version

Summary of AtREG601 (All List)

OrganismArabidopsis thaliana  
IDAtREG601  
SequenceATAAAGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count276  

Entry Sequences (276 entries)

LocusGene modelSequenceDescription
AT1G02405AT1G02405.1TTGGCCCAATAAAGCCCAAATproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink). 
AT1G02410AT1G02410.1ATTTGGGCTTTATTGGGCCAAcytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink). 
AT1G02690AT1G02690.1ATAAAGCCPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G02690.2ATAAAGCCPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G03040AT1G03040.1ATAAAGCCCACTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G03090AT1G03090.1ATAAAGCCCATAMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. 
AT1G03090.2ATAAAGCCCATAMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. 
AT1G03140AT1G03140.1ATAAAGCCCATTTAsplicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT1G03150AT1G03150.1TAAATGGGCTTTATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). 
AT1G04120AT1G04120.1GGCTTTATmember of MRP subfamily 
AT1G05340AT1G05340.1ATAAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 122 Blast hits to 122 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 16; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G06000AT1G06000.1GGCTTTATencodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols 
AT1G06190AT1G06190.1CAAAGCCCATAAAGCCCAATAATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). 
AT1G06190.2CAAAGCCCATAAAGCCCAATAATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). 
AT1G07570AT1G07570.1ATAAAGCCProtein kinase capable of phosphorylating tyrosine, serine, and threonine residues 
AT1G07570.2ATAAAGCCProtein kinase capable of phosphorylating tyrosine, serine, and threonine residues 
AT1G10230AT1G10230.1GTTTGGGCTTTATARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink). 
AT1G12920AT1G12920.1ATAAAGCCCATTAGEncodes a eukaryotic release factor one homolog. 
AT1G13370AT1G13370.1ATAAAGCChistone H3, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: flower, inflorescence, root, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10206 Blast hits to 10203 proteins in 5279 species: Archae - 0; Bacteria - 0; Metazoa - 7337; Fungi - 1299; Plants - 998; Viruses - 0; Other Eukaryotes - 572 (source: NCBI BLink). 
AT1G15020AT1G15020.1ATAAAGCCCAGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. 
AT1G15020.2ATAAAGCCCAGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. 
AT1G16445AT1G16445.1ATAAAGCCCAATATmethylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G17060AT1G17060.1ATAAAGCCEncodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. 
AT1G17070AT1G17070.1ATAAAGCCCAAGTCGGTTD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G17380AT1G17380.1GGCTTTATJASMONATE-ZIM-DOMAIN PROTEIN 5 (JAZ5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to jasmonic acid stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ6 (JASMONATE-ZIM-DOMAIN PROTEIN 6) (TAIR:AT1G72450.1); Has 172 Blast hits to 167 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G18880AT1G18880.1ATAAAGCCproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2446 Blast hits to 2303 proteins in 404 species: Archae - 0; Bacteria - 410; Metazoa - 511; Fungi - 250; Plants - 1134; Viruses - 0; Other Eukaryotes - 141 (source: NCBI BLink). 
AT1G20575AT1G20575.1TTTTGGGCTTTATATAGGCCCATATdolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink). 
AT1G20580AT1G20580.1ATATGGGCCTATATAAAGCCCAAAAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT1G22360AT1G22360.1GGCTTTATUDP-glucosyl transferase 85A2 (AtUGT85A2); FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 4893 Blast hits to 4835 proteins in 290 species: Archae - 0; Bacteria - 46; Metazoa - 1935; Fungi - 10; Plants - 2777; Viruses - 95; Other Eukaryotes - 30 (source: NCBI BLink). 
AT1G22360.2GGCTTTATUDP-glucosyl transferase 85A2 (AtUGT85A2); FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 4893 Blast hits to 4835 proteins in 290 species: Archae - 0; Bacteria - 46; Metazoa - 1935; Fungi - 10; Plants - 2777; Viruses - 95; Other Eukaryotes - 30 (source: NCBI BLink). 
AT1G23750AT1G23750.1AATTGGGCTTTATDNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). 
