55175.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24300.1). |
| AT1G55250 | AT1G55250.1 | TTATTGGGCTTTTT | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT1G56210 | AT1G56210.1 | AAAAAGCC | copper chaperone (CCH)-related; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT5G27690.1); Has 3381 Blast hits to 2720 proteins in 263 species: Archae - 2; Bacteria - 163; Metazoa - 1093; Fungi - 463; Plants - 963; Viruses - 22; Other Eukaryotes - 675 (source: NCBI BLink). |
| AT1G58200 | AT1G58200.1 | AAAAAGCC | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
| AT1G58200.2 | AAAAAGCC | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
| AT1G58210 | AT1G58210.1 | GGCTTTTT | EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink). |
| AT1G58380 | AT1G58380.1 | AAAAAGCCCAC | XW6; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast, membrane; EXPRESSED IN: guard cell, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 7963 Blast hits to 7153 proteins in 1715 species: Archae - 183; Bacteria - 3057; Metazoa - 1443; Fungi - 466; Plants - 299; Viruses - 25; Other Eukaryotes - 2490 (source: NCBI BLink). |
| AT1G60710 | AT1G60710.1 | GGCTTTTT | Encodes ATB2. |
| AT1G62050 | AT1G62050.1 | AAAAAGCCCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G11740.1); Has 967 Blast hits to 722 proteins in 118 species: Archae - 0; Bacteria - 24; Metazoa - 556; Fungi - 45; Plants - 193; Viruses - 2; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT1G62790 | AT1G62790.1 | GGCTTTTT | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: receptor serine/threonine kinase, putative (TAIR:AT1G70250.1); Has 190 Blast hits to 186 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 190; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G62790.2 | GGCTTTTT | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: receptor serine/threonine kinase, putative (TAIR:AT1G70250.1); Has 190 Blast hits to 186 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 190; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G64142 | AT1G64142.1 | AAAAAGCC | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF23 represents a conserved upstream opening reading frame relative to major ORF AT1G64140.1 |
| AT1G64440 | AT1G64440.1 | AAAAAGCCACGTGGCTT | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
| AT1G65840 | AT1G65840.1 | AAAAAGCC | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. |
| AT1G67680 | AT1G67680.1 | AAAGGCCCATATAAAAAGCCCATTAA | 7S RNA binding; FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); BEST Arabidopsis thaliana protein match is: 7S RNA binding (TAIR:AT1G67650.1); Has 525 Blast hits to 512 proteins in 165 species: Archae - 12; Bacteria - 42; Metazoa - 217; Fungi - 108; Plants - 25; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT1G67960 | AT1G67960.1 | GGCTTTTT | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT1G70700 | AT1G70700.1 | AAAAAGCCC | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70700.2 | AAAAAGCCC | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70780 | AT1G70780.1 | AAAAAGCCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23150.1); Has 70 Blast hits to 70 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G70782 | AT1G70782.1 | AAAAAGCCTTTAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF28 represents a conserved upstream opening reading frame relative to major ORF AT1G70780.1 |
| AT1G72290 | AT1G72290.1 | AAAAAGCC | trypsin and protease inhibitor family protein / Kunitz family protein; FUNCTIONS IN: endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I3, Kunitz legume (InterPro:IPR002160), Kunitz inhibitor ST1-like (InterPro:IPR011065); BEST Arabidopsis thaliana protein match is: trypsin and protease inhibitor family protein / Kunitz family protein (TAIR:AT1G73325.1); Has 190 Blast hits to 190 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 190; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72730 | AT1G72730.1 | CGTGGCTTTTT | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: EIF4A1 (EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1); ATP-dependent helicase/ translation initiation factor (TAIR:AT3G13920.1); Has 31616 Blast hits to 31226 proteins in 1784 species: Archae - 458; Bacteria - 14276; Metazoa - 4974; Fungi - 3353; Plants - 1386; Viruses - 16; Other Eukaryotes - 7153 (source: NCBI BLink). |
| AT1G74920 | AT1G74920.1 | GGCTTTTTCGTTTTGA | Arabidopsis thaliana similar to betaine aldehyde dehydrogenase |
| AT1G75330 | AT1G75330.1 | AAAAAGCCCAATAAG | ORNITHINE CARBAMOYLTRANSFERASE (OTC); FUNCTIONS IN: amino acid binding, ornithine carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding region (InterPro:IPR006131), Ornithine carbamoyltransferase (InterPro:IPR002292); BEST Arabidopsis thaliana protein match is: aspartate carabmoyltransferase, chloroplast / aspartate transcarbamylase / ATCase (PYRB) (TAIR:AT3G20330.1); Has 11337 Blast hits to 11337 proteins in 1659 species: Archae - 346; Bacteria - 6031; Metazoa - 180; Fungi - 195; Plants - 66; Viruses - 6; Other Eukaryotes - 4513 (source: NCBI BLink). |
| AT1G75560 | AT1G75560.1 | AAAAAGCCCAGCCCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G75560.2 | AAAAAGCCCAGCCCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G76050 | AT1G76050.1 | AAAAAGCC | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). |
| AT1G76050.2 | AAAAAGCC | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). |
| AT1G76570 | AT1G76570.1 | GGGCTTTTT | chlorophyll A-B binding family protein; FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to far red light, photosynthesis; LOCATED IN: light-harvesting complex, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); BEST Arabidopsis thaliana protein match is: LHCB2.3; chlorophyll binding (TAIR:AT3G27690.1); Has 1746 Blast hits to 1686 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1525; Viruses - 0; Other Eukaryotes - 219 (source: NCBI BLink). |
| AT1G76700 | AT1G76700.1 | AAAAAGCC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT1G21080.1); Has 15728 Blast hits to 15653 proteins in 1913 species: Archae - 105; Bacteria - 5182; Metazoa - 3292; Fungi - 1431; Plants - 1171; Viruses - 18; Other Eukaryotes - 4529 (source: NCBI BLink). |
| AT1G76850 | AT1G76850.1 | AAAAAGCC | EXOCYST COMPLEX COMPONENT SEC5 (SEC5A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: SEC5B (TAIR:AT1G21170.1); Has 394 Blast hits to 372 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 200; Fungi - 94; Plants - 52; Viruses - 4; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT1G77180 | AT1G77180.1 | AAAAAGCC | Encodes a protein with a putative role in mRNA splicing. |
| AT1G77180.2 | AAAAAGCC | Encodes a protein with a putative role in mRNA splicing. |
| AT1G77270 | AT1G77270.1 | ACTGGGCCAAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07730.1); Has 365 Blast hits to 331 proteins in 76 species: Archae - 0; Bacteria - 25; Metazoa - 174; Fungi - 10; Plants - 59; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). |
| AT1G77480 | AT1G77480.1 | AAAAAGCC | nucellin protein, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1042 Blast hits to 1037 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 17; Plants - 945; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT1G77480.2 | AAAAAGCC | nucellin protein, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1042 Blast hits to 1037 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 17; Plants - 945; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT1G77750 | AT1G77750.1 | AAAAAGCCCAATAA | 30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink). |
| AT1G78100 | AT1G78100.1 | AAAAAGCC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G22220.1); Has 82 Blast hits to 81 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G79430 | AT1G79430.1 | AAAAAGCC | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G79430.2 | AAAAAGCC | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G79710 | AT1G79710.1 | CTAATGGGCCACAAAAAGCCCATCT | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). |
| AT1G80750 | AT1G80750.1 | GTAAGGCCTTACATAAGCCCATAAATATTGGGCTTTTTTAGCCCAATAG | 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT1G80770 | AT1G80770.1 | AAAAAGCCCATTAA | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink). |
| AT1G80820 | AT1G80820.1 | GGCTTTTT | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT2G01250 | AT2G01250.1 | CCATGGGCTTTTT | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G01250.2 | CCATGGGCTTTTT | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G01340 | AT2G01340.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71015.1); Has 55 Blast hits to 55 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G01950 | AT2G01950.1 | AAAAAGCCC | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT2G02040 | AT2G02040.1 | AAAAAGCC | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. Expression of the transcripts for this gene can be detected in the embryo through in situ hybridization. This protein does not have nitrate transporter activity based on oocyte transport assays. |
