| Locus | Gene model | Sequence | Description |
| AT1G01500 | AT1G01500.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G03650 | AT1G03650.1 | GGGTCAAA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1907 Blast hits to 1907 proteins in 687 species: Archae - 132; Bacteria - 1082; Metazoa - 181; Fungi - 133; Plants - 50; Viruses - 0; Other Eukaryotes - 329 (source: NCBI BLink). |
| AT1G03950 | AT1G03950.1 | TTTGACCC | VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN 2.3 (VPS2.3); INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS2.2 (TAIR:AT5G44560.1); Has 1238 Blast hits to 1237 proteins in 168 species: Archae - 0; Bacteria - 6; Metazoa - 605; Fungi - 223; Plants - 241; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). |
| AT1G03960 | AT1G03960.1 | GGGTCAAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein, putative / protein phosphatase 2A 62 kDa B'' regulatory subunit, putative (TAIR:AT5G44090.1); Has 558 Blast hits to 555 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 328; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT1G04530 | AT1G04530.1 | GGGTCAAA | binding; FUNCTIONS IN: binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G17940.1); Has 445 Blast hits to 236 proteins in 47 species: Archae - 10; Bacteria - 76; Metazoa - 30; Fungi - 6; Plants - 278; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT1G04640 | AT1G04640.1 | TTTGACCC | Lipoyltransferase, located in mitochondria but not found in chloroplasts |
| AT1G04640.2 | TTTGACCC | Lipoyltransferase, located in mitochondria but not found in chloroplasts |
| AT1G04750 | AT1G04750.1 | TTTGACCC | vesicle-associated membrane protein 7B (At VAMP7B) mRNA, |
| AT1G04750.2 | TTTGACCC | vesicle-associated membrane protein 7B (At VAMP7B) mRNA, |
| AT1G06770 | AT1G06770.1 | TTTGACCC | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
| AT1G15020 | AT1G15020.1 | TTTTGGGCGGGTCAAA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G15020.2 | TTTTGGGCGGGTCAAA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G15030 | AT1G15030.1 | GGGTCAAA | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT1G17520 | AT1G17520.1 | TTTGACCCCTTA | DNA-binding protein, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 6 processes; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Histone H1/H5 (InterPro:IPR005818), Homeodomain-related (InterPro:IPR012287), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / histone H1/H5 family protein (TAIR:AT1G72740.1); Has 615 Blast hits to 611 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 63; Plants - 394; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G17530 | AT1G17530.1 | TAAGGGGTCAAA | Encodes a translocase of inner mitochondrial membrane. |
| AT1G17730 | AT1G17730.1 | TCAGGGGTCAAA | VACUOLAR PROTEIN SORTING 46.1 (VPS46.1); INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.2 (TAIR:AT1G73030.1); Has 975 Blast hits to 975 proteins in 162 species: Archae - 2; Bacteria - 0; Metazoa - 421; Fungi - 185; Plants - 220; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT1G18500 | AT1G18500.1 | TTCCACGTGGGTCAAA | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). |
| AT1G19130 | AT1G19130.1 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF985 (InterPro:IPR009327), RmlC-like jelly roll fold (InterPro:IPR014710); Has 778 Blast hits to 778 proteins in 280 species: Archae - 8; Bacteria - 513; Metazoa - 2; Fungi - 16; Plants - 22; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink). |
| AT1G20770 | AT1G20770.1 | ATAACCGGTTTGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G20780 | AT1G20780.1 | TTCGGGTCAAACCGGTTAT | Encodes a protein containing a U-box and an ARM domain. |
| AT1G21910 | AT1G21910.1 | TTTGACCC | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G23830 | AT1G23830.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23840.1); Has 33 Blast hits to 30 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G26580 | AT1G26580.1 | GGGTCAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myb family transcription factor / ELM2 domain-containing protein (TAIR:AT2G03470.1); Has 82 Blast hits to 82 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G30135 | AT1G30135.1 | GGGTCAAA | JASMONATE-ZIM-DOMAIN PROTEIN 8 (JAZ8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ7 (JASMONATE-ZIM-DOMAIN PROTEIN 7) (TAIR:AT2G34600.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G31814 | AT1G31814.1 | TTTGACCCAATAG | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885 |
| AT1G36050 | AT1G36050.1 | TAAATGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22200.1); Has 910 Blast hits to 798 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 392; Fungi - 181; Plants - 141; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT1G36050.2 | TAAATGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22200.1); Has 910 Blast hits to 798 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 392; Fungi - 181; Plants - 141; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT1G48090 | AT1G48090.1 | GGGTCAAA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17140.1); Has 1972 Blast hits to 1096 proteins in 156 species: Archae - 2; Bacteria - 10; Metazoa - 987; Fungi - 338; Plants - 230; Viruses - 0; Other Eukaryotes - 405 (source: NCBI BLink). |
| AT1G48090.2 | GGGTCAAA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17140.1); Has 1972 Blast hits to 1096 proteins in 156 species: Archae - 2; Bacteria - 10; Metazoa - 987; Fungi - 338; Plants - 230; Viruses - 0; Other Eukaryotes - 405 (source: NCBI BLink). |
| AT1G50920 | AT1G50920.1 | TTTGACCC | GTP-binding protein-related; FUNCTIONS IN: GTP binding, nucleotide binding; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674), NOG, C-terminal (InterPro:IPR012973); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G10300.1); Has 6304 Blast hits to 6137 proteins in 1196 species: Archae - 232; Bacteria - 2737; Metazoa - 1044; Fungi - 314; Plants - 177; Viruses - 0; Other Eukaryotes - 1800 (source: NCBI BLink). |
| AT1G53140 | AT1G53140.1 | TTTGACCC | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
| AT1G53730 | AT1G53730.1 | ATAATGGGTCAAA | STRUBBELIG-RECEPTOR FAMILY 6 (SRF6); FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF7 (STRUBBELIG-RECEPTOR FAMILY 7); ATP binding / protein binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT3G14350.1); Has 107911 Blast hits to 84979 proteins in 2317 species: Archae - 64; Bacteria - 9020; Metazoa - 40372; Fungi - 5700; Plants - 38429; Viruses - 278; Other Eukaryotes - 14048 (source: NCBI BLink). |
| AT1G53730.2 | ATAATGGGTCAAA | STRUBBELIG-RECEPTOR FAMILY 6 (SRF6); FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF7 (STRUBBELIG-RECEPTOR FAMILY 7); ATP binding / protein binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT3G14350.1); Has 107911 Blast hits to 84979 proteins in 2317 species: Archae - 64; Bacteria - 9020; Metazoa - 40372; Fungi - 5700; Plants - 38429; Viruses - 278; Other Eukaryotes - 14048 (source: NCBI BLink). |
| AT1G54115 | AT1G54115.1 | GGGTCAAA | Involved in cation (Na and K) homeostasis. |