AT1G26450AT1G26450.1ATAAAGCCbeta-1,3-glucanase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: PDCB4 (PLASMODESMATA CALLOSE-BINDING PROTEIN 4); callose binding / polysaccharide binding (TAIR:AT1G69295.1); Has 10543 Blast hits to 2817 proteins in 330 species: Archae - 10; Bacteria - 555; Metazoa - 2513; Fungi - 887; Plants - 692; Viruses - 195; Other Eukaryotes - 5691 (source: NCBI BLink). 
AT1G26460AT1G26460.1TTAATGGGCTGGGCTTTATpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). 
AT1G27750AT1G27750.1GGCTTTATnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 43321 Blast hits to 25070 proteins in 1124 species: Archae - 78; Bacteria - 4579; Metazoa - 20319; Fungi - 5516; Plants - 6313; Viruses - 1307; Other Eukaryotes - 5209 (source: NCBI BLink). 
AT1G27910AT1G27910.1GGCTTTATEncodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. 
AT1G28490AT1G28490.1CTTATTGGGCTTTATEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. 
AT1G28490.2CTTATTGGGCTTTATEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. 
AT1G28710AT1G28710.1GGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G28710.2GGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G28960AT1G28960.1ATAAAGCCARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.2ATAAAGCCARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.3ATAAAGCCARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.4ATAAAGCCARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.5ATAAAGCCARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G29670AT1G29670.1ATAAAGCCGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: apoplast, cell wall, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT1G29660.1); Has 1995 Blast hits to 1979 proteins in 221 species: Archae - 0; Bacteria - 342; Metazoa - 1; Fungi - 54; Plants - 1578; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT1G33490AT1G33490.1ATAAAGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G33500AT1G33500.1TAATTGGGCTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). 
AT1G34130AT1G34130.1ATAATGGGCTCAATAAAGCCCAAACEncodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. 
AT1G50170AT1G50170.1ATAAAGCCCencodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis 
AT1G50450AT1G50450.1ATAAAGCCCAACTbinding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase (InterPro:IPR005097), NAD(P)-binding (InterPro:IPR016040); Has 934 Blast hits to 931 proteins in 259 species: Archae - 13; Bacteria - 434; Metazoa - 33; Fungi - 62; Plants - 25; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink). 
AT1G51670AT1G51670.1ATAAAGCCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48180.1); Has 20 Blast hits to 20 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G51700AT1G51700.1ATAAAGCCEncodes dof zinc finger protein (adof1). 
AT1G52030AT1G52030.1GGCTTTATSimilar to myrosinase binding proteins which may be involved in metabolizing glucosinolates and forming defense compounds to protect against herbivory. Also similar to lectins and other agglutinating factors. Expressed only in flowers. 
AT1G52030.2GGCTTTATSimilar to myrosinase binding proteins which may be involved in metabolizing glucosinolates and forming defense compounds to protect against herbivory. Also similar to lectins and other agglutinating factors. Expressed only in flowers. 
AT1G54320AT1G54320.1TAAAGCCCATTATAAAGCCCACLEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALIS1 (ALA-INTERACTING SUBUNIT 1); phospholipid transporter (TAIR:AT3G12740.1); Has 648 Blast hits to 646 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 139; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). 
AT1G54490AT1G54490.1CCGGCCCAATAAAGCCCATTTAInvolved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. 
AT1G56190AT1G56190.1ATAAAGCCphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G56190.2ATAAAGCCphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G56590AT1G56590.1ATAAAGCCCAAclathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: HAP13 (HAPLESS 13); protein binding (TAIR:AT1G60780.1); Has 1451 Blast hits to 1434 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 782; Fungi - 300; Plants - 105; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink). 
AT1G64650AT1G64650.1ATAAAGCCCAAALOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT1G64650.2ATAAAGCCCAAALOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT1G65010AT1G65010.1ATAAAGCCunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 289245 Blast hits to 110345 proteins in 2676 species: Archae - 3808; Bacteria - 54712; Metazoa - 119193; Fungi - 19166; Plants - 10632; Viruses - 1818; Other Eukaryotes - 79916 (source: NCBI BLink). 