| AT2G03667 | AT2G03667.1 | AAAAAGCC | asparagine synthase (glutamine-hydrolyzing); FUNCTIONS IN: asparagine synthase (glutamine-hydrolyzing) activity; INVOLVED IN: asparagine biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Asparagine synthase (InterPro:IPR001962), Glutamine amidotransferase, type II (InterPro:IPR017932); Has 804 Blast hits to 751 proteins in 286 species: Archae - 66; Bacteria - 218; Metazoa - 123; Fungi - 87; Plants - 17; Viruses - 3; Other Eukaryotes - 290 (source: NCBI BLink). |
| AT2G04230 | AT2G04230.1 | AAAAAGCCCATTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G49030.1); Has 1566 Blast hits to 1530 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1562; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04350 | AT2G04350.1 | AAAAAGCC | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G04350.2 | AAAAAGCC | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G05620 | AT2G05620.1 | AAAAAGCC | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT2G15270 | AT2G15270.1 | CAAGCCCAAAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1168 (InterPro:IPR009548); Has 2059 Blast hits to 1352 proteins in 169 species: Archae - 0; Bacteria - 30; Metazoa - 987; Fungi - 240; Plants - 61; Viruses - 3; Other Eukaryotes - 738 (source: NCBI BLink). |
| AT2G15290 | AT2G15290.1 | AAAAAGCCCATTG | Encodes a protein located in the chloroplast inner envelope. The study of mutant defective in the gene product suggests that the protein is involved in the translocation of protein across the envelope membrane into the chloroplast stroma. |
| AT2G16950 | AT2G16950.1 | AAAAAGCCCATAA | Nuclear import receptor for AtGRP7. |
| AT2G16950.2 | AAAAAGCCCATAA | Nuclear import receptor for AtGRP7. |
| AT2G17630 | AT2G17630.1 | AAAAAGCC | phosphoserine aminotransferase, putative; FUNCTIONS IN: pyridoxal phosphate binding, transaminase activity, catalytic activity, O-phospho-L-serine:2-oxoglutarate aminotransferase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase, class V/Cysteine desulfurase (InterPro:IPR000192), Phosphoserine aminotransferase (InterPro:IPR003248), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: PSAT; O-phospho-L-serine:2-oxoglutarate aminotransferase (TAIR:AT4G35630.1); Has 3399 Blast hits to 3398 proteins in 981 species: Archae - 32; Bacteria - 1822; Metazoa - 150; Fungi - 92; Plants - 37; Viruses - 0; Other Eukaryotes - 1266 (source: NCBI BLink). |
| AT2G18020 | AT2G18020.1 | GTTGGGCTTTTT | embryo defective 2296 (EMB2296); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: in 7 components; EXPRESSED IN: male gametophyte, guard cell, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L8 (RPL8C) (TAIR:AT4G36130.1); Has 7419 Blast hits to 7417 proteins in 2201 species: Archae - 236; Bacteria - 3117; Metazoa - 334; Fungi - 188; Plants - 928; Viruses - 0; Other Eukaryotes - 2616 (source: NCBI BLink). |
| AT2G18390 | AT2G18390.1 | AAAAAGCCCAT | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development. |
| AT2G19270 | AT2G19270.1 | AAAAAGCCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitotic checkpoint protein PRCC, C-terminal (InterPro:IPR018800); Has 1029 Blast hits to 488 proteins in 117 species: Archae - 0; Bacteria - 14; Metazoa - 432; Fungi - 124; Plants - 39; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). |
| AT2G19540 | AT2G19540.1 | GGCTTTTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: MSI2 (MULTICOPY SUPPRESSOR OF IRA1 2) (TAIR:AT2G16780.1); Has 15889 Blast hits to 11352 proteins in 415 species: Archae - 2; Bacteria - 1006; Metazoa - 7280; Fungi - 3371; Plants - 2046; Viruses - 0; Other Eukaryotes - 2184 (source: NCBI BLink). |
| AT2G20060 | AT2G20060.1 | TTATGGGCTTTTT | ribosomal protein L4 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4 (InterPro:IPR015498), Ribosomal protein L4/L1e, bacterial-type (InterPro:IPR013005), Ribosomal protein L4/L1e (InterPro:IPR002136); BEST Arabidopsis thaliana protein match is: RPL4; poly(U) binding / structural constituent of ribosome (TAIR:AT1G07320.4); Has 5451 Blast hits to 5451 proteins in 1497 species: Archae - 63; Bacteria - 2944; Metazoa - 100; Fungi - 82; Plants - 60; Viruses - 0; Other Eukaryotes - 2202 (source: NCBI BLink). |
| AT2G20400 | AT2G20400.1 | AAAAAGCCC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 913 Blast hits to 906 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 900; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G20480 | AT2G20480.1 | AAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20490 | AT2G20490.1 | AAAAAGCCCATTT | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G20490.2 | AAAAAGCCCATTT | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G20930 | AT2G20930.1 | AAAAAGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); Has 370 Blast hits to 370 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 55; Plants - 47; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT2G22400 | AT2G22400.1 | TAAAGCCCAATTAAAAAGCC | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT2G24765 | AT2G24765.1 | TTTAGGCCCAAAAAAAGCC | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT2G24765.2 | TTTAGGCCCAAAAAAAGCC | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT2G25690 | AT2G25690.1 | AAAAAGCC | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT5G11460.1); Has 277 Blast hits to 277 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 277; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25690.2 | AAAAAGCC | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT5G11460.1); Has 277 Blast hits to 277 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 277; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25910 | AT2G25910.1 | AAAAAGCCCAAT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT2G25910.2 | AAAAAGCCCAAT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT2G26140 | AT2G26140.1 | AAAAAGCC | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G26800 | AT2G26800.1 | GGCTTTTT | hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative; FUNCTIONS IN: hydroxymethylglutaryl-CoA lyase activity, catalytic activity; INVOLVED IN: leucine metabolic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Pyruvate carboxyltransferase (InterPro:IPR000891); BEST Arabidopsis thaliana protein match is: MAM1 (METHYLTHIOALKYLMALATE SYNTHASE 1); 2-isopropylmalate synthase/ methylthioalkylmalate synthase (TAIR:AT5G23010.1); Has 7083 Blast hits to 7079 proteins in 1248 species: Archae - 266; Bacteria - 3753; Metazoa - 176; Fungi - 188; Plants - 138; Viruses - 0; Other Eukaryotes - 2562 (source: NCBI BLink). |
| AT2G26800.2 | GGCTTTTT | hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative; FUNCTIONS IN: hydroxymethylglutaryl-CoA lyase activity, catalytic activity; INVOLVED IN: leucine metabolic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Pyruvate carboxyltransferase (InterPro:IPR000891); BEST Arabidopsis thaliana protein match is: MAM1 (METHYLTHIOALKYLMALATE SYNTHASE 1); 2-isopropylmalate synthase/ methylthioalkylmalate synthase (TAIR:AT5G23010.1); Has 7083 Blast hits to 7079 proteins in 1248 species: Archae - 266; Bacteria - 3753; Metazoa - 176; Fungi - 188; Plants - 138; Viruses - 0; Other Eukaryotes - 2562 (source: NCBI BLink). |
| AT2G26800.3 | GGCTTTTT | hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative; FUNCTIONS IN: hydroxymethylglutaryl-CoA lyase activity, catalytic activity; INVOLVED IN: leucine metabolic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Pyruvate carboxyltransferase (InterPro:IPR000891); BEST Arabidopsis thaliana protein match is: MAM1 (METHYLTHIOALKYLMALATE SYNTHASE 1); 2-isopropylmalate synthase/ methylthioalkylmalate synthase (TAIR:AT5G23010.1); Has 7083 Blast hits to 7079 proteins in 1248 species: Archae - 266; Bacteria - 3753; Metazoa - 176; Fungi - 188; Plants - 138; Viruses - 0; Other Eukaryotes - 2562 (source: NCBI BLink). |
| AT2G27530 | AT2G27530.1 | AGATGGGCTTTTT | Encodes ribosomal protein L10aP. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT2G27530.2 | AGATGGGCTTTTT | Encodes ribosomal protein L10aP. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT2G30760 | AT2G30760.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G32480 | AT2G32480.1 | AAAAAGCC | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). |
| AT2G32480.2 | AAAAAGCC | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). |
| AT2G32520 | AT2G32520.1 | GGCTTTTT | dienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase (InterPro:IPR002155), Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT1G35420.1); Has 2362 Blast hits to 2362 proteins in 596 species: Archae - 20; Bacteria - 1757; Metazoa - 54; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 466 (source: NCBI BLink). |
| AT2G33180 | AT2G33180.1 | GGCTTTATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G34460 | AT2G34460.1 | AAAAAGCC | flavin reductase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 2946 Blast hits to 2906 proteins in 716 species: Archae - 28; Bacteria - 1803; Metazoa - 133; Fungi - 58; Plants - 295; Viruses - 0; Other Eukaryotes - 629 (source: NCBI BLink). |
| AT2G37340 | AT2G37340.2 | GGGCTTTTT | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. |
| AT2G37340.3 | GGGCTTTTT | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. |
