Organism | Arabidopsis thaliana | |
ID | AtREG597 | |
Sequence | GACCCGAA | |
Annotation | ||
PPDB Motif | GGGACCC | function unknown |
PLACE Motif | ||
Total Entry Count | 130 |
Locus | Gene model | Sequence | Description |
AT1G12360 | AT1G12360.1 | ACCGGTTCGGGTCA | encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis.  |
AT1G14230 | AT1G14230.1 | TGACCCGAA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
AT1G20770 | AT1G20770.1 | ATAACCGGTTTGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G20780 | AT1G20780.1 | TTCGGGTCAAACCGGTTAT | Encodes a protein containing a U-box and an ARM domain.  |
AT1G21600 | AT1G21600.1 | TTCGGGTCGGGTCGGGTCGG | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.  |
AT1G21600.2 | TTCGGGTCGGGTCGGGTCGG | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.  | |
AT1G23090 | AT1G23090.1 | CCGACCCGAA | Encodes AST91 mRNA for sulfate transporter.  |
AT1G32870 | AT1G32870.1 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT1G32870.2 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  | |
AT1G65040 | AT1G65040.2 | TTCGGGTCG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).  |
AT1G65040.3 | TTCGGGTCG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).  | |
AT1G65540 | AT1G65540.1 | TCGACCCGACCCGAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink).  |
AT1G70980 | AT1G70980.1 | GACCCGAA | SYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink).  |
AT1G75020 | AT1G75020.1 | CCGACCCGAA | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink).  |
AT1G75020.2 | CCGACCCGAA | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink).  | |
AT1G77420 | AT1G77420.1 | TTCGGGTCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).  |
AT1G80550 | AT1G80550.1 | TTCGGGTCA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  |
AT1G80550.1 | TTCGGGTCAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  | |
AT1G80670 | AT1G80670.1 | ACCCGACCCGAACCGA | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT2G01860 | AT2G01860.1 | TTCGGGTCG | EMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT2G02480 | AT2G02480.1 | GACCCGAA | STICHEL mutant shows trichomes with fewer than normal branches.  |
AT2G04630 | AT2G04630.1 | CCGAACCGAACCCGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  |
AT2G04630.1 | CCGACCCGACCCTGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  | |
AT2G04630.1 | CGGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  | |
AT2G05220 | AT2G05220.1 | TCGGTTCGGGTCAGTTCGGTT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT2G05220.2 | TCGGTTCGGGTCAGTTCGGTT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  | |
AT2G14460 | AT2G14460.1 | TCGGTTCGGGTCGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G15230 | AT2G15230.1 | TGACCCGAA | Lipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular.  |
AT2G16500 | AT2G16500.1 | TTCGGGTCGGGTCGGGTCG | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements.  |
AT2G21840 | AT2G21840.1 | TGACCCGACCCGAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21850.1); Has 2278 Blast hits to 530 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 2227; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT2G24650 | AT2G24650.2 | GTAAACCGACCCGAA | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: apoplast; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: MEE45 (maternal effect embryo arrest 45); DNA binding / transcription factor (TAIR:AT4G00260.1); Has 527 Blast hits to 125 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G28830 | AT2G28830.1 | CCGACCCGAA | binding / structural constituent of ribosome / ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity, structural constituent of ribosome, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex, ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Ribosomal protein L10e/L16 (InterPro:IPR016180), Armadillo (InterPro:IPR000225), Ribosomal protein L16 (InterPro:IPR000114), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: PUB13 (PLANT U-BOX 13); ubiquitin-protein ligase (TAIR:AT3G46510.1); Has 4249 Blast hits to 3154 proteins in 216 species: Archae - 0; Bacteria - 22; Metazoa - 1271; Fungi - 546; Plants - 1890; Viruses - 3; Other Eukaryotes - 517 (source: NCBI BLink).  |
AT2G34400 | AT2G34400.1 | TCGACCCGAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G22410.1); Has 14623 Blast hits to 5296 proteins in 169 species: Archae - 0; Bacteria - 4; Metazoa - 195; Fungi - 114; Plants - 13938; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).  |