AT1G65445AT1G65445.1ATAAAGCCtransferase-related; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: HCT (HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE HYDROXYCINNAMOYL TRANSFERASE); quinate O-hydroxycinnamoyltransferase/ shikimate O-hydroxycinnamoyltransferase/ transferase (TAIR:AT5G48930.1); Has 438 Blast hits to 437 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 435; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G71020AT1G71020.1ATAAAGCCarmadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein / U-box domain-containing protein (TAIR:AT1G23030.1); Has 3784 Blast hits to 2707 proteins in 219 species: Archae - 0; Bacteria - 16; Metazoa - 1080; Fungi - 417; Plants - 1807; Viruses - 3; Other Eukaryotes - 461 (source: NCBI BLink). 
AT1G71020.2ATAAAGCCarmadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein / U-box domain-containing protein (TAIR:AT1G23030.1); Has 3784 Blast hits to 2707 proteins in 219 species: Archae - 0; Bacteria - 16; Metazoa - 1080; Fungi - 417; Plants - 1807; Viruses - 3; Other Eukaryotes - 461 (source: NCBI BLink). 
AT1G72410AT1G72410.1GGCTTTATCOP1-interacting protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17360.1); Has 12658 Blast hits to 8688 proteins in 500 species: Archae - 14; Bacteria - 773; Metazoa - 6078; Fungi - 1243; Plants - 387; Viruses - 26; Other Eukaryotes - 4137 (source: NCBI BLink). 
AT1G74060AT1G74060.1ATAAAGCCC60S ribosomal protein L6 (RPL6B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 551 Blast hits to 550 proteins in 201 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT1G76690AT1G76690.1TAGGGCTTTATEncodes one of two closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. 
AT1G78900AT1G78900.1ATAAAGCCCAATAAEncodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. 
AT1G78900.2ATAAAGCCCAATAAEncodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. 
AT2G01270AT2G01270.1ATAAAGCCCATTATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. 
AT2G02790AT2G02790.1CCAATAAGCCCACTAATAAAGCCCATTATIQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink). 
AT2G06850AT2G06850.1ATAAAGCCendoxyloglucan transferase (EXGT-A1) gene 
AT2G18400AT2G18400.1GGGCTTTTGGGCTTTATribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink). 
AT2G18465AT2G18465.1GGCTTTATDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G42080.1); Has 685 Blast hits to 685 proteins in 152 species: Archae - 6; Bacteria - 112; Metazoa - 268; Fungi - 15; Plants - 75; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink). 
AT2G19310AT2G19310.1AAAAGGCCTTTTCTATTGGGCTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress, response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: HSP18.2 (heat shock protein 18.2) (TAIR:AT5G59720.1); Has 527 Blast hits to 527 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 34; Plants - 479; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). 
AT2G20930AT2G20930.1ATAAAGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); Has 370 Blast hits to 370 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 55; Plants - 47; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT2G22400AT2G22400.1CTAATGGGCTTTATACGGCCCAAAANOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). 
AT2G27020AT2G27020.1ATAAAGCCCGTTAEncodes 20S proteasome subunit PAG1 (PAG1). 
AT2G28290AT2G28290.1ATTTGGGCTTTATEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. 
AT2G28290.2ATTTGGGCTTTATEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. 
AT2G28290.3ATTTGGGCTTTATEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. 
AT2G28480AT2G28480.1ATAAAGCCCATARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT2G29650AT2G29650.1ATTTGGGCCTTATATGGGCTTTATEncodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. 
AT2G29650.2ATTTGGGCCTTATATGGGCTTTATEncodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. 
AT2G29650.3ATTTGGGCCTTATATGGGCTTTATEncodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. 
AT2G33180AT2G33180.1GGCTTTATGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G33470AT2G33470.1ATAAAGCCglycolipid transfer protein 1 (GLTP1); FUNCTIONS IN: glycolipid transporter activity, glycolipid binding; INVOLVED IN: glycolipid transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycolipid transfer protein, GLTP (InterPro:IPR014830); BEST Arabidopsis thaliana protein match is: glycolipid transfer protein-related (TAIR:AT3G21260.3); Has 458 Blast hits to 458 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 80; Plants - 73; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT2G33470.2ATAAAGCCglycolipid transfer protein 1 (GLTP1); FUNCTIONS IN: glycolipid transporter activity, glycolipid binding; INVOLVED IN: glycolipid transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycolipid transfer protein, GLTP (InterPro:IPR014830); BEST Arabidopsis thaliana protein match is: glycolipid transfer protein