| AT1G54880 | AT1G54880.1 | TCTAGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G54920 | AT1G54920.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 434 Blast hits to 317 proteins in 67 species: Archae - 2; Bacteria - 27; Metazoa - 209; Fungi - 34; Plants - 25; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT1G54920.2 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 434 Blast hits to 317 proteins in 67 species: Archae - 2; Bacteria - 27; Metazoa - 209; Fungi - 34; Plants - 25; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT1G56440 | AT1G56440.1 | TTTGACCCGACC | serine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). |
| AT1G56450 | AT1G56450.1 | GGTCGGGTCAAA | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds |
| AT1G58110 | AT1G58110.1 | GGGTCAAA | bZIP family transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G06598.1); Has 469 Blast hits to 465 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 20; Plants - 358; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT1G58110.2 | GGGTCAAA | bZIP family transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G06598.1); Has 469 Blast hits to 465 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 20; Plants - 358; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT1G63500 | AT1G63500.1 | TTTGACCC | ATP binding / binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, binding, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tetratricopeptide-like helical (InterPro:IPR011990), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G41260.1); Has 16820 Blast hits to 16536 proteins in 587 species: Archae - 4; Bacteria - 565; Metazoa - 3898; Fungi - 88; Plants - 11430; Viruses - 67; Other Eukaryotes - 768 (source: NCBI BLink). |
| AT1G63830 | AT1G63830.1 | GGGTCAAA | proline-rich family protein; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G41390.1); Has 417 Blast hits to 328 proteins in 109 species: Archae - 0; Bacteria - 18; Metazoa - 107; Fungi - 25; Plants - 144; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink). |
| AT1G63830.2 | GGGTCAAA | proline-rich family protein; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G41390.1); Has 417 Blast hits to 328 proteins in 109 species: Archae - 0; Bacteria - 18; Metazoa - 107; Fungi - 25; Plants - 144; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink). |
| AT1G65930 | AT1G65930.1 | GGGTCAAA | isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, copper ion binding; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: apoplast, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: ICDH (ISOCITRATE DEHYDROGENASE); isocitrate dehydrogenase (NADP+)/ oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor (TAIR:AT1G54340.1); Has 4101 Blast hits to 4085 proteins in 611 species: Archae - 17; Bacteria - 632; Metazoa - 448; Fungi - 160; Plants - 247; Viruses - 0; Other Eukaryotes - 2597 (source: NCBI BLink). |
| AT1G66160 | AT1G66160.1 | TTTGACCC | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G37490.1); Has 1387 Blast hits to 1378 proteins in 121 species: Archae - 0; Bacteria - 14; Metazoa - 190; Fungi - 41; Plants - 975; Viruses - 3; Other Eukaryotes - 164 (source: NCBI BLink). |
| AT1G66160.2 | TTTGACCC | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G37490.1); Has 1387 Blast hits to 1378 proteins in 121 species: Archae - 0; Bacteria - 14; Metazoa - 190; Fungi - 41; Plants - 975; Viruses - 3; Other Eukaryotes - 164 (source: NCBI BLink). |
| AT1G67325 | AT1G67325.1 | GGGTCAAA | binding / zinc ion binding; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: TAF15 (TBP-associated factor 15); RNA binding / nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT1G50300.1); Has 1400 Blast hits to 940 proteins in 111 species: Archae - 0; Bacteria - 4; Metazoa - 839; Fungi - 67; Plants - 293; Viruses - 0; Other Eukaryotes - 197 (source: NCBI BLink). |
| AT1G68390 | AT1G68390.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68380.1); Has 359 Blast hits to 359 proteins in 24 species: Archae - 0; Bacteria - 6; Metazoa - 12; Fungi - 0; Plants - 306; Viruses - 9; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G68840 | AT1G68840.1 | TTTGACCC | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) |
| AT1G77510 | AT1G77510.1 | GGGTCAAA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT1G78700 | AT1G78700.1 | GGGTCAAA | brassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink). |
| AT1G80170 | AT1G80170.1 | GGGTCAAA | polygalacturonase, putative / pectinase, putative; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plant-type cell wall; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectin lyase fold (InterPro:IPR012334), Glycoside hydrolase, family 28 (InterPro:IPR000743), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: polygalacturonase, putative / pectinase, putative (TAIR:AT1G70500.1); Has 2438 Blast hits to 2429 proteins in 297 species: Archae - 2; Bacteria - 459; Metazoa - 8; Fungi - 992; Plants - 896; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT1G80180 | AT1G80180.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15400.3); Has 46 Blast hits to 46 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G80550 | AT1G80550.1 | TTCGGGTCAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink). |
| AT2G03120 | AT2G03120.1 | TTTGACCC | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. |
| AT2G03220 | AT2G03220.1 | GGGTCAAA | member of Glycosyltransferase Family- 37 |
| AT2G06210 | AT2G06210.1 | TTTGACCC | Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. |
| AT2G16430 | AT2G16430.1 | GGGTCAAA | PURPLE ACID PHOSPHATASE 10 (PAP10); FUNCTIONS IN: protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP12 (PURPLE ACID PHOSPHATASE 12); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G27190.1); Has 1151 Blast hits to 1142 proteins in 253 species: Archae - 2; Bacteria - 293; Metazoa - 169; Fungi - 60; Plants - 442; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT2G16430.2 | GGGTCAAA | PURPLE ACID PHOSPHATASE 10 (PAP10); FUNCTIONS IN: protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP12 (PURPLE ACID PHOSPHATASE 12); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G27190.1); Has 1151 Blast hits to 1142 proteins in 253 species: Archae - 2; Bacteria - 293; Metazoa - 169; Fungi - 60; Plants - 442; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT2G17200 | AT2G17200.1 | TTTGACCCGACCCGGT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink). |
| AT2G17340 | AT2G17340.1 | TTTGACCC | pantothenate kinase-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Domain of unknown function DUF89 (InterPro:IPR002791), Uncharacterised conserved protein UCP030210 (InterPro:IPR016949); BEST Arabidopsis thaliana protein match is: pantothenate kinase family protein (TAIR:AT4G35360.1); Has 221 Blast hits to 221 proteins in 82 species: Archae - 33; Bacteria - 28; Metazoa - 87; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G17500 | AT2G17500.1 | GGGTCAAA | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G65980.1); Has 400 Blast hits to 390 proteins in 87 species: Archae - 2; Bacteria - 24; Metazoa - 0; Fungi - 152; Plants - 180; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17500.2 | GGGTCAAA | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G65980.1); Has 400 Blast hits to 390 proteins in 87 species: Archae - 2; Bacteria - 24; Metazoa - 0; Fungi - 152; Plants - 180; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17500.3 | GGGTCAAA | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G65980.1); Has 400 Blast hits to 390 proteins in 87 species: Archae - 2; Bacteria - 24; Metazoa - 0; Fungi - 152; Plants - 180; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17500.4 | GGGTCAAA | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G65980.1); Has 400 Blast hits to 390 proteins in 87 species: Archae - 2; Bacteria - 24; Metazoa - 0; Fungi - 152; Plants - 180; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G21190 | AT2G21190.1 | TTTGACCC | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT4G38790.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT2G21640 | AT2G21640.1 | GGGTCAAA | Encodes a protein of unknown function that is a marker for oxidative stress response. |
| AT2G21640.1 | TAAGGGGTCAAA | Encodes a protein of unknown function that is a marker for oxidative stress response. |
| AT2G22122 | AT2G22122.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G23520 | AT2G23520.1 | TTTGACCCGA | catalytic/ pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: catalytic/ pyridoxal phosphate binding (TAIR:AT4G37100.1); Has 361 Blast hits to 314 proteins in 102 species: Archae - 6; Bacteria - 16; Metazoa - 93; Fungi - 74; Plants - 125; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT2G24600 | AT2G24600.1 | GGGTCAAA | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G10340.1); Has 19378 Blast hits to 9653 proteins in 395 species: Archae - 20; Bacteria - 1127; Metazoa - 11375; Fungi - 1040; Plants - 1601; Viruses - 129; Other Eukaryotes - 4086 (source: NCBI BLink). |
| AT2G24600.2 | GGGTCAAA | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G10340.1); Has 19378 Blast hits to 9653 proteins in 395 species: Archae - 20; Bacteria - 1127; Metazoa - 11375; Fungi - 1040; Plants - 1601; Viruses - 129; Other Eukaryotes - 4086 (source: NCBI BLink). |
| AT2G24600.3 | GGGTCAAA | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G10340.1); Has 19378 Blast hits to 9653 proteins in 395 species: Archae - 20; Bacteria - 1127; Metazoa - 11375; Fungi - 1040; Plants - 1601; Viruses - 129; Other Eukaryotes - 4086 (source: NCBI BLink). |
| AT2G24850 | AT2G24850.1 | GGGTCAAA | Encodes a tyrosine aminotransferase that is responsive to treatment with jasmonic acid. |
| AT2G25900 | AT2G25900.1 | TTTGACCC | putative Cys3His zinc finger protein (ATCTH) mRNA, complete |
| AT2G27050 | AT2G27050.1 | TTTGACCC | ethylene-insensitive3-like1 (EIL1) |
| AT2G27590 | AT2G27590.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT2G31880 | AT2G31880.1 | GGGTCAAA | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. |
| AT2G32480 | AT2G32480.1 | TTTGACCC | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). |
| AT2G32480.2 | TTTGACCC | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). |
| AT2G33220 | AT2G33220.1 | TTTGACCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G33830 | AT2G33830.1 | GGGTCAAA | dormancy/auxin associated family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: DYL1 (DORMANCY-ASSOCIATED PROTEIN-LIKE 1) (TAIR:AT1G28330.1); Has 114 Blast hits to 114 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G33830.2 | GGGTCAAA | dormancy/auxin associated family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: DYL1 (DORMANCY-ASSOCIATED PROTEIN-LIKE 1) (TAIR:AT1G28330.1); Has 114 Blast hits to 114 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G34250 | AT2G34250.1 | CAAAGCCCATTTGACCC | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G34250.2 | CAAAGCCCATTTGACCC | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G35720 | AT2G35720.1 | GGGTCAAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae - 105; Bacteria - 5397; Metazoa - 3297; Fungi - 1386; Plants - 1147; Viruses - 13; Other Eukaryotes - 4442 (source: NCBI BLink). |
| AT2G38600 | AT2G38600.1 | TTTGACCC | acid phosphatase class B family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase, putative (TAIR:AT4G25150.1); Has 458 Blast hits to 458 proteins in 101 species: Archae - 0; Bacteria - 159; Metazoa - 0; Fungi - 0; Plants - 236; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT2G39270 | AT2G39270.1 | AAAAAGCCCAAACGGGTCAAA | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink). |
| AT2G39480 | AT2G39480.1 | TTTGACCC | P-GLYCOPROTEIN 6 (PGP6); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane region, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane region (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PGP20 (P-GLYCOPROTEIN 20); ATPase, coupled to transmembrane movement of substances (TAIR:AT3G55320.1); Has 425152 Blast hits to 214184 proteins in 2609 species: Archae - 7629; Bacteria - 293193; Metazoa - 15627; Fungi - 7875; Plants - 4410; Viruses - 13; Other Eukaryotes - 96405 (source: NCBI BLink). |
| AT2G39805 | AT2G39805.1 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G39805.1 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G39805.2 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G39805.2 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G42230 | AT2G42230.1 | GGCCTTTTTGACCC | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G42230.2 | GGCCTTTTTGACCC | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G43090 | AT2G43090.1 | TTTGACCC | aconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: response to salt stress, metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT3G58990.1); Has 5678 Blast hits to 5678 proteins in 1275 species: Archae - 220; Bacteria - 2969; Metazoa - 13; Fungi - 241; Plants - 45; Viruses - 0; Other Eukaryotes - 2190 (source: NCBI BLink). |
| AT2G46500 | AT2G46500.1 | TTTGACCC | phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink). |
| AT2G46500.2 | TTTGACCC | phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink). |
| AT2G46800 | AT2G46800.1 | GGGTCAAA | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G46800.2 | GGGTCAAA | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT3G01150 | AT3G01150.1 | GGGTCAAA | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT3G01150.2 | GGGTCAAA | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT3G02080 | AT3G02080.1 | TTTGACCC | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT3G02090 | AT3G02090.1 | GGGTCAAA | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02090.2 | GGGTCAAA | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02570 | AT3G02570.1 | TTTGACCC | Encodes a protein with phosphomannose isomerase activity. |
| AT3G02700 | AT3G02700.1 | GGGTCAAA | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT5G16330.1); Has 105 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 23; Metazoa - 12; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G02710 | AT3G02710.1 | TTTGACCC | Encodes a protein with a putative role in mRNA splicing. |
| AT3G02820 | AT3G02820.1 | ATAAACCGGGTCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G03950 | AT3G03950.1 | TTTGACCC | Physically interacts with CIPK1. Located in the nucleus. |
| AT3G03950.2 | TTTGACCC | Physically interacts with CIPK1. Located in the nucleus. |
| AT3G03950.3 | TTTGACCC | Physically interacts with CIPK1. Located in the nucleus. |
| AT3G04240 | AT3G04240.1 | TTTGACCC | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
| AT3G04300 | AT3G04300.1 | GGGTCAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10300.1); Has 364 Blast hits to 364 proteins in 91 species: Archae - 0; Bacteria - 191; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). |
| AT3G07020 | AT3G07020.1 | GGGTCAAA | UDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G07020.2 | GGGTCAAA | UDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G07090 | AT3G07090.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25170.1); Has 596 Blast hits to 596 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 84; Plants - 173; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT3G07820 | AT3G07820.1 | GGGTCAAA | polygalacturonase 3 (PGA3) / pectinase; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectin lyase fold (InterPro:IPR012334), Glycoside hydrolase, family 28 (InterPro:IPR000743), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: polygalacturonase, putative / pectinase, putative (TAIR:AT3G07830.1); Has 2216 Blast hits to 2209 proteins in 277 species: Archae - 2; Bacteria - 315; Metazoa - 8; Fungi - 977; Plants - 856; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G07950 | AT3G07950.1 | GGGTCAAA | rhomboid protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1751, integral membrane, eukaryotic (InterPro:IPR013861); Has 397 Blast hits to 397 proteins in 163 species: Archae - 6; Bacteria - 95; Metazoa - 104; Fungi - 97; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G08750 | AT3G08750.1 | GGGCTTTTGACCC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (FBX15) (TAIR:AT4G04690.1); Has 1194 Blast hits to 1181 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1190; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G08920 | AT3G08920.1 | TTTGACCC | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G42220.1); Has 151 Blast hits to 151 proteins in 36 species: Archae - 0; Bacteria - 36; Metazoa - 1; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G10985 | AT3G10985.1 | GGGTCAAA | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. |
| AT3G12480 | AT3G12480.1 | TTTGACCC | NUCLEAR FACTOR Y, SUBUNIT C11 (NF-YC11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: DNA binding / sequence-specific DNA binding (TAIR:AT5G19490.1); Has 776 Blast hits to 776 proteins in 162 species: Archae - 0; Bacteria - 6; Metazoa - 273; Fungi - 211; Plants - 212; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT3G13432 | AT3G13432.1 | TTTGACCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13940 | AT3G13940.1 | GGGTCAAA | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase I associated factor, A49-like (InterPro:IPR009668); Has 150 Blast hits to 150 proteins in 69 species: Archae - 0; Bacteria - 1; Metazoa - 57; Fungi - 66; Plants - 15; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G14960 | AT3G14960.1 | GGGTCAAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G53290.1); Has 932 Blast hits to 929 proteins in 77 species: Archae - 0; Bacteria - 2; Metazoa - 607; Fungi - 2; Plants - 303; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G15590 | AT3G15590.1 | TTTGACCCGAA | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT1G80270.3); Has 4141 Blast hits to 2233 proteins in 120 species: Archae - 0; Bacteria - 9; Metazoa - 154; Fungi - 32; Plants - 3825; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT3G17170 | AT3G17170.1 | GGGTCAAA | REGULATOR OF FATTY-ACID COMPOSITION 3 (RFC3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 12520 Blast hits to 8352 proteins in 1408 species: Archae - 14; Bacteria - 2671; Metazoa - 4692; Fungi - 858; Plants - 331; Viruses - 258; Other Eukaryotes - 3696 (source: NCBI BLink). |
| AT3G18710 | AT3G18710.1 | TTTGACCC | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G19680 | AT3G19680.1 | TTTGACCC | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50040.1); Has 728 Blast hits to 127 proteins in 32 species: Archae - 0; Bacteria - 22; Metazoa - 26; Fungi - 20; Plants - 72; Viruses - 0; Other Eukaryotes - 588 (source: NCBI BLink). |
| AT3G20362 | AT3G20362.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT3G21640 | AT3G21640.1 | GGGTCAAA | encodes a 42 kDa FK506-binding protein (AtFKBP42) that possesses similarity to multidomain peptidyl-prolyl cis/trans isomerases (PPIases, EC 5.2.1.8), which are known to be components of mammalian steroid hormone receptor complexes. The protein appears to be localized to the plasma membrane by electron microscopy and binds to HSP90.1 and calmodulin in vitro. It also aggregates citrate synthase in vitro but does NOT show PPIase activity in vivo. Mutants are reduced in size and exhibit disoriented growth in all organs. |
| AT3G22260 | AT3G22260.1 | TTTGACCC | OTU-like cysteine protease family protein; FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: OTU-like cysteine protease family protein (TAIR:AT3G02070.1); Has 586 Blast hits to 576 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 289; Fungi - 51; Plants - 137; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G22260.2 | TTTGACCC | OTU-like cysteine protease family protein; FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: OTU-like cysteine protease family protein (TAIR:AT3G02070.1); Has 586 Blast hits to 576 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 289; Fungi - 51; Plants - 137; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G22460 | AT3G22460.1 | GTCGGGTCAAA | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
| AT3G23910 | AT3G23910.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24255.2); Has 456 Blast hits to 427 proteins in 106 species: Archae - 19; Bacteria - 37; Metazoa - 146; Fungi - 47; Plants - 55; Viruses - 6; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT3G24570 | AT3G24570.1 | TTTGACCC | peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, integral to membrane, peroxisomal membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane 22 kDa family protein (TAIR:AT5G43140.1); Has 898 Blast hits to 898 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 471; Fungi - 216; Plants - 153; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G26030 | AT3G26030.1 | TTTGACCC | protein phosphatase 2A regulatory subunit isoform B' delta |
| AT3G26670 | AT3G26670.1 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G26670.2 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G26670.3 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G27310 | AT3G27310.1 | GGGTCAAA | encodes a protein that contains a UBX domain and regulates AtCDC48 by inhibiting its ATPase activity and by promoting the disassembly of the active hexamer. Phenotypic analysis of pux1 plants revealed that the loss of PUX1 accelerated the growth of various plant organs including roots and inflorescence shoots. AtCDC48 and SYP31 colocalize at the division plane during cytokinesis and to interact in vitro and in vivo. |
| AT3G27850 | AT3G27850.1 | CTATTGGGTCAAA | 50S ribosomal protein L12-C |
| AT3G43210 | AT3G43210.1 | TTTGACCC | Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT3G44890 | AT3G44890.1 | TAATTACGGGGTCAAA | Plastid ribosomal protein CL9 |
| AT3G46620 | AT3G46620.1 | GGGTCAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF1117 (InterPro:IPR010543); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G59550.1); Has 5953 Blast hits to 5931 proteins in 209 species: Archae - 0; Bacteria - 6; Metazoa - 2088; Fungi - 498; Plants - 2518; Viruses - 31; Other Eukaryotes - 812 (source: NCBI BLink). |
| AT3G47833 | AT3G47833.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62575.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G47833.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62575.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G48730 | AT3G48730.1 | TCGGGTCAAA | glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink). |
| AT3G49000 | AT3G49000.1 | GGGTCAAA | RNA polymerase III subunit RPC82 family protein; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase III subunit RPC82-related, helix-turn-helix (InterPro:IPR013197), RNA polymerase III Rpc82, C -terminal (InterPro:IPR008806); Has 175 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 45; Plants - 23; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G49120 | AT3G49120.1 | TTTGACCC | Class III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. |
| AT3G50370 | AT3G50370.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 43668 Blast hits to 22560 proteins in 1277 species: Archae - 119; Bacteria - 4801; Metazoa - 19184; Fungi - 3840; Plants - 1250; Viruses - 317; Other Eukaryotes - 14157 (source: NCBI BLink). |
| AT3G51520 | AT3G51520.1 | GGGTCAAA | diacylglycerol acyltransferase family; FUNCTIONS IN: diacylglycerol O-acyltransferase activity, transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); Has 889 Blast hits to 882 proteins in 180 species: Archae - 0; Bacteria - 135; Metazoa - 472; Fungi - 110; Plants - 62; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT3G52170 | AT3G52170.1 | GGGTCAAA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G58210.4); Has 171 Blast hits to 150 proteins in 58 species: Archae - 6; Bacteria - 49; Metazoa - 41; Fungi - 4; Plants - 38; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G52560 | AT3G52560.1 | TTTGACCC | MMZ4/UEV1D encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1D-4, a predicted splice variant, can interact relatively weakly with UBC35/UBC13A and UBC36/UBC13B in a yeast-2-hybrid UEV1D-4 can also significantly, but not totally, functionally complement an mms2 mutation in budding yeast by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS. uev1d-1 mutants are more sensitive than wild type plants to the DNA damaging agent MMS in seed germination and pollen germination assays. |
| AT3G52560.2 | TTTGACCC | MMZ4/UEV1D encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1D-4, a predicted splice variant, can interact relatively weakly with UBC35/UBC13A and UBC36/UBC13B in a yeast-2-hybrid UEV1D-4 can also significantly, but not totally, functionally complement an mms2 mutation in budding yeast by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS. uev1d-1 mutants are more sensitive than wild type plants to the DNA damaging agent MMS in seed germination and pollen germination assays. |
| AT3G52560.3 | TTTGACCC | MMZ4/UEV1D encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1D-4, a predicted splice variant, can interact relatively weakly with UBC35/UBC13A and UBC36/UBC13B in a yeast-2-hybrid UEV1D-4 can also significantly, but not totally, functionally complement an mms2 mutation in budding yeast by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS. uev1d-1 mutants are more sensitive than wild type plants to the DNA damaging agent MMS in seed germination and pollen germination assays. |
| AT3G56010 | AT3G56010.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9 Blast hits to 9 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G58170 | AT3G58170.1 | TTTGACCC | Encodes a Bet1/Sft1-like SNARE protein which fully suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1Δ</i>). |
| AT3G58180 | AT3G58180.1 | GGGTCAAA | PBS lyase HEAT-like repeat-containing protein; FUNCTIONS IN: lyase activity, binding; INVOLVED IN: biological_process unknown; LOCATED IN: phycobilisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), PBS lyase HEAT-like repeat (InterPro:IPR004155); BEST Arabidopsis thaliana protein match is: PBS lyase HEAT-like repeat-containing protein (TAIR:AT3G62530.1); Has 1505 Blast hits to 797 proteins in 276 species: Archae - 192; Bacteria - 504; Metazoa - 254; Fungi - 237; Plants - 43; Viruses - 0; Other Eukaryotes - 275 (source: NCBI BLink). |
| AT3G62000 | AT3G62000.1 | TTTGACCC | O-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G61990.1); Has 3642 Blast hits to 3640 proteins in 775 species: Archae - 31; Bacteria - 1513; Metazoa - 236; Fungi - 112; Plants - 446; Viruses - 0; Other Eukaryotes - 1304 (source: NCBI BLink). |
| AT3G62000.1 | TTTGACCCGACCCGGTT | O-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G61990.1); Has 3642 Blast hits to 3640 proteins in 775 species: Archae - 31; Bacteria - 1513; Metazoa - 236; Fungi - 112; Plants - 446; Viruses - 0; Other Eukaryotes - 1304 (source: NCBI BLink). |
| AT3G62140 | AT3G62140.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; Has 331 Blast hits to 328 proteins in 104 species: Archae - 0; Bacteria - 6; Metazoa - 181; Fungi - 52; Plants - 23; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G62310 | AT3G62310.1 | GGGTCAAA | RNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, ATP binding, nucleic acid binding; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT2G47250.1); Has 7383 Blast hits to 6668 proteins in 1008 species: Archae - 2; Bacteria - 1942; Metazoa - 2132; Fungi - 846; Plants - 392; Viruses - 554; Other Eukaryotes - 1515 (source: NCBI BLink). |
| AT3G63210 | AT3G63210.1 | GGGTCAAA | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT3G66654 | AT3G66654.1 | GGGTCAAA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus, plasma membrane; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein (TAIR:AT2G47320.1); Has 6847 Blast hits to 6845 proteins in 1174 species: Archae - 74; Bacteria - 2212; Metazoa - 1539; Fungi - 761; Plants - 564; Viruses - 0; Other Eukaryotes - 1697 (source: NCBI BLink). |
| AT3G66654.2 | GGGTCAAA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus, plasma membrane; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein (TAIR:AT2G47320.1); Has 6847 Blast hits to 6845 proteins in 1174 species: Archae - 74; Bacteria - 2212; Metazoa - 1539; Fungi - 761; Plants - 564; Viruses - 0; Other Eukaryotes - 1697 (source: NCBI BLink). |
| AT3G66654.3 | GGGTCAAA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus, plasma membrane; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein (TAIR:AT2G47320.1); Has 6847 Blast hits to 6845 proteins in 1174 species: Archae - 74; Bacteria - 2212; Metazoa - 1539; Fungi - 761; Plants - 564; Viruses - 0; Other Eukaryotes - 1697 (source: NCBI BLink). |
| AT3G66658 | AT3G66658.1 | GTCGGGTCAAA | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT3G66658.2 | GTCGGGTCAAA | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G01690 | AT4G01690.1 | GGGTCAAA | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G01690.2 | GGGTCAAA | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G02380 | AT4G02380.1 | GGGTCAAA | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
| AT4G02380.2 | GGGTCAAA | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
| AT4G02425 | AT4G02425.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 16 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02430 | AT4G02430.1 | GGGTCAAA | pre-mRNA splicing factor, putative / SR1 protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SR1; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT1G02840.3); Has 21454 Blast hits to 14252 proteins in 615 species: Archae - 10; Bacteria - 760; Metazoa - 14239; Fungi - 1994; Plants - 2024; Viruses - 303; Other Eukaryotes - 2124 (source: NCBI BLink). |
| AT4G02430.2 | GGGTCAAA | pre-mRNA splicing factor, putative / SR1 protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SR1; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT1G02840.3); Has 21454 Blast hits to 14252 proteins in 615 species: Archae - 10; Bacteria - 760; Metazoa - 14239; Fungi - 1994; Plants - 2024; Viruses - 303; Other Eukaryotes - 2124 (source: NCBI BLink). |
| AT4G02480 | AT4G02480.1 | TTTGACCC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), SMAD/FHA domain (InterPro:IPR008984), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT1G02890.1); Has 26189 Blast hits to 22283 proteins in 1802 species: Archae - 938; Bacteria - 7842; Metazoa - 4073; Fungi - 2409; Plants - 1486; Viruses - 27; Other Eukaryotes - 9414 (source: NCBI BLink). |
| AT4G02550 | AT4G02550.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.2 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.3 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02920 | AT4G02920.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03340.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02920.2 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03340.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G03150 | AT4G03150.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 30 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04640 | AT4G04640.1 | GGGTCAAA | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT4G09680 | AT4G09680.1 | AACCCGGTCGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G09680.2 | AACCCGGTCGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G10320 | AT4G10320.1 | TTTGACCC | isoleucyl-tRNA synthetase, putative / isoleucine--tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae - 699; Bacteria - 11987; Metazoa - 692; Fungi - 480; Plants - 135; Viruses - 0; Other Eukaryotes - 13655 (source: NCBI BLink). |
| AT4G10925 | AT4G10925.1 | GGGTCAAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G10925.2 | GGGTCAAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G11660 | AT4G11660.1 | GGGTCAAA | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G14420 | AT4G14420.1 | TTTGACCC | lesion inducing protein-related; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT1G04340.1); Has 95 Blast hits to 95 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G14600 | AT4G14600.1 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G15490 | AT4G15490.1 | GGGTCAAA | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G16265 | AT4G16265.1 | GGGTCAAA | One of two highly similar, non-catalytic subunits common to nuclear DNA-directed RNA polymerases II, IV and V; homologous to budding yeast RPB9. Appears to be redundant with At3g16980 |
| AT4G16450 | AT4G16450.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G17470 | AT4G17470.1 | GGGTCAAA | palmitoyl protein thioesterase family protein; FUNCTIONS IN: palmitoyl-(protein) hydrolase activity; INVOLVED IN: protein modification process; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Palmitoyl protein thioesterase (InterPro:IPR002472); BEST Arabidopsis thaliana protein match is: palmitoyl protein thioesterase family protein (TAIR:AT4G17480.1); Has 471 Blast hits to 467 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 285; Fungi - 63; Plants - 80; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT4G17720 | AT4G17720.1 | GGGTCAAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G46870.1); Has 381 Blast hits to 361 proteins in 83 species: Archae - 2; Bacteria - 16; Metazoa - 30; Fungi - 84; Plants - 147; Viruses - 12; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT4G19210 | AT4G19210.1 | TCGGGTCAAA | member of RLI subfamily |
| AT4G20140 | AT4G20140.1 | TTTGACCC | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT4G20860 | AT4G20860.1 | TTTGACCCGAA | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44360.1); Has 3032 Blast hits to 2927 proteins in 504 species: Archae - 28; Bacteria - 1241; Metazoa - 4; Fungi - 1147; Plants - 342; Viruses - 0; Other Eukaryotes - 270 (source: NCBI BLink). |
| AT4G21160 | AT4G21160.1 | TTTGACCC | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G21160.2 | TTTGACCC | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G21160.3 | TTTGACCC | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G21160.4 | TTTGACCC | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G21190 | AT4G21190.1 | GGGTCAAA | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G21192 | AT4G21192.1 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G21192.2 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G24090 | AT4G24090.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G24110 | AT4G24110.1 | TTTGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25470 | AT4G25470.1 | GGGTCAAA | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT4G27080 | AT4G27080.1 | GGGTCAAA | putative protein |
| AT4G27080.2 | GGGTCAAA | putative protein |
| AT4G27745 | AT4G27745.1 | TTTGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT5G53940.1); Has 697 Blast hits to 697 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 132; Plants - 110; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT4G28390 | AT4G28390.1 | GGGTCAAA | Encodes a mitochondrial ADP/ATP carrier protein. Shown in heterologous systems to be located in the plasma membrane. Has comparable affinity for ADP and ATP (in E.coli). |
| AT4G29060 | AT4G29060.1 | GGGTCAAA | embryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink). |
| AT4G29060.2 | GGGTCAAA | embryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink). |
| AT4G29330 | AT4G29330.1 | TTAATGGGTCAAATAAAAGCC | DERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT4G29840 | AT4G29840.1 | GGGTCAAA | threonine synthase |
| AT4G30996 | AT4G30996.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24290.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G31180 | AT4G31180.1 | GGGTCAAAACG | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink). |
| AT4G31180.2 | GGGTCAAAACG | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink). |
| AT4G32760 | AT4G32760.1 | GGGTCAAA | protein transporter; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT3G08790.1); Has 18386 Blast hits to 12933 proteins in 541 species: Archae - 4; Bacteria - 507; Metazoa - 7666; Fungi - 3474; Plants - 2212; Viruses - 64; Other Eukaryotes - 4459 (source: NCBI BLink). |
| AT4G33070 | AT4G33070.1 | GGGTCAAA | pyruvate decarboxylase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, C globular stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: TPP-binding enzymes, conserved site (InterPro:IPR000399), Thiamine pyrophosphate enzyme, central region (InterPro:IPR012000), Pyruvate decarboxylase/indolepyruvate decarboxylase (InterPro:IPR012110), Thiamine pyrophosphate enzyme, N-terminal TPP binding region (InterPro:IPR012001), Thiamine pyrophosphate enzyme, C-terminal TPP-binding (InterPro:IPR011766); BEST Arabidopsis thaliana protein match is: pyruvate decarboxylase, putative (TAIR:AT5G01320.1); Has 13782 Blast hits to 13739 proteins in 1425 species: Archae - 236; Bacteria - 7155; Metazoa - 152; Fungi - 511; Plants - 438; Viruses - 2; Other Eukaryotes - 5288 (source: NCBI BLink). |
| AT4G35410 | AT4G35410.1 | TTTGACCC | clathrin adaptor complex small chain family protein; FUNCTIONS IN: protein transporter activity, protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin coat of trans-Golgi network vesicle, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor AP1, sigma subunit (InterPro:IPR015604), Adaptor protein complex, sigma subunit (InterPro:IPR016635), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: AP19; protein binding / protein transporter (TAIR:AT2G17380.1); Has 1428 Blast hits to 1427 proteins in 185 species: Archae - 0; Bacteria - 0; Metazoa - 679; Fungi - 317; Plants - 140; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink). |
| AT4G35410.2 | TTTGACCC | clathrin adaptor complex small chain family protein; FUNCTIONS IN: protein transporter activity, protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin coat of trans-Golgi network vesicle, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor AP1, sigma subunit (InterPro:IPR015604), Adaptor protein complex, sigma subunit (InterPro:IPR016635), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: AP19; protein binding / protein transporter (TAIR:AT2G17380.1); Has 1428 Blast hits to 1427 proteins in 185 species: Archae - 0; Bacteria - 0; Metazoa - 679; Fungi - 317; Plants - 140; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink). |
| AT4G35490 | AT4G35490.1 | GGGTCAAA | MITOCHONDRIAL RIBOSOMAL PROTEIN L11 (MRPL11); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11, bacterial-type (InterPro:IPR006519), Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome (TAIR:AT1G32990.1); Has 5744 Blast hits to 5744 proteins in 1575 species: Archae - 191; Bacteria - 2960; Metazoa - 99; Fungi - 83; Plants - 65; Viruses - 0; Other Eukaryotes - 2346 (source: NCBI BLink). |
| AT4G36290 | AT4G36290.1 | AGTTGGGCTTGGGCTTTTGACCC | ATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36280.1); Has 329 Blast hits to 316 proteins in 61 species: Archae - 0; Bacteria - 34; Metazoa - 167; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G37440 | AT4G37440.1 | GGGTCAAA | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 46; Fungi - 9; Plants - 44; Viruses - 3; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G37440.2 | GGGTCAAA | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 46; Fungi - 9; Plants - 44; Viruses - 3; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G37950 | AT4G37950.1 | TTTGACCC | lyase; FUNCTIONS IN: lyase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, root; CONTAINS InterPro DOMAIN/s: Rhamnogalacturonate lyase (InterPro:IPR010325), Carbohydrate-binding-like fold (InterPro:IPR013784), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: lyase (TAIR:AT2G22620.1); Has 157 Blast hits to 146 proteins in 44 species: Archae - 0; Bacteria - 25; Metazoa - 0; Fungi - 55; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G39640 | AT4G39640.1 | GGGTCAAA | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT4G39640.2 | GGGTCAAA | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT5G01530 | AT5G01530.1 | TTTGACCC | chlorophyll A-B binding protein CP29 (LHCB4); FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to red light, response to far red light, photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); BEST Arabidopsis thaliana protein match is: LHCB4.2 (light harvesting complex PSII); chlorophyll binding (TAIR:AT3G08940.2); Has 1770 Blast hits to 1698 proteins in 193 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1503; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT5G02260 | AT5G02260.1 | GGGTCAAA | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G02760 | AT5G02760.1 | TTTGACCCATACCCTT | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3788 Blast hits to 3786 proteins in 222 species: Archae - 2; Bacteria - 8; Metazoa - 1298; Fungi - 398; Plants - 1308; Viruses - 2; Other Eukaryotes - 772 (source: NCBI BLink). |
| AT5G03630 | AT5G03630.1 | ACCGGGTCAAA | ATMDAR2; FUNCTIONS IN: monodehydroascorbate reductase (NADH) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), FAD/NAD-linked reductase, dimerisation (InterPro:IPR016156); BEST Arabidopsis thaliana protein match is: MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) (TAIR:AT3G09940.1); Has 15548 Blast hits to 15528 proteins in 1711 species: Archae - 317; Bacteria - 10742; Metazoa - 673; Fungi - 378; Plants - 332; Viruses - 0; Other Eukaryotes - 3106 (source: NCBI BLink). |
| AT5G06340 | AT5G06340.1 | TTTGACCC | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). |
| AT5G06660 | AT5G06660.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G07120 | AT5G07120.1 | CGGGTCGGGTCAAA | SORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT5G07690 | AT5G07690.1 | GGGTCAAA | Encodes a putative transcription factor (MYB29). |
| AT5G07890 | AT5G07890.1 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07890.2 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07890.3 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07900 | AT5G07900.1 | GGTCGGGTCGGTTCGGGTCAAA | mitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G08520 | AT5G08520.1 | GGCGTTTTGACCC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya (InterPro:IPR017884), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT5G23650.1); Has 1430 Blast hits to 1399 proteins in 120 species: Archae - 0; Bacteria - 4; Metazoa - 98; Fungi - 50; Plants - 802; Viruses - 0; Other Eukaryotes - 476 (source: NCBI BLink). |
| AT5G10440 | AT5G10440.1 | TTTGACCC | Encodes a cyclin involved in cell proliferation during stomatal cell lineage development. |
| AT5G13140 | AT5G13140.1 | GGGTCAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26960.1); Has 90 Blast hits to 85 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G13280 | AT5G13280.1 | GGGTCAAA | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). |
| AT5G14130 | AT5G14130.1 | GGGTCAAA | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, hypocotyl, fruit, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT4G37530.1); Has 2956 Blast hits to 2939 proteins in 222 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 109; Plants - 2801; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT5G15120 | AT5G15120.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT5G15802 | AT5G15802.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 21 Blast hits to 21 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17230 | AT5G17230.1 | TTAATGGGTCAAA | Encodes phytoene synthase. |
| AT5G17230.2 | TTAATGGGTCAAA | Encodes phytoene synthase. |
| AT5G17230.3 | TTAATGGGTCAAA | Encodes phytoene synthase. |
| AT5G17330 | AT5G17330.1 | ATATTGGGTCAAA | Encodes one of two isoforms of glutamate decarboxylase. |