AT2G35110 | AT2G35110.1 | GACCCGAA | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs.  |
AT2G35110.2 | GACCCGAA | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs.  | |
AT2G36290 | AT2G36290.1 | TTCGGGTC | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74300.1); Has 557 Blast hits to 555 proteins in 128 species: Archae - 11; Bacteria - 242; Metazoa - 0; Fungi - 39; Plants - 185; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).  |
AT2G39805 | AT2G39805.1 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G39805.1 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G39805.2 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G39805.2 | TTCGGGTCAAA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT3G01370 | AT3G01370.1 | CCGACCCGACCCGAA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing.  |
AT3G03320 | AT3G03320.1 | TTCGGGTCCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ProFAR isomerase-like (InterPro:IPR010759), ASCH domain (InterPro:IPR007374); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G43465.1); Has 65 Blast hits to 65 proteins in 18 species: Archae - 31; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT3G06270 | AT3G06270.1 | ACCCGACCCGAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink).  |
AT3G07050 | AT3G07050.1 | TTCGGGTCA | GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917), GNL3L/Grn1 putative GTPase (InterPro:IPR014813); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT1G52980.1); Has 8737 Blast hits to 6941 proteins in 1045 species: Archae - 97; Bacteria - 2936; Metazoa - 2440; Fungi - 644; Plants - 338; Viruses - 29; Other Eukaryotes - 2253 (source: NCBI BLink).  |
AT3G07100 | AT3G07100.1 | TTCGGGTCA | protein transport protein Sec24, putative; FUNCTIONS IN: protein binding, transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 74720 Blast hits to 37673 proteins in 1279 species: Archae - 56; Bacteria - 8492; Metazoa - 38339; Fungi - 10824; Plants - 6948; Viruses - 1820; Other Eukaryotes - 8241 (source: NCBI BLink).  |
AT3G09405 | AT3G09405.1 | TTCGGGTCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: pectinacetylesterase family protein (TAIR:AT3G09410.1).  |
AT3G11130 | AT3G11130.1 | TCGACCCGAA | clathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G08530.1); Has 1310 Blast hits to 1193 proteins in 365 species: Archae - 0; Bacteria - 34; Metazoa - 776; Fungi - 123; Plants - 60; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).  |
AT3G14960 | AT3G14960.1 | CCGACCCGAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G53290.1); Has 932 Blast hits to 929 proteins in 77 species: Archae - 0; Bacteria - 2; Metazoa - 607; Fungi - 2; Plants - 303; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT3G15590 | AT3G15590.1 | TTTGACCCGAA | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT1G80270.3); Has 4141 Blast hits to 2233 proteins in 120 species: Archae - 0; Bacteria - 9; Metazoa - 154; Fungi - 32; Plants - 3825; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT3G16240 | AT3G16240.1 | TTCGGGTC | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane.  |
AT3G16640 | AT3G16640.1 | CCGACCCGAA | Encodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well.  |
AT3G16650 | AT3G16650.1 | TTCGGGTCGG | PP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink).  |
AT3G18270 | AT3G18270.1 | GACCCGAA | a cytochrome P450 pseudogene. the second half of the gene overlaps perfectly with the other gene model.  |
AT3G18630 | AT3G18630.1 | GACCCGAA | uracil DNA glycosylase family protein; FUNCTIONS IN: uracil DNA N-glycosylase activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Uracil-DNA glycosylase (InterPro:IPR002043), Uracil-DNA glycosylase-like (InterPro:IPR005122); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G10550.1); Has 3474 Blast hits to 3474 proteins in 1242 species: Archae - 0; Bacteria - 2123; Metazoa - 111; Fungi - 87; Plants - 30; Viruses - 206; Other Eukaryotes - 917 (source: NCBI BLink).  |
AT3G19520 | AT3G19520.1 | CCGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G19520.2 | CCGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G20870 | AT3G20870.1 | TTCGGGTCA | metal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink).  |
AT3G21290 | AT3G21290.1 | TTCGGGTCGGGTT | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink).  |
AT3G24200 | AT3G24200.1 | GACCCGAA | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).  |
AT3G24200.2 | GACCCGAA | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).  | |
AT3G26340 | AT3G26340.1 | TGACCCGAA | 20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
AT3G42790 | AT3G42790.1 | TGACCCGACCCGAACCA | AL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
AT3G47120 | AT3G47120.1 | AACCGAACCGACCCGAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink).  |
AT3G50690 | AT3G50690.1 | AACCCGACCCGAACCGA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink).  |
AT3G53620 | AT3G53620.1 | TTCGGGTCCG | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.  |
AT3G63370 | AT3G63370.1 | TGACCCGAA | pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink).  |
AT4G00355 | AT4G00355.1 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G00355.2 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G00355.3 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G00355.4 | GACCCGAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G09680 | AT4G09680.1 | TTCGGGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G09680.2 | TTCGGGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G11010 | AT4G11010.1 | AACCCGACCCGAA | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria  |
AT4G16450 | AT4G16450.1 | TAAATGGGCTCATTCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G18460 | AT4G18460.1 | TTCGGGTC | D-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink).  |
AT4G18465 | AT4G18465.1 | GACCCGAA | RNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 7224 Blast hits to 6791 proteins in 1024 species: Archae - 6; Bacteria - 1974; Metazoa - 1905; Fungi - 796; Plants - 374; Viruses - 693; Other Eukaryotes - 1476 (source: NCBI BLink).  |
AT4G18780 | AT4G18780.1 | AACCCGACCCGAATAAACCGGAT | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling.  |
AT4G19600 | AT4G19600.1 | TTCGGGTCA | Encodes a cyclin T partner CYCT1;4. Plays important roles in infection with Cauliflower mosaic virus (CaMV).  |
AT4G20860 | AT4G20860.1 | TTTGACCCGAA | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44360.1); Has 3032 Blast hits to 2927 proteins in 504 species: Archae - 28; Bacteria - 1241; Metazoa - 4; Fungi - 1147; Plants - 342; Viruses - 0; Other Eukaryotes - 270 (source: NCBI BLink).  |
AT4G24110 | AT4G24110.1 | TTTGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30010 | AT4G30010.1 | CCGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G31200 | AT4G31200.1 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  |
AT4G31200.2 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31200.3 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31210 | AT4G31210.1 | AACCCGACCCGAA | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink).  |
AT4G34830 | AT4G34830.1 | CCGACCCGAA | LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink).  |
AT4G34840 | AT4G34840.1 | TTCGGGTCGG | ATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT5G01650 | AT5G01650.1 | TTCGGGTC | macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).  |
AT5G01650.2 | TTCGGGTC | macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).  | |
AT5G02580 | AT5G02580.1 | TTCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G02580.2 | TTCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G03560 | AT5G03560.1 | GACCCGAA | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2).  |
AT5G03560.2 | GACCCGAA | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2).  | |
AT5G04750 | AT5G04750.1 | CGGACCCGAA | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G04750.2 | CGGACCCGAA | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G06850 | AT5G06850.1 | TTCGGGTCG | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT5G48060.1); Has 1175 Blast hits to 999 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 573; Fungi - 10; Plants - 560; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT5G07120 | AT5G07120.1 | TGACCCGAA | SORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).  |
AT5G07890 | AT5G07890.1 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  |
AT5G07890.2 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  | |
AT5G07890.3 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  | |
AT5G07900 | AT5G07900.1 | GGTCGGGTCGGTTCGGGTCAAA | mitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G07970 | AT5G07970.1 | CGGACCCGAA | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G07980.1); Has 597 Blast hits to 418 proteins in 73 species: Archae - 0; Bacteria - 68; Metazoa - 170; Fungi - 26; Plants - 66; Viruses - 0; Other Eukaryotes - 267 (source: NCBI BLink).  |
AT5G07970.1 | GACCCGAA | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G07980.1); Has 597 Blast hits to 418 proteins in 73 species: Archae - 0; Bacteria - 68; Metazoa - 170; Fungi - 26; Plants - 66; Viruses - 0; Other Eukaryotes - 267 (source: NCBI BLink).  | |
AT5G13280 | AT5G13280.1 | GACCCGAA | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).  |
AT5G16290 | AT5G16290.1 | TGACCCGAA | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink).  |
AT5G16290.2 | TGACCCGAA | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink).  | |
AT5G16930 | AT5G16930.1 | TTCGGGTCA | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G03060.1); Has 38698 Blast hits to 27302 proteins in 1845 species: Archae - 846; Bacteria - 8730; Metazoa - 11396; Fungi - 3984; Plants - 1702; Viruses - 176; Other Eukaryotes - 11864 (source: NCBI BLink).  |
AT5G19570 | AT5G19570.1 | TTCGGGTCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0546 (InterPro:IPR018908); Has 152 Blast hits to 152 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 35; Plants - 9; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G19570.1 | TTCGGGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0546 (InterPro:IPR018908); Has 152 Blast hits to 152 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 35; Plants - 9; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  | |
AT5G22360 | AT5G22360.1 | TTCGGGTCGG | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.  |
AT5G23080 | AT5G23080.1 | GACCCGAACCAGGCCCAGA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.  |
AT5G23080.2 | GACCCGAACCAGGCCCAGA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.  | |
AT5G23090 | AT5G23090.1 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
AT5G23090.2 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  | |
AT5G23090.3 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  | |
AT5G23090.4 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  | |
AT5G41600 | AT5G41600.1 | GAGGCCCAGACCCGAA | VIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT5G41685 | AT5G41685.1 | TGACCCGAA | mitochondrial import receptor subunit TOM7 / translocase of outer membrane 7 kDa subunit (TOM7.1); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial outer membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import translocase, subunit Tom7 (InterPro:IPR012621); BEST Arabidopsis thaliana protein match is: TOM7-2 (TRANSLOCASE OF OUTER MEMBRANE 7 KDA SUBUNIT 2); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G64220.1); Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G42020 | AT5G42020.1 | TTCGGGTCA | luminal binding protein (BiP)  |
AT5G42020.2 | TTCGGGTCA | luminal binding protein (BiP)  | |
AT5G45010 | AT5G45010.1 | TTCGGGTCGG | Arabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G45010.1 | TTCGGGTCGG | Arabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT5G45620 | AT5G45620.1 | CGGTTCGGGTCGGG | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink).  |
AT5G45620.2 | CGGTTCGGGTCGGG | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink).  | |
AT5G55940 | AT5G55940.1 | TGACCCGAACCCGGTTTAG | embryo defective 2731 (emb2731); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51620.3); Has 220 Blast hits to 219 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 10; Plants - 30; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).  |
AT5G60860 | AT5G60860.1 | GACCCGAA | Arabidopsis Rab GTPase homolog A1f (AtRABA1f); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1g (Arabidopsis Rab GTPase homolog A1g); GTP binding (TAIR:AT3G15060.1); Has 21819 Blast hits to 21779 proteins in 607 species: Archae - 23; Bacteria - 103; Metazoa - 12072; Fungi - 2821; Plants - 1861; Viruses - 19; Other Eukaryotes - 4920 (source: NCBI BLink).  |
AT5G61020 | AT5G61020.1 | TTTGACCCGAA | ECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT5G61020.2 | TTTGACCCGAA | ECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT5G63570 | AT5G63570.1 | TTCGGGTCGG | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced.  |
AT5G64270 | AT5G64270.1 | TGACCCGAA | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).  |