Organism | Arabidopsis thaliana | |
ID | AtREG594 | |
Sequence | CCGTCCGA | |
Annotation | ||
PPDB Motif | ||
PLACE Motif | ||
Total Entry Count | 78 |
Locus | Gene model | Sequence | Description |
AT1G12500 | AT1G12500.1 | CCGTCCGA | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620), Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT3G11320.1); Has 1798 Blast hits to 1797 proteins in 187 species: Archae - 4; Bacteria - 13; Metazoa - 544; Fungi - 288; Plants - 744; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT1G14790 | AT1G14790.1 | CCGTCCGA | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs.  |
AT1G33980 | AT1G33980.1 | CCGTCCGA | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)  |
AT1G33980.2 | CCGTCCGA | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)  | |
AT1G35340 | AT1G35340.1 | CCGTCCGA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT1G35340.2 | CCGTCCGA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G35340.3 | CCGTCCGA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G47970 | AT1G47970.1 | CTAAACCGTCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink).  |
AT1G61620 | AT1G61620.1 | TCGGACGG | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Nitric oxide synthase-interacting (InterPro:IPR016818), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 380 Blast hits to 380 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 84; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT1G69450 | AT1G69450.1 | CCGTCCGA | LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: HYP1 (HYPOTHETICAL PROTEIN 1) (TAIR:AT3G01100.1); Has 911 Blast hits to 825 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 442; Plants - 243; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
AT1G69620 | AT1G69620.1 | CCGTCCGA | putative 60S ribosomal protein L34  |
AT1G72480 | AT1G72480.1 | CCGTCCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01070.1); Has 422 Blast hits to 420 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 208; Fungi - 101; Plants - 83; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT1G73020 | AT1G73020.1 | CCGTCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF590 (InterPro:IPR007632); Has 925 Blast hits to 873 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 662; Fungi - 104; Plants - 12; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).  |
AT1G73030 | AT1G73030.1 | TCGGACGG | VPS46.2; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.1 (VACUOLAR PROTEIN SORTING 46.1) (TAIR:AT1G17730.1); Has 975 Blast hits to 974 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 421; Fungi - 187; Plants - 221; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT2G23350 | AT2G23350.1 | TCGGACGG | polyadenylate-binding protein, putative / PABP, putative.Member of the Class II family of PABP proteins. Highly and ubiquitously expressed.  |
AT2G24610 | AT2G24610.1 | CCGTCCGA | member of Cyclic nucleotide gated channel family  |
AT2G37585 | AT2G37585.1 | TCGGACGG | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT5G39990.1); Has 608 Blast hits to 607 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 401; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT2G38040 | AT2G38040.1 | CCGTCCGA | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis  |
AT2G38040.2 | CCGTCCGA | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis  | |
AT2G38210 | AT2G38210.1 | CCGTCCGA | PUTATIVE PDX1-LIKE PROTEIN 4 (PDX1L4); INVOLVED IN: response to ethylene stimulus, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Vitamin B6 biosynthesis protein (InterPro:IPR001852); BEST Arabidopsis thaliana protein match is: ATPDX1.1 (pyridoxine biosynthesis 1.1); protein heterodimerization (TAIR:AT2G38230.1); Has 1462 Blast hits to 1461 proteins in 499 species: Archae - 146; Bacteria - 735; Metazoa - 10; Fungi - 97; Plants - 79; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink).  |
AT2G38220 | AT2G38220.1 | CCGTCCGA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G38195.1); Has 1929 Blast hits to 1925 proteins in 192 species: Archae - 0; Bacteria - 0; Metazoa - 1143; Fungi - 39; Plants - 257; Viruses - 180; Other Eukaryotes - 310 (source: NCBI BLink).  |
AT2G41630 | AT2G41630.1 | CCGTCCGA | Encodes the transcription factor TFIIB.  |
AT2G45620 | AT2G45620.1 | TCGGACGG | nucleotidyltransferase family protein; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotidyltransferase (InterPro:IPR002934), PAP/25A-associated (InterPro:IPR002058); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45750.1); Has 1532 Blast hits to 1443 proteins in 168 species: Archae - 0; Bacteria - 5; Metazoa - 813; Fungi - 252; Plants - 82; Viruses - 0; Other Eukaryotes - 380 (source: NCBI BLink).  |
AT2G46180 | AT2G46180.1 | AACCCGACCCGTCCGA | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.  |
AT3G10520 | AT3G10520.1 | TCGGACGG | class 2 non-symbiotic hemoglobin  |
AT3G11670 | AT3G11670.1 | CCGTCCGA | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).  |
AT3G11670.2 | CCGTCCGA | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).  | |