| AT2G37480 | AT2G37480.1 | TAGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53670.1); Has 159 Blast hits to 159 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G37480.2 | TAGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53670.1); Has 159 Blast hits to 159 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G39270 | AT2G39270.1 | AAAAAGCCCAAACGGGTCAAA | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink). |
| AT2G39420 | AT2G39420.1 | AAAAAGCC | esterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT2G39410.2); Has 2754 Blast hits to 2750 proteins in 815 species: Archae - 17; Bacteria - 1873; Metazoa - 111; Fungi - 90; Plants - 263; Viruses - 34; Other Eukaryotes - 366 (source: NCBI BLink). |
| AT2G40060 | AT2G40060.1 | AAAAAGCCCATTAAG | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT2G40140 | AT2G40140.1 | AAAAAGCC | CZF1; FUNCTIONS IN: transcription factor activity; INVOLVED IN: defense response to fungus, response to cold, response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: SZF1 (SALT-INDUCIBLE ZINC FINGER 1); transcription factor (TAIR:AT3G55980.1); Has 847 Blast hits to 803 proteins in 134 species: Archae - 2; Bacteria - 35; Metazoa - 340; Fungi - 36; Plants - 230; Viruses - 2; Other Eukaryotes - 202 (source: NCBI BLink). |
| AT2G40140.2 | AAAAAGCC | CZF1; FUNCTIONS IN: transcription factor activity; INVOLVED IN: defense response to fungus, response to cold, response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: SZF1 (SALT-INDUCIBLE ZINC FINGER 1); transcription factor (TAIR:AT3G55980.1); Has 847 Blast hits to 803 proteins in 134 species: Archae - 2; Bacteria - 35; Metazoa - 340; Fungi - 36; Plants - 230; Viruses - 2; Other Eukaryotes - 202 (source: NCBI BLink). |
| AT2G40700 | AT2G40700.1 | TTAAACCGTAAAAAGCC | DEAD/DEAH box helicase, putative (RH17); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G65900.1); Has 26770 Blast hits to 25070 proteins in 1684 species: Archae - 453; Bacteria - 10406; Metazoa - 5242; Fungi - 3151; Plants - 1377; Viruses - 5; Other Eukaryotes - 6136 (source: NCBI BLink). |
| AT2G40840 | AT2G40840.1 | AAAAAGCC | Encodes a cytosolic protein with transglucosidase and amylomaltase activity. It is an essential component of the pathway from starch to sucrose and cellular metabolism in leaves at night. The protein binds to heteroglycans and utilizes glucose, mannose and xylose as acceptors. Fucose and galactose can also act as acceptors but less efficiently than the previous three. It was also was also recently reported to act on maltodextrins. On the other hand, arabinose and fructose were not efficiently used. Its role probably includes metabolizing maltose exported from the chloroplast. Studies using maltose extracted from the double mutant be2-1 be3-2 showed that this enzyme is preferentially active of β-maltose. |
| AT2G41830 | AT2G41830.1 | TAGGGCTTTTT | cyclin-related; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21080.1); Has 188 Blast hits to 186 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 115; Fungi - 3; Plants - 65; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT2G42700 | AT2G42700.1 | AAAAAGCCCAACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport, vesicle docking during exocytosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sec1-like protein (InterPro:IPR001619); Has 95 Blast hits to 92 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT2G43240 | AT2G43240.1 | AAAAAGCC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G43240.2 | AAAAAGCC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G43360 | AT2G43360.1 | AAAAAGCCCAACA | Catalyzes the conversion of dethiobiotin to biotin. |
| AT2G43370 | AT2G43370.1 | TGTTGGGCTTTTT | U1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink). |
| AT2G43620 | AT2G43620.1 | AAAAAGCC | chitinase, putative; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 19 protein (TAIR:AT2G43610.1); Has 2130 Blast hits to 1900 proteins in 431 species: Archae - 0; Bacteria - 469; Metazoa - 33; Fungi - 213; Plants - 1231; Viruses - 34; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT2G44360 | AT2G44360.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G44940 | AT2G44940.1 | AAAAAGCC | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT2G46090 | AT2G46090.1 | AAAAAGCC | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT2G46735 | AT2G46735.1 | AAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46800 | AT2G46800.1 | AAAAAGCC | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G46800.2 | AAAAAGCC | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G46930 | AT2G46930.1 | AAAAAGCC | pectinacetylesterase, putative; FUNCTIONS IN: carboxylesterase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: pectinacetylesterase family protein (TAIR:AT3G62060.1); Has 401 Blast hits to 395 proteins in 78 species: Archae - 0; Bacteria - 40; Metazoa - 115; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G47120 | AT2G47120.1 | AAAAAGCC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G47130.1); Has 80311 Blast hits to 80158 proteins in 2201 species: Archae - 468; Bacteria - 43770; Metazoa - 4463; Fungi - 4181; Plants - 1494; Viruses - 4; Other Eukaryotes - 25931 (source: NCBI BLink). |
| AT3G01160 | AT3G01160.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 35234 Blast hits to 19107 proteins in 767 species: Archae - 54; Bacteria - 1674; Metazoa - 14725; Fungi - 4288; Plants - 1318; Viruses - 508; Other Eukaryotes - 12667 (source: NCBI BLink). |
| AT3G01170 | AT3G01170.1 | AAAAAGCC | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G15260.1); Has 39 Blast hits to 39 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G01320 | AT3G01320.1 | AAAAAGCCCAATAG | Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT3G01390 | AT3G01390.1 | TTTGGGCTTTTT | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01390.2 | TTTGGGCTTTTT | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01400 | AT3G01400.1 | AAAAAGCCCAAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT5G58680.1); Has 3812 Blast hits to 2325 proteins in 207 species: Archae - 0; Bacteria - 2; Metazoa - 1580; Fungi - 356; Plants - 1453; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink). |
| AT3G01410 | AT3G01410.1 | CTATTGGGCTTTTT | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). |
| AT3G01410.2 | CTATTGGGCTTTTT | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). |
| AT3G01690 | AT3G01690.1 | AAAAAGCC | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14390.1); Has 2954 Blast hits to 2948 proteins in 496 species: Archae - 2; Bacteria - 741; Metazoa - 618; Fungi - 134; Plants - 170; Viruses - 6; Other Eukaryotes - 1283 (source: NCBI BLink). |
| AT3G01720 | AT3G01720.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13500.3); Has 169 Blast hits to 95 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT3G01980 | AT3G01980.1 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink). |
| AT3G01980.2 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink). |
| AT3G01980.3 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink). |
| AT3G01980.4 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink). |
| AT3G02065 | AT3G02065.1 | AAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.1 | TATGGCCCAGTAAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.2 | AAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.2 | TATGGCCCAGTAAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.3 | AAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.3 | TATGGCCCAGTAAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02700 | AT3G02700.1 | ATTTGGGCTTTTT | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT5G16330.1); Has 105 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 23; Metazoa - 12; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G04060 | AT3G04060.1 | GGGCTTTTT | Arabidopsis NAC domain containing protein 46 (anac046); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC087; transcription factor (TAIR:AT5G18270.1); Has 1632 Blast hits to 1630 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1632; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G04500 | AT3G04500.1 | GGCTTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition motif-related (InterPro:IPR015464); BEST Arabidopsis thaliana protein match is: UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding (TAIR:AT1G17370.2); Has 10169 Blast hits to 8298 proteins in 506 species: Archae - 0; Bacteria - 623; Metazoa - 5880; Fungi - 1176; Plants - 1670; Viruses - 0; Other Eukaryotes - 820 (source: NCBI BLink). |
| AT3G05370 | AT3G05370.1 | TGGCCCAAATAAAAAGCCCAAAT | Receptor Like Protein 31 (AtRLP31); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP12 (Receptor Like Protein 12); protein binding (TAIR:AT1G71400.1); Has 71485 Blast hits to 19659 proteins in 809 species: Archae - 36; Bacteria - 3854; Metazoa - 21831; Fungi - 684; Plants - 39507; Viruses - 4; Other Eukaryotes - 5569 (source: NCBI BLink). |
| AT3G06030 | AT3G06030.1 | AAAAAGCCCAATAAGAAGGCCCATTAAG | NPK1-related protein kinase 3 |