| AT5G19790 | AT5G19790.1 | TTTGACCC | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family (RAP2.11). The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G20170 | AT5G20170.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 3; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20180 | AT5G20180.1 | GGGTCAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G20180.2 | GGGTCAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G21070 | AT5G21070.1 | TTTGACCCGTCAGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 17 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G24450 | AT5G24450.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49410.1); Has 598 Blast hits to 569 proteins in 160 species: Archae - 0; Bacteria - 19; Metazoa - 191; Fungi - 117; Plants - 57; Viruses - 10; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT5G37850 | AT5G37850.2 | GGGTCAAA | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
| AT5G38880 | AT5G38880.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 379 Blast hits to 327 proteins in 103 species: Archae - 4; Bacteria - 53; Metazoa - 188; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G38880.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 379 Blast hits to 327 proteins in 103 species: Archae - 4; Bacteria - 53; Metazoa - 188; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G41150 | AT5G41150.1 | TTTGACCC | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41150.2 | TTTGACCC | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41410 | AT5G41410.1 | TTTGACCC | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT5G41700 | AT5G41700.1 | GGGTCAAA | One of the polypeptides that constitute the ubiquitin-conjugating enzyme E2 |
| AT5G41700.2 | GGGTCAAA | One of the polypeptides that constitute the ubiquitin-conjugating enzyme E2 |
| AT5G41700.3 | GGGTCAAA | One of the polypeptides that constitute the ubiquitin-conjugating enzyme E2 |
| AT5G41700.4 | GGGTCAAA | One of the polypeptides that constitute the ubiquitin-conjugating enzyme E2 |
| AT5G44860 | AT5G44860.1 | TTTGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19950.1); Has 123 Blast hits to 121 proteins in 16 species: Archae - 0; Bacteria - 6; Metazoa - 1; Fungi - 0; Plants - 113; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G45710 | AT5G45710.1 | GGGTCAAA | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G47690 | AT5G47690.1 | GGGTCAAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.2 | GGGTCAAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.3 | GGGTCAAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47730 | AT5G47730.1 | TTTGACCC | SEC14 cytosolic factor, putative / polyphosphoinositide-binding protein, putative; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein (TAIR:AT1G55840.1); Has 1254 Blast hits to 1254 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 467; Fungi - 271; Plants - 377; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT5G47730.2 | TTTGACCC | SEC14 cytosolic factor, putative / polyphosphoinositide-binding protein, putative; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein (TAIR:AT1G55840.1); Has 1254 Blast hits to 1254 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 467; Fungi - 271; Plants - 377; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT5G47730.3 | TTTGACCC | SEC14 cytosolic factor, putative / polyphosphoinositide-binding protein, putative; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein (TAIR:AT1G55840.1); Has 1254 Blast hits to 1254 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 467; Fungi - 271; Plants - 377; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT5G50450 | AT5G50450.1 | TTTGACCC | zinc finger (MYND type) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MYND-type (InterPro:IPR002893), Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / F-box family protein (TAIR:AT1G67340.1); Has 341 Blast hits to 328 proteins in 91 species: Archae - 0; Bacteria - 66; Metazoa - 65; Fungi - 87; Plants - 79; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). |
| AT5G52060 | AT5G52060.1 | TTTGACCC | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G53620 | AT5G53620.1 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53970 | AT5G53970.1 | GGGTCAAA | encodes tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment |
| AT5G55120 | AT5G55120.1 | ATCCAACGGGTCAAA | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT5G55120.1 | TCGGGTCAAA | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT5G55910 | AT5G55910.1 | TTTGACCC | D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. |
| AT5G57020 | AT5G57020.1 | GGGTCAAA | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
| AT5G58960 | AT5G58960.2 | TCAGGGGTCAAA | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT5G58960.3 | TCAGGGGTCAAA | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT5G60600 | AT5G60600.1 | GGGTCAAA | Encodes a chloroplast-localized hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) synthase (HDS), catalyzes the formation of HMBPP from 2-C-methyl-D-erythrytol 2,4-cyclodiphosphate (MEcPP). The HDS enzyme controls the penultimate steps of the biosynthesis of IPP and dimethylallyl diphosphate (DMAPP) via the MEP pathway and may serve as a metabolic control point for SA-mediated disease resistance. In the light, the electrons required for the reaction catalyzed by HDS are directly provided by the electron flow from photosynthesis via ferredoxin. In the dark however, the enzyme requires an electron shuttle: ferredoxin-NADP<sup>+</sup> reductase. |
| AT5G60600.2 | GGGTCAAA | Encodes a chloroplast-localized hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) synthase (HDS), catalyzes the formation of HMBPP from 2-C-methyl-D-erythrytol 2,4-cyclodiphosphate (MEcPP). The HDS enzyme controls the penultimate steps of the biosynthesis of IPP and dimethylallyl diphosphate (DMAPP) via the MEP pathway and may serve as a metabolic control point for SA-mediated disease resistance. In the light, the electrons required for the reaction catalyzed by HDS are directly provided by the electron flow from photosynthesis via ferredoxin. In the dark however, the enzyme requires an electron shuttle: ferredoxin-NADP<sup>+</sup> reductase. |
| AT5G60600.3 | GGGTCAAA | Encodes a chloroplast-localized hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) synthase (HDS), catalyzes the formation of HMBPP from 2-C-methyl-D-erythrytol 2,4-cyclodiphosphate (MEcPP). The HDS enzyme controls the penultimate steps of the biosynthesis of IPP and dimethylallyl diphosphate (DMAPP) via the MEP pathway and may serve as a metabolic control point for SA-mediated disease resistance. In the light, the electrons required for the reaction catalyzed by HDS are directly provided by the electron flow from photosynthesis via ferredoxin. In the dark however, the enzyme requires an electron shuttle: ferredoxin-NADP<sup>+</sup> reductase. |
| AT5G61020 | AT5G61020.1 | TTTGACCCGAA | ECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT5G61020.2 | TTTGACCCGAA | ECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT5G62200 | AT5G62200.1 | TTTGACCCGGT | embryo-specific protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Embryo-specific 3 (InterPro:IPR010417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41475.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G62300 | AT5G62300.1 | TAATTGGGTCAAA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). |
| AT5G62300.2 | TAATTGGGTCAAA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). |
| AT5G64400 | AT5G64400.1 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G64400.2 | GGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| ATMG01370 | ATMG01370.1 | TTTGACCC | hypothetical protein |