AT3G12410 | AT3G12410.1 | CCGTCCGA | 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease/ nucleic acid binding (TAIR:AT3G12460.1); Has 117 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT3G13360 | AT3G13360.1 | TCGGACGG | WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
AT3G20475 | AT3G20475.1 | TCGGACGG | Encodes MSH5, a homologue of the MutS-homolog family of genes required for normal levels of recombination in budding yeast, mouse and Caenorhabditis elegans. Involved in meiotic recombination. Required for the formation of Class I interference-sensitive crossovers. Transcripts of AtMSH5 are specific to reproductive tissues and expression of the protein is abundant during prophase I of meiosis. Involved in meiotic recombination. Required for the formation of Class I interference-sensitive crossovers.  |
AT3G56360 | AT3G56360.1 | CCGTCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05250.1); Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61790 | AT3G61790.1 | CCGTCCGA | seven in absentia (SINA) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: seven in absentia (SINA) family protein (TAIR:AT4G27880.1); Has 1422 Blast hits to 1414 proteins in 637 species: Archae - 0; Bacteria - 0; Metazoa - 1099; Fungi - 9; Plants - 250; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT3G62980 | AT3G62980.1 | TCGGACGG | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation.  |
AT3G63010 | AT3G63010.1 | CCGTCCGA | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4.  |
AT3G63400 | AT3G63400.1 | TCGGACGG | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, RNA splicing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 47527 Blast hits to 29594 proteins in 1838 species: Archae - 95; Bacteria - 7193; Metazoa - 22003; Fungi - 4320; Plants - 2499; Viruses - 348; Other Eukaryotes - 11069 (source: NCBI BLink).  |
AT3G63400.2 | TCGGACGG | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, RNA splicing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 47527 Blast hits to 29594 proteins in 1838 species: Archae - 95; Bacteria - 7193; Metazoa - 22003; Fungi - 4320; Plants - 2499; Viruses - 348; Other Eukaryotes - 11069 (source: NCBI BLink).  | |
AT4G02260 | AT4G02260.1 | TCGGACGG | RELA-SPOT HOMOLOG 1 (RSH1); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGS-like (InterPro:IPR012676), Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), TGS (InterPro:IPR004095), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8102 Blast hits to 8095 proteins in 1310 species: Archae - 6; Bacteria - 4034; Metazoa - 88; Fungi - 4; Plants - 126; Viruses - 2; Other Eukaryotes - 3842 (source: NCBI BLink).  |
AT4G02260.2 | TCGGACGG | RELA-SPOT HOMOLOG 1 (RSH1); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGS-like (InterPro:IPR012676), Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), TGS (InterPro:IPR004095), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8102 Blast hits to 8095 proteins in 1310 species: Archae - 6; Bacteria - 4034; Metazoa - 88; Fungi - 4; Plants - 126; Viruses - 2; Other Eukaryotes - 3842 (source: NCBI BLink).  | |
AT4G02260.3 | TCGGACGG | RELA-SPOT HOMOLOG 1 (RSH1); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGS-like (InterPro:IPR012676), Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), TGS (InterPro:IPR004095), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8102 Blast hits to 8095 proteins in 1310 species: Archae - 6; Bacteria - 4034; Metazoa - 88; Fungi - 4; Plants - 126; Viruses - 2; Other Eukaryotes - 3842 (source: NCBI BLink).  | |
AT4G13940 | AT4G13940.1 | CCGTCCGA | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.  |
AT4G13940.2 | CCGTCCGA | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.  | |
AT4G13940.3 | CCGTCCGA | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.  | |
AT4G13940.4 | CCGTCCGA | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.  | |
AT4G17940 | AT4G17940.1 | TCGGACGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G20190.1); Has 378 Blast hits to 251 proteins in 46 species: Archae - 2; Bacteria - 99; Metazoa - 16; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
AT4G26630 | AT4G26630.1 | TCGGACGG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  |
AT4G26630.2 | TCGGACGG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  | |
AT4G34880 | AT4G34880.1 | TCGGACGG | amidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: amidase family protein (TAIR:AT5G07360.2); Has 10946 Blast hits to 10880 proteins in 1379 species: Archae - 132; Bacteria - 5130; Metazoa - 366; Fungi - 337; Plants - 155; Viruses - 0; Other Eukaryotes - 4826 (source: NCBI BLink).  |
AT4G35760 | AT4G35760.1 | TCGGACGG | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vitamin K epoxide reductase (InterPro:IPR012932), Thioredoxin-like fold (InterPro:IPR012336); Has 447 Blast hits to 447 proteins in 86 species: Archae - 0; Bacteria - 179; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
AT4G35770 | AT4G35770.1 | CCGTCCGA | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.  |
AT4G35770.2 | CCGTCCGA | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.  | |
AT4G35770.3 | CCGTCCGA | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.  | |
AT4G36980 | AT4G36980.1 | TCGGACGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink).  |