| AT3G06810 | AT3G06810.1 | GGCTTTTT | Encodes a protein with similarity to acyl-CoA dehydrogenases. Mutations in IBR3 render plants resistant to indole-3-butryic acid, a putative storage form of the biologically active auxin IAA (indole-3-acetic acid). IBR3 is hypothesized to carry out the second step in a β-oxidation-like process of IBA metabolism in Arabidopsis. Though its subcellular location has not been determined, IBR3 has a peroxisomal targeting sequence and two other putative IBA metabolic enzymes (IBR1 and IBR10) can be found in this organelle. No specific enzymatic activity has been documented for IBR3, but double mutant analyses with CHY1 argue against a role for IBR3 in general fatty acid β-oxidation. |
| AT3G06850 | AT3G06850.1 | GGCTTTTT | dihydrolipoamide branched chain acyltransferase |
| AT3G06850.2 | GGCTTTTT | dihydrolipoamide branched chain acyltransferase |
| AT3G07410 | AT3G07410.1 | AAAAAGCC | Arabidopsis Rab GTPase homolog A5b (AtRABA5b); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ARA4; GTP binding / GTPase/ protein binding (TAIR:AT2G43130.1); Has 22386 Blast hits to 22351 proteins in 619 species: Archae - 15; Bacteria - 99; Metazoa - 12578; Fungi - 2607; Plants - 2049; Viruses - 19; Other Eukaryotes - 5019 (source: NCBI BLink). |
| AT3G07560 | AT3G07560.1 | GGCTTTTT | Encodes peroxin 13 (PEX13) involved in protein transport into peroxisomes. |
| AT3G07565 | AT3G07565.1 | AAAAAGCC | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10820.2); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G07565.2 | AAAAAGCC | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10820.2); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G07565.3 | AAAAAGCC | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10820.2); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G07670 | AT3G07670.1 | GGCTTTTTCCCATTAG | SET domain-containing protein; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT5G14260.3); Has 844 Blast hits to 844 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 238; Plants - 226; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G07990 | AT3G07990.1 | AAAAAGCCCAT | serine carboxypeptidase-like 27 (SCPL27); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl26 (serine carboxypeptidase-like 26); serine-type carboxypeptidase (TAIR:AT2G35780.1); Has 2491 Blast hits to 2440 proteins in 260 species: Archae - 0; Bacteria - 86; Metazoa - 579; Fungi - 564; Plants - 959; Viruses - 0; Other Eukaryotes - 303 (source: NCBI BLink). |
| AT3G09030 | AT3G09030.1 | GGCTTTTT | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT5G41330.1); Has 1331 Blast hits to 1319 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 1177; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT3G09670 | AT3G09670.1 | GGGCTTTTT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). |
| AT3G09670.2 | GGGCTTTTT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). |
| AT3G09720 | AT3G09720.1 | GGCTTTTT | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink). |
| AT3G10840 | AT3G10840.1 | AGTGGGCTTTTT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G15490.1); Has 4701 Blast hits to 4652 proteins in 739 species: Archae - 42; Bacteria - 3042; Metazoa - 265; Fungi - 67; Plants - 169; Viruses - 4; Other Eukaryotes - 1112 (source: NCBI BLink). |
| AT3G10940 | AT3G10940.1 | AAAAAGCCCAATAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G11500 | AT3G11500.1 | GGCTTTTT | small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G) (TAIR:AT2G23930.1); Has 921 Blast hits to 921 proteins in 197 species: Archae - 84; Bacteria - 0; Metazoa - 385; Fungi - 191; Plants - 117; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink). |
| AT3G11730 | AT3G11730.1 | AAAAAGCCCAAAT | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
| AT3G12203 | AT3G12203.1 | GGGCTTTTT | serine carboxypeptidase-like 17 (scpl17); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl16 (serine carboxypeptidase-like 16); serine-type carboxypeptidase (TAIR:AT3G12220.1); Has 2528 Blast hits to 2469 proteins in 280 species: Archae - 0; Bacteria - 129; Metazoa - 563; Fungi - 548; Plants - 983; Viruses - 0; Other Eukaryotes - 305 (source: NCBI BLink). |
| AT3G12260 | AT3G12260.1 | CTTAGGCCCATAAAAAGCCCATTAG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G12620 | AT3G12620.1 | GGCTTTTT | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2C (PP2C6) (TAIR:AT3G55050.2); Has 3612 Blast hits to 3610 proteins in 218 species: Archae - 0; Bacteria - 8; Metazoa - 1241; Fungi - 382; Plants - 1246; Viruses - 2; Other Eukaryotes - 733 (source: NCBI BLink). |
| AT3G12620.2 | GGCTTTTT | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2C (PP2C6) (TAIR:AT3G55050.2); Has 3612 Blast hits to 3610 proteins in 218 species: Archae - 0; Bacteria - 8; Metazoa - 1241; Fungi - 382; Plants - 1246; Viruses - 2; Other Eukaryotes - 733 (source: NCBI BLink). |
| AT3G13677 | AT3G13677.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13677.2 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13940 | AT3G13940.1 | AAAAAGCC | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase I associated factor, A49-like (InterPro:IPR009668); Has 150 Blast hits to 150 proteins in 69 species: Archae - 0; Bacteria - 1; Metazoa - 57; Fungi - 66; Plants - 15; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G14310 | AT3G14310.1 | AAAAAGCC | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G14400 | AT3G14400.1 | AGATGGGCCTAAAAAGCCCAGTA | Encodes a ubiquitin-specific protease. |
| AT3G14595 | AT3G14595.1 | AAAAAGCCACGTGGCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17080.1); Has 81 Blast hits to 81 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G14610 | AT3G14610.1 | AAAAAGCCC | putative cytochrome P450 |
| AT3G14860 | AT3G14860.1 | GGCTTTTT | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). |
| AT3G14860.2 | GGCTTTTT | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). |
| AT3G14990 | AT3G14990.1 | GGCTTTTT | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
| AT3G14990.2 | GGCTTTTT | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
| AT3G14990.3 | GGCTTTTT | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
| AT3G15040 | AT3G15040.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink). |
| AT3G15940 | AT3G15940.1 | GGCTTTTT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G52420.1); Has 6481 Blast hits to 6467 proteins in 933 species: Archae - 176; Bacteria - 3946; Metazoa - 40; Fungi - 36; Plants - 110; Viruses - 0; Other Eukaryotes - 2173 (source: NCBI BLink). |
| AT3G15950 | AT3G15950.1 | AAAAAGCCACGT | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT3G15950.2 | AAAAAGCCACGT | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT3G16810 | AT3G16810.1 | AAAAAGCC | Arabidopsis Pumilio 24 (APUM24); FUNCTIONS IN: RNA binding, binding; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 1729 Blast hits to 925 proteins in 171 species: Archae - 0; Bacteria - 1; Metazoa - 1021; Fungi - 301; Plants - 205; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT3G16950 | AT3G16950.1 | CAATGGGCTTTTT | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G16950.2 | CAATGGGCTTTTT | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G18190 | AT3G18190.1 | TAGGGCTTTTT | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink). |
| AT3G19760 | AT3G19760.1 | AAAAAGCCCTA | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink). |
| AT3G20270 | AT3G20270.1 | AAATGGGCTTTTT | lipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G21140 | AT3G21140.1 | AAAAAGCC | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT1G51560.1); Has 478 Blast hits to 478 proteins in 176 species: Archae - 0; Bacteria - 293; Metazoa - 3; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT3G21660 | AT3G21660.1 | AAAAAGCC | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012), SEP (InterPro:IPR012989); BEST Arabidopsis thaliana protein match is: PUX5 (Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma); protein binding (TAIR:AT4G15410.1); Has 901 Blast hits to 569 proteins in 154 species: Archae - 0; Bacteria - 31; Metazoa - 481; Fungi - 168; Plants - 100; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT3G21770 | AT3G21770.1 | GGCTTTTT | peroxidase 30 (PER30) (P30) (PRXR9); FUNCTIONS IN: transferase activity, transferring glycosyl groups, peroxidase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: cell wall, nucleus, cytoplasm, plant-type cell wall; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: RCI3 (RARE COLD INDUCIBLE GENE 3); peroxidase (TAIR:AT1G05260.1); Has 2896 Blast hits to 2881 proteins in 211 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 79; Plants - 2778; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G22590 | AT3G22590.1 | AAAAAGCCCATTAT | RNA pol II accessory factor Cdc73 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II accessory factor, Cdc73 (InterPro:IPR007852); Has 392 Blast hits to 300 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 87; Plants - 21; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G22750 | AT3G22750.1 | GGCTTTTT | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT4G14780.1); Has 94157 Blast hits to 93036 proteins in 3595 species: Archae - 75; Bacteria - 8061; Metazoa - 41878; Fungi - 7877; Plants - 18896; Viruses - 493; Other Eukaryotes - 16877 (source: NCBI BLink). |
| AT3G24150 | AT3G24150.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G24160 | AT3G24160.1 | GGCTTTTT | Encodes a putative Type 1 membrane protein (PMP). |
| AT3G24860 | AT3G24860.1 | AAAAAGCCCAAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT2G44730.1); Has 700 Blast hits to 557 proteins in 131 species: Archae - 0; Bacteria - 29; Metazoa - 100; Fungi - 40; Plants - 346; Viruses - 61; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT3G25110 | AT3G25110.1 | GGCTTTTT | Encodes a FatA acyl-ACP thioesterase |
| AT3G26170 | AT3G26170.1 | GGCTTTTT | putative cytochrome P450 |
| AT3G26670 | AT3G26670.1 | AAAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G26670.2 | AAAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G26670.3 | AAAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G27230 | AT3G27230.1 | AAAAAGCCCAT | LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G40830.2); Has 184 Blast hits to 183 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 182; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G27520 | AT3G27520.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G28140 | AT3G28140.1 | AAAAAGCC | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: RNA metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA ligase/cyclic nucleotide phosphodiesterase (InterPro:IPR009097); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT5G40190.1); Has 53 Blast hits to 53 proteins in 21 species: Archae - 0; Bacteria - 31; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G28140.2 | AAAAAGCC | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: RNA metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA ligase/cyclic nucleotide phosphodiesterase (InterPro:IPR009097); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT5G40190.1); Has 53 Blast hits to 53 proteins in 21 species: Archae - 0; Bacteria - 31; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G28930 | AT3G28930.1 | AAAAAGCC | avrRpt2-induced gene that exhibits RPS2- and avrRpt2-dependent induction early after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT3G29370 | AT3G29370.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39240.1); Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G29410 | AT3G29410.1 | AAAAAGCC | terpene synthase/cyclase family protein; FUNCTIONS IN: lyase activity, magnesium ion binding; INVOLVED IN: metabolic process; EXPRESSED IN: embryo, flower, root, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Terpene synthase, metal-binding domain (InterPro:IPR005630), Terpenoid synthase (InterPro:IPR008949), Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Terpene synthase-like (InterPro:IPR001906); BEST Arabidopsis thaliana protein match is: terpene synthase/cyclase family protein (TAIR:AT3G14490.1); Has 1080 Blast hits to 1067 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1077; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G32180 | AT3G32180.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G32160.1); Has 34 Blast hits to 22 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G45060 | AT3G45060.1 | AAAAAGCC | member of High affinity nitrate transporter family |
| AT3G46430 | AT3G46430.1 | AAAAAGCCCATTATGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59613.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46790 | AT3G46790.1 | AAAAAGCC | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation. |
| AT3G49080 | AT3G49080.1 | GGCTTTTT | ribosomal protein S9 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome (TAIR:AT1G74970.1); Has 5624 Blast hits to 5609 proteins in 1600 species: Archae - 138; Bacteria - 2917; Metazoa - 148; Fungi - 89; Plants - 121; Viruses - 18; Other Eukaryotes - 2193 (source: NCBI BLink). |
| AT3G49560 | AT3G49560.1 | TAAATGGGCTTTTTTCAGGCCCAG | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT5G24650.1); Has 56 Blast hits to 54 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G52140 | AT3G52140.1 | AAAAAGCCCAAACAAAGCCCATTAG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15290.1); Has 9395 Blast hits to 2929 proteins in 282 species: Archae - 109; Bacteria - 2193; Metazoa - 5294; Fungi - 854; Plants - 176; Viruses - 9; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G52480 | AT3G52480.1 | ATTTGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G53580 | AT3G53580.1 | CTTAATGGGCTTTTT | diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink). |
| AT3G54363 | AT3G54363.1 | AAAAAGCCAAACCG | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT3G54890 | AT3G54890.1 | AGACACGTGGCCCAATGAAAAAGCCACG | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT3G54890.2 | AGACACGTGGCCCAATGAAAAAGCCACG | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT3G54890.3 | AGACACGTGGCCCAATGAAAAAGCCACG | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT3G54890.4 | AGACACGTGGCCCAATGAAAAAGCCACG | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT3G56270 | AT3G56270.1 | AAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT3G56370 | AT3G56370.1 | GGCTTTTT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G01890.1); Has 151611 Blast hits to 99679 proteins in 3264 species: Archae - 101; Bacteria - 11605; Metazoa - 63918; Fungi - 7104; Plants - 48989; Viruses - 405; Other Eukaryotes - 19489 (source: NCBI BLink). |
| AT3G56580 | AT3G56580.1 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink). |
| AT3G56580.2 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink). |
| AT3G56580.3 | AAAAAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink). |
| AT3G57010 | AT3G57010.1 | AAAAAGCC | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT3G57020.1); Has 704 Blast hits to 697 proteins in 135 species: Archae - 1; Bacteria - 128; Metazoa - 196; Fungi - 0; Plants - 299; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT3G57560 | AT3G57560.1 | AAAAAGCC | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT3G57570 | AT3G57570.1 | GGCTTTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G58790 | AT3G58790.1 | GGCTTTTT | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G59070 | AT3G59070.1 | GGCTTTTT | auxin-responsive protein, putative; INVOLVED IN: multicellular organismal development; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G48750.1); Has 350 Blast hits to 350 proteins in 61 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 13; Plants - 243; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT3G60900 | AT3G60900.1 | GGCTTTTT | FLA10; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA8 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8) (TAIR:AT2G45470.1); Has 12081 Blast hits to 6122 proteins in 671 species: Archae - 102; Bacteria - 3569; Metazoa - 1134; Fungi - 757; Plants - 1832; Viruses - 697; Other Eukaryotes - 3990 (source: NCBI BLink). |
| AT3G61470 | AT3G61470.1 | AAAAAGCCCAAAA | Encodes a component of the light harvesting antenna complex of photosystem I. |
| AT3G61870 | AT3G61870.1 | AAAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G61870.2 | AAAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G62010 | AT3G62010.1 | AAAAAGCC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 392 Blast hits to 144 proteins in 61 species: Archae - 0; Bacteria - 83; Metazoa - 177; Fungi - 40; Plants - 41; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT3G62980 | AT3G62980.1 | GGCTTTTT | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. |
| AT3G63500 | AT3G63500.1 | GGGCTTTTT | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1423, plant (InterPro:IPR004082); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14740.1); Has 2817 Blast hits to 2297 proteins in 310 species: Archae - 8; Bacteria - 278; Metazoa - 1232; Fungi - 288; Plants - 201; Viruses - 10; Other Eukaryotes - 800 (source: NCBI BLink). |
| AT3G63520 | AT3G63520.1 | TATGGGCTTTTT | Encodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds. |
| AT4G00026 | AT4G00026.1 | AAAAAGCCCATTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); Has 168 Blast hits to 168 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 52; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G00030 | AT4G00030.1 | AAATGGGCTTTTT | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 126 Blast hits to 126 proteins in 26 species: Archae - 0; Bacteria - 11; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G00100 | AT4G00100.1 | ATGGGCTTTTT | Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development |
| AT4G02150 | AT4G02150.1 | TTTGGGCTTTAAAAAGCC | Encodes IMPORTIN ALPHA 3. Mutant plants act as suppressors of snc1 response and salicylic acid accumulation. Located in the nucleus. Involved in protein import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT4G02550 | AT4G02550.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.2 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.3 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02570 | AT4G02570.1 | AAAAAGCC | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G02570.2 | AAAAAGCC | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G02570.3 | AAAAAGCC | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G02790 | AT4G02790.1 | AAAAAGCCCA | GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT2G41670.1); Has 6347 Blast hits to 6027 proteins in 1205 species: Archae - 72; Bacteria - 3880; Metazoa - 692; Fungi - 374; Plants - 122; Viruses - 0; Other Eukaryotes - 1207 (source: NCBI BLink). |
| AT4G03430 | AT4G03430.1 | AAAAAGCCCATTAAAAAGCCCACTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G04670 | AT4G04670.1 | TGTTGGGCTTTTT | Met-10+ like family protein / kelch repeat-containing protein; INVOLVED IN: wybutosine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Protein of unknown function Met10 (InterPro:IPR003402), Kelch-type beta propeller (InterPro:IPR015915), tRNA wybutosine-synthesizing protein (InterPro:IPR003827); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18610.1); Has 8151 Blast hits to 4692 proteins in 304 species: Archae - 337; Bacteria - 119; Metazoa - 3836; Fungi - 887; Plants - 1022; Viruses - 20; Other Eukaryotes - 1930 (source: NCBI BLink). |
| AT4G07390 | AT4G07390.1 | GGCTTTTT | PQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT4G08500 | AT4G08500.1 | TAAGCCCAATTAAAAAGCCCAGTA | Member of MAP Kinase Kinase gene family. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates AtMEK1. |
| AT4G09000 | AT4G09000.1 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09750 | AT4G09750.1 | AAAAAGCCACGTCATC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G24050.1); Has 49720 Blast hits to 49652 proteins in 1938 species: Archae - 292; Bacteria - 27546; Metazoa - 4870; Fungi - 3259; Plants - 1240; Viruses - 0; Other Eukaryotes - 12513 (source: NCBI BLink). |
| AT4G10750 | AT4G10750.1 | GGGCTTTTT | HpcH/HpaI aldolase family protein; FUNCTIONS IN: carbon-carbon lyase activity, catalytic activity; INVOLVED IN: in 8 processes; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), HpcH/HpaI aldolase (InterPro:IPR005000); BEST Arabidopsis thaliana protein match is: ALL1 (Aldolase like); carbon-carbon lyase/ catalytic (TAIR:AT4G24080.1); Has 2940 Blast hits to 2939 proteins in 494 species: Archae - 8; Bacteria - 1472; Metazoa - 0; Fungi - 122; Plants - 25; Viruses - 0; Other Eukaryotes - 1313 (source: NCBI BLink). |
| AT4G11220 | AT4G11220.1 | AAAAAGCC | VIRB2-INTERACTING PROTEIN 2 (BTI2); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: BTI1 (VIRB2-INTERACTING PROTEIN 1) (TAIR:AT4G23630.1); Has 982 Blast hits to 982 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 664; Fungi - 12; Plants - 283; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT4G11260 | AT4G11260.1 | AAAAAGCC | Functions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. |
| AT4G11740 | AT4G11740.1 | AAAAAGCCCAAAA | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
| AT4G12570 | AT4G12570.1 | GGCTTTTT | UBIQUITIN PROTEIN LIGASE 5 (UPL5); FUNCTIONS IN: ubiquitin-protein ligase activity, binding, acid-amino acid ligase activity; INVOLVED IN: protein modification process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C-type lectin (InterPro:IPR001304), Ubiquitin (InterPro:IPR000626), HECT (InterPro:IPR000569), C-type lectin, conserved site (InterPro:IPR018378); BEST Arabidopsis thaliana protein match is: UPL1 (UBIQUITIN-PROTEIN LIGASE 1); ubiquitin-protein ligase (TAIR:AT1G55860.1); Has 9656 Blast hits to 6258 proteins in 570 species: Archae - 0; Bacteria - 6; Metazoa - 4838; Fungi - 1209; Plants - 1658; Viruses - 155; Other Eukaryotes - 1790 (source: NCBI BLink). |
| AT4G13270 | AT4G13270.1 | AAAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52330.1); Has 109 Blast hits to 109 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 109; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14320 | AT4G14320.1 | TTAATGGGCTTTTT | 60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G14330 | AT4G14330.1 | AAAAAGCCCATTAA | phragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink). |
| AT4G15630 | AT4G15630.1 | AAAAAGCCACGTA | integral membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); BEST Arabidopsis thaliana protein match is: integral membrane family protein (TAIR:AT4G15620.1); Has 298 Blast hits to 298 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 298; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16490 | AT4G16490.1 | AAAAAGCC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G01400.1); Has 213 Blast hits to 211 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 206; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G16490.1 | GGGCTTTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G01400.1); Has 213 Blast hits to 211 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 206; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G17190 | AT4G17190.1 | TAAATGGGCCACAAAAAGCCCATTTA | Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. |
| AT4G17190.2 | TAAATGGGCCACAAAAAGCCCATTTA | Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. |
| AT4G17570 | AT4G17570.1 | AAAAAGCC | zinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT5G47140.1); Has 593 Blast hits to 574 proteins in 91 species: Archae - 0; Bacteria - 4; Metazoa - 17; Fungi - 134; Plants - 403; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G18100 | AT4G18100.1 | GGCTTTTT | 60S ribosomal protein L32 (RPL32A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32e (InterPro:IPR001515), Ribosomal protein L32e, conserved site (InterPro:IPR018263); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L32 (RPL32B) (TAIR:AT5G46430.2); Has 1112 Blast hits to 1112 proteins in 342 species: Archae - 217; Bacteria - 0; Metazoa - 540; Fungi - 96; Plants - 104; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G18460 | AT4G18460.1 | GGCTTTTT | D-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink). |
| AT4G18760 | AT4G18760.1 | AAAAAGCC | Receptor Like Protein 51 (AtRLP51); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP55 (Receptor Like Protein 55); protein binding (TAIR:AT5G45770.1); Has 49381 Blast hits to 18169 proteins in 775 species: Archae - 21; Bacteria - 2325; Metazoa - 12582; Fungi - 717; Plants - 30648; Viruses - 12; Other Eukaryotes - 3076 (source: NCBI BLink). |
| AT4G18890 | AT4G18890.1 | AAAAAGCC | brassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT1G78700.1); Has 301 Blast hits to 214 proteins in 26 species: Archae - 0; Bacteria - 8; Metazoa - 41; Fungi - 2; Plants - 152; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G21410 | AT4G21410.1 | GGCTTTTT | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: response to abscisic acid stimulus; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G21400.1); Has 88589 Blast hits to 87458 proteins in 3258 species: Archae - 51; Bacteria - 7783; Metazoa - 38493; Fungi - 6974; Plants - 19666; Viruses - 409; Other Eukaryotes - 15213 (source: NCBI BLink). |
| AT4G21600 | AT4G21600.1 | GGGCTTTTT | Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). |
| AT4G22750 | AT4G22750.1 | AAAAAGCC | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1). |
| AT4G22750.2 | AAAAAGCC | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1). |
| AT4G23630 | AT4G23630.1 | GGCTTTTT | VIRB2-INTERACTING PROTEIN 1 (BTI1); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: BTI2 (VIRB2-INTERACTING PROTEIN 2) (TAIR:AT4G11220.1); Has 962 Blast hits to 962 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 10; Plants - 284; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G24210 | AT4G24210.1 | AGATGGGCTTGGGCTTTTT | F-box protein that is involved in GA signaling. Regulates seed germination. Component of E3 ubiquitin complex. Interacts with DELLA proteins. |
| AT4G24570 | AT4G24570.1 | AAAAAGCCCAATTA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink). |
| AT4G24780 | AT4G24780.1 | GGCTTTTT | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT5G63180.1); Has 863 Blast hits to 860 proteins in 162 species: Archae - 0; Bacteria - 350; Metazoa - 0; Fungi - 105; Plants - 397; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT4G25450 | AT4G25450.1 | GTCCACGTGGCTTTTT | member of NAP subfamily |
| AT4G25450.2 | GTCCACGTGGCTTTTT | member of NAP subfamily |
| AT4G25450.3 | GTCCACGTGGCTTTTT | member of NAP subfamily |
| AT4G28450 | AT4G28450.1 | AAAAAGCCCATTAAG | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G28610 | AT4G28610.1 | AAAAAGCC | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling. |
| AT4G30350 | AT4G30350.1 | AAAAAGCC | heat shock protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT5G57710.1); Has 9629 Blast hits to 8914 proteins in 1507 species: Archae - 15; Bacteria - 6840; Metazoa - 9; Fungi - 184; Plants - 322; Viruses - 0; Other Eukaryotes - 2259 (source: NCBI BLink). |
| AT4G30350.1 | GGCTTTTT | heat shock protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT5G57710.1); Has 9629 Blast hits to 8914 proteins in 1507 species: Archae - 15; Bacteria - 6840; Metazoa - 9; Fungi - 184; Plants - 322; Viruses - 0; Other Eukaryotes - 2259 (source: NCBI BLink). |
| AT4G30620 | AT4G30620.1 | TTTGGGCTTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT4G30660 | AT4G30660.1 | AAAAAGCC | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G30660.2 | AAAAAGCC | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G30890 | AT4G30890.1 | GGCTTTTT | Encodes a ubiquitin-specific protease. |
| AT4G30890.2 | GGCTTTTT | Encodes a ubiquitin-specific protease. |
| AT4G31460 | AT4G31460.1 | AAAAAGCCCAAC | ribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink). |
| AT4G31930 | AT4G31930.1 | AAAAAGCCCAC | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT4G31985 | AT4G31985.1 | AAAAAGCCCAATAA | 60S ribosomal protein L39 (RPL39C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39B) (TAIR:AT3G02190.1); Has 591 Blast hits to 591 proteins in 225 species: Archae - 151; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT4G32590 | AT4G32590.1 | AAAAAGCC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.2 | AAAAAGCC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.3 | AAAAAGCC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.4 | AAAAAGCC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32660 | AT4G32660.1 | AAAAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.2 | AAAAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.3 | AAAAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32930 | AT4G32930.1 | AATTGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF866, eukaryotic (InterPro:IPR008584); Has 275 Blast hits to 274 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 73; Plants - 42; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT4G34620 | AT4G34620.1 | AAAAAGCC | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
| AT4G35000 | AT4G35000.1 | AAAAAGCC | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35140 | AT4G35140.1 | GAAGCCCAAAAAGCCCAATG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). |
| AT4G35910 | AT4G35910.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 222 Blast hits to 208 proteins in 90 species: Archae - 2; Bacteria - 0; Metazoa - 113; Fungi - 80; Plants - 19; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT4G36980 | AT4G36980.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink). |
| AT4G36980.2 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink). |
| AT4G37040 | AT4G37040.1 | AAAAAGCCCAT | encodes a methionine aminopeptidase |
| AT4G37160 | AT4G37160.1 | GGCTTTTT | SKU5 Similar 15 (sks15); FUNCTIONS IN: oxidoreductase activity, copper ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: sks16 (SKU5 Similar 16); copper ion binding / pectinesterase (TAIR:AT2G23630.1); Has 3813 Blast hits to 3802 proteins in 678 species: Archae - 8; Bacteria - 1022; Metazoa - 253; Fungi - 1594; Plants - 773; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). |
| AT4G37520 | AT4G37520.1 | AAAAAGCC | peroxidase 50 (PER50) (P50) (PRXR2); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT4G37530.1); Has 3003 Blast hits to 2988 proteins in 241 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 172; Plants - 2780; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT4G37880 | AT4G37880.1 | ATAATGGGCTTTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22690.2); Has 631 Blast hits to 627 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 324; Fungi - 158; Plants - 74; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G38530 | AT4G38530.1 | AAAAAGCC | Encodes a putative phosphoinositide-specific phospholipase C. There are two genes called ATPLC1, one corresponding to AT4g38530 (this one) and one corresponding to AT5g58670. |
| AT4G39235 | AT4G39235.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05570.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G01110 | AT5G01110.1 | GGCTTTTT | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink). |
| AT5G02050 | AT5G02050.1 | GGCTTTTT | mitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 39; Fungi - 94; Plants - 115; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G02610 | AT5G02610.1 | AAAAAGCCCAT | 60S ribosomal protein L35 (RPL35D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 840 Blast hits to 840 proteins in 308 species: Archae - 109; Bacteria - 145; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT5G03740 | AT5G03740.1 | CCGTTAAAAAAAGCC | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression |
| AT5G05320 | AT5G05320.1 | TTATGGGCTTTTT | monooxygenase, putative (MO3); FUNCTIONS IN: monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: monooxygenase, putative (MO2) (TAIR:AT4G38540.1); Has 3563 Blast hits to 3548 proteins in 650 species: Archae - 42; Bacteria - 1804; Metazoa - 7; Fungi - 839; Plants - 277; Viruses - 0; Other Eukaryotes - 594 (source: NCBI BLink). |
| AT5G05970 | AT5G05970.1 | AAAAAGCC | a WD40 repeat protein related to the animal NEDD1/GCP-WD protein, which interacts with the g-tubulin complex. Plays a critical role in MT organization during mitosis |
| AT5G05970.2 | AAAAAGCC | a WD40 repeat protein related to the animal NEDD1/GCP-WD protein, which interacts with the g-tubulin complex. Plays a critical role in MT organization during mitosis |
| AT5G06560 | AT5G06560.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11850.2); Has 800 Blast hits to 744 proteins in 109 species: Archae - 8; Bacteria - 38; Metazoa - 326; Fungi - 28; Plants - 211; Viruses - 24; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT5G08190 | AT5G08190.1 | AAAAAGCCCATTT | NUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G08190.2 | AAAAAGCCCATTT | NUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G10050 | AT5G10050.1 | GGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT5G65205.1); Has 81170 Blast hits to 81015 proteins in 2374 species: Archae - 457; Bacteria - 44780; Metazoa - 6876; Fungi - 4265; Plants - 1648; Viruses - 2; Other Eukaryotes - 23142 (source: NCBI BLink). |
| AT5G10160 | AT5G10160.1 | TAATTGGGCCTAAAAAAGCCCAACT | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). |
| AT5G11520 | AT5G11520.1 | GGCTTTTT | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
| AT5G11560 | AT5G11560.1 | GGCTTTTT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1620 (InterPro:IPR011678), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); Has 361 Blast hits to 325 proteins in 153 species: Archae - 4; Bacteria - 34; Metazoa - 139; Fungi - 102; Plants - 18; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G14040 | AT5G14040.1 | AAAAAGCCCATGGGCCAA | mitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink). |
| AT5G14050 | AT5G14050.1 | TTGGCCCATGGGCTTTTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink). |
| AT5G14650 | AT5G14650.1 | GGCTTTTT | polygalacturonase, putative / pectinase, putative; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, LP.02 two leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: polygalacturonase, putative / pectinase, putative (TAIR:AT1G60590.1); Has 2723 Blast hits to 2712 proteins in 393 species: Archae - 2; Bacteria - 574; Metazoa - 8; Fungi - 1164; Plants - 893; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). |
| AT5G15090 | AT5G15090.1 | AAAAAGCC | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT5G17280 | AT5G17280.1 | GGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 223 Blast hits to 223 proteins in 123 species: Archae - 0; Bacteria - 72; Metazoa - 36; Fungi - 80; Plants - 15; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G17870 | AT5G17870.1 | CAAAGGCCCAATAAAAAAGCCCA | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G18230 | AT5G18230.1 | AAAAAGCCC | transcription regulator NOT2/NOT3/NOT5 family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: negative regulation of transcription, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NOT2/NOT3/NOT5 (InterPro:IPR007282), CCR4-NOT complex, subunits 3 and 5 (InterPro:IPR012270), Not CCR4-Not complex component, N-terminal (InterPro:IPR007207); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT1G07705.2). |
| AT5G18230.2 | AAAAAGCCC | transcription regulator NOT2/NOT3/NOT5 family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: negative regulation of transcription, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NOT2/NOT3/NOT5 (InterPro:IPR007282), CCR4-NOT complex, subunits 3 and 5 (InterPro:IPR012270), Not CCR4-Not complex component, N-terminal (InterPro:IPR007207); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT1G07705.2). |
| AT5G18860 | AT5G18860.1 | GGCTTTTT | inosine-uridine preferring nucleoside hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: inosine-uridine preferring nucleoside hydrolase family protein (TAIR:AT5G18890.1); Has 3818 Blast hits to 2401 proteins in 580 species: Archae - 30; Bacteria - 2470; Metazoa - 138; Fungi - 117; Plants - 124; Viruses - 0; Other Eukaryotes - 939 (source: NCBI BLink). |
| AT5G19875 | AT5G19875.1 | AAAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 63 Blast hits to 63 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20140 | AT5G20140.1 | AAAAAGCC | SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink). |
| AT5G20635 | AT5G20635.1 | AAAAAGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: keratin filament, chloroplast; CONTAINS InterPro DOMAIN/s: Keratin, high sulphur B2 protein (InterPro:IPR002494); Has 5724 Blast hits to 2501 proteins in 208 species: Archae - 6; Bacteria - 25; Metazoa - 4583; Fungi - 39; Plants - 97; Viruses - 40; Other Eukaryotes - 934 (source: NCBI BLink). |
| AT5G21020 | AT5G21020.2 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G21920 | AT5G21920.1 | AAAAAGCC | YGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). |
| AT5G21930 | AT5G21930.1 | GGCTTTTT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G21930.2 | GGCTTTTT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G22210 | AT5G22210.1 | CTAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G22210.2 | CTAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23730 | AT5G23730.1 | AAAAAGCC | nucleotide binding; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G52250.1); Has 9016 Blast hits to 6231 proteins in 356 species: Archae - 12; Bacteria - 1820; Metazoa - 3399; Fungi - 1848; Plants - 686; Viruses - 0; Other Eukaryotes - 1251 (source: NCBI BLink). |
| AT5G24760 | AT5G24760.1 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink). |
| AT5G24760.2 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink). |
| AT5G24760.3 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink). |
| AT5G24810 | AT5G24810.1 | AAAAAGCCCAACA | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). |
| AT5G35630 | AT5G35630.1 | AAAAAGCC | chloroplastic glutamine synthetase |
| AT5G35630.2 | AAAAAGCC | chloroplastic glutamine synthetase |
| AT5G35630.3 | AAAAAGCC | chloroplastic glutamine synthetase |
| AT5G37510 | AT5G37510.1 | AAAAAGCCCACAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. |
| AT5G37510.2 | AAAAAGCCCACAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. |
| AT5G39320 | AT5G39320.1 | GGCTTTTT | UDP-glucose 6-dehydrogenase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucose/GDP-mannose dehydrogenase, N-terminal (InterPro:IPR001732), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), UDP-glucose/GDP-mannose dehydrogenase, dimerisation and substrate-binding (InterPro:IPR014028), UDP-glucose/GDP-mannose dehydrogenase, C-terminal (InterPro:IPR014027), NAD(P)-binding (InterPro:IPR016040), UDP-glucose/GDP-mannose dehydrogenase, dimerisation (InterPro:IPR014026), Nucleotide sugar dehydrogenase (InterPro:IPR017476); BEST Arabidopsis thaliana protein match is: UDP-glucose 6-dehydrogenase, putative (TAIR:AT3G29360.2); Has 10074 Blast hits to 10058 proteins in 1240 species: Archae - 198; Bacteria - 3918; Metazoa - 183; Fungi - 74; Plants - 117; Viruses - 14; Other Eukaryotes - 5570 (source: NCBI BLink). |
| AT5G39850 | AT5G39850.1 | AAAAAGCCCAATGGGCCAA | 40S ribosomal protein S9 (RPS9C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9B) (TAIR:AT5G15200.1); Has 5400 Blast hits to 5397 proteins in 2680 species: Archae - 171; Bacteria - 348; Metazoa - 335; Fungi - 191; Plants - 3457; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink). |
| AT5G43540 | AT5G43540.1 | AAAAAGCC | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT3G53820.1); Has 401 Blast hits to 399 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 0; Plants - 380; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G44080 | AT5G44080.1 | AAAAAGCCCTA | bZIP transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: GBF4; DNA binding / sequence-specific DNA binding / transcription factor (TAIR:AT1G03970.1); Has 730 Blast hits to 730 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 2; Plants - 496; Viruses - 1; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT5G45990 | AT5G45990.1 | TTTTGGGCTTTTGGGCTTTTT | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink). |
| AT5G46250 | AT5G46250.1 | AAAAAGCC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46250.2 | AAAAAGCC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46250.3 | AAAAAGCC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G47590 | AT5G47590.1 | AAAAAGCC | heat shock protein-related; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Small heat shock protein, predicted, plant (InterPro:IPR016952), Peptidase A1 (InterPro:IPR001461), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT4G16550.1); Has 51 Blast hits to 42 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G48905 | AT5G48905.1 | GGCTTTTT | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G49220 | AT5G49220.1 | AAAAAGCCCAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16100.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G51200 | AT5G51200.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 176 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 19; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G51700 | AT5G51700.1 | AAAAAGCCC | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
| AT5G53420 | AT5G53420.1 | GGCTTTATGGGCTTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27900.2); Has 863 Blast hits to 863 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 840; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G53420.3 | GGCTTTATGGGCTTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27900.2); Has 863 Blast hits to 863 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 840; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G54900 | AT5G54900.1 | AATTGGGCCTATAAAAAAGCC | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G55400 | AT5G55400.1 | GGCTTTTT | fimbrin-like protein, putative; FUNCTIONS IN: actin binding; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Actinin-type, actin-binding, conserved site (InterPro:IPR001589), EF-HAND 1 (InterPro:IPR018247), Calponin-homology (InterPro:IPR016146), Calponin-like actin-binding (InterPro:IPR001715); BEST Arabidopsis thaliana protein match is: ATFIM1; actin binding (TAIR:AT4G26700.2); Has 4936 Blast hits to 2333 proteins in 172 species: Archae - 2; Bacteria - 71; Metazoa - 2845; Fungi - 408; Plants - 86; Viruses - 0; Other Eukaryotes - 1524 (source: NCBI BLink). |
| AT5G55910 | AT5G55910.1 | AAAAAGCC | D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. |
| AT5G57490 | AT5G57490.1 | AAAAAGCCC | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT5G59730 | AT5G59730.1 | AAAAAGCCGTCGTTTC | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59730.2 | AAAAAGCCGTCGTTTC | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59790 | AT5G59790.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF966 (InterPro:IPR010369); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46110.1); Has 96 Blast hits to 95 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 90; Viruses - 3; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G60030 | AT5G60030.1 | GTTTGGGCTTTTT | unknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink). |
| AT5G60540 | AT5G60540.1 | GGCTTTTT | Encodes a protein predicted to function in tandem with PDX1 to form glutamine amidotransferase complex with involved in vitamin B6 biosynthesis. PDX2 is predicted to function as glutaminase within the complex. |
| AT5G60840 | AT5G60840.1 | AAAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; Has 359 Blast hits to 315 proteins in 79 species: Archae - 2; Bacteria - 43; Metazoa - 176; Fungi - 34; Plants - 19; Viruses - 19; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT5G61150 | AT5G61150.1 | AAAAAGCCCATAA | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. |
| AT5G61150.2 | AAAAAGCCCATAA | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. |
| AT5G62070 | AT5G62070.1 | AAAAAGCC | IQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 4; Plants - 406; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G62880 | AT5G62880.1 | AAAAAGCC | A member of ROP GTPase gene family. |
| AT5G63510 | AT5G63510.1 | CCGTTAAAAAGCCCAATAT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT5G63630 | AT5G63630.1 | AAAAAGCC | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase (RH26) (TAIR:AT5G08610.1); Has 27043 Blast hits to 26460 proteins in 1692 species: Archae - 431; Bacteria - 10802; Metazoa - 5031; Fungi - 3249; Plants - 1370; Viruses - 10; Other Eukaryotes - 6150 (source: NCBI BLink). |
| AT5G63760 | AT5G63760.1 | GGCTTTTT | IBR domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: IBR domain-containing protein (TAIR:AT5G63750.1); Has 1361 Blast hits to 1359 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 751; Fungi - 99; Plants - 254; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT5G63760.2 | GGCTTTTT | IBR domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: IBR domain-containing protein (TAIR:AT5G63750.1); Has 1361 Blast hits to 1359 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 751; Fungi - 99; Plants - 254; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT5G64140 | AT5G64140.1 | AAAAAGCCCATAT | Encodes a putative ribosomal protein S28. |
| AT5G64140.1 | TATGGGCTTTTT | Encodes a putative ribosomal protein S28. |
| AT5G66200 | AT5G66200.1 | GGCTTTTT | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT5G66850 | AT5G66850.1 | AAAAAGCC | member of MEKK subfamily |
| AT5G67290 | AT5G67290.1 | GGCTTTTT | FAD-dependent oxidoreductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); Has 4766 Blast hits to 4696 proteins in 673 species: Archae - 74; Bacteria - 2349; Metazoa - 201; Fungi - 175; Plants - 42; Viruses - 0; Other Eukaryotes - 1925 (source: NCBI BLink). |
| ATCG00170 | ATCG00170.1 | AAAAAGCC | RNA polymerase beta' subunit-2 |