AT4G36980.2 | TCGGACGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink).  | |
AT4G38710 | AT4G38710.1 | CCGTCCGA | glycine-rich protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Plant specific eukaryotic initiation factor 4B (InterPro:IPR010433); BEST Arabidopsis thaliana protein match is: EIF4B1; translation initiation factor (TAIR:AT3G26400.1); Has 13881 Blast hits to 7241 proteins in 523 species: Archae - 38; Bacteria - 1004; Metazoa - 5553; Fungi - 1110; Plants - 508; Viruses - 195; Other Eukaryotes - 5473 (source: NCBI BLink).  |
AT4G40040 | AT4G40040.1 | CCGTCCGA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).  |
AT4G40040.2 | CCGTCCGA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).  | |
AT5G01260 | AT5G01260.1 | TCGGACGG | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
AT5G01260.2 | TCGGACGG | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  | |
AT5G01350 | AT5G01350.1 | CCGTCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G01410 | AT5G01410.1 | CCGTCCGA | Encodes a protein predicted to function in tandem with PDX2 to form glutamine amidotransferase complex with involved in vitamin B6 biosynthesis.  |
AT5G02370 | AT5G02370.1 | CCGTCCGA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink).  |
AT5G02500 | AT5G02500.1 | CCGTCCGA | encodes a member of heat shock protein 70 family.  |
AT5G02500.2 | CCGTCCGA | encodes a member of heat shock protein 70 family.  | |
AT5G02880 | AT5G02880.1 | CCGTCCGA | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis.  |
AT5G03220 | AT5G03220.1 | CCGTCCGA | transcriptional co-activator-related; FUNCTIONS IN: transcription coactivator activity; INVOLVED IN: positive regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: MED7 (InterPro:IPR009244); BEST Arabidopsis thaliana protein match is: transcription coactivator (TAIR:AT5G03500.2); Has 302 Blast hits to 300 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 111; Plants - 29; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT5G12860 | AT5G12860.1 | CCGTCCGA | dicarboxylate transporter 1 (DiT1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: N-terminal protein myristoylation, malate transport, response to nematode; LOCATED IN: mitochondrion, chloroplast, plastid, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DIT2.1 (DICARBOXYLATE TRANSPORT 2.1); oxoglutarate:malate antiporter (TAIR:AT5G64290.1); Has 3501 Blast hits to 3480 proteins in 730 species: Archae - 45; Bacteria - 2714; Metazoa - 82; Fungi - 3; Plants - 82; Viruses - 1; Other Eukaryotes - 574 (source: NCBI BLink).  |
AT5G12860.2 | CCGTCCGA | dicarboxylate transporter 1 (DiT1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: N-terminal protein myristoylation, malate transport, response to nematode; LOCATED IN: mitochondrion, chloroplast, plastid, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DIT2.1 (DICARBOXYLATE TRANSPORT 2.1); oxoglutarate:malate antiporter (TAIR:AT5G64290.1); Has 3501 Blast hits to 3480 proteins in 730 species: Archae - 45; Bacteria - 2714; Metazoa - 82; Fungi - 3; Plants - 82; Viruses - 1; Other Eukaryotes - 574 (source: NCBI BLink).  | |
AT5G14640 | AT5G14640.1 | CCGTCCGA | SHAGGY-LIKE KINASE 13 (SK13); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK11; protein kinase/ protein serine/threonine kinase (TAIR:AT5G26751.1); Has 77993 Blast hits to 77020 proteins in 2468 species: Archae - 36; Bacteria - 6200; Metazoa - 32731; Fungi - 7832; Plants - 15487; Viruses - 357; Other Eukaryotes - 15350 (source: NCBI BLink).  |
AT5G21040 | AT5G21040.1 | TCGGACGG | Encodes an F-box containing protein that interacts physically with BHLH32 and appears to be involved in mediating phosphate starvation responses.  |
AT5G24980 | AT5G24980.1 | CCGTCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G25780 | AT5G25780.1 | TGACCCGACCCGACCCGTCCGA | member of eIF3b - eukaryotic initiation factor 3b  |
AT5G42990 | AT5G42990.1 | CCGTCCGA | ubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink).  |
AT5G46110 | AT5G46110.1 | CCGTCCGA | mutant has Altered acclimation responses; Chloroplast Triose Phosphate Translocator  |
AT5G46110.2 | CCGTCCGA | mutant has Altered acclimation responses; Chloroplast Triose Phosphate Translocator  | |
AT5G46110.3 | CCGTCCGA | mutant has Altered acclimation responses; Chloroplast Triose Phosphate Translocator  | |
AT5G46110.4 | CCGTCCGA | mutant has Altered acclimation responses; Chloroplast Triose Phosphate Translocator  | |
AT5G50850 | AT5G50850.1 | TCGGACGG | MACCI-BOU (MAB1); FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: mitochondrion, nucleolus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 11982 Blast hits to 11974 proteins in 1601 species: Archae - 106; Bacteria - 6028; Metazoa - 516; Fungi - 148; Plants - 236; Viruses - 0; Other Eukaryotes - 4948 (source: NCBI BLink).  |
AT5G52510 | AT5G52510.1 | TCGGACGG | scarecrow-like transcription factor 8 (SCL8); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: SCL1 (SCARECROW-LIKE 1); transcription factor (TAIR:AT1G21450.1); Has 1239 Blast hits to 1228 proteins in 191 species: Archae - 0; Bacteria - 4; Metazoa - 13; Fungi - 19; Plants - 1170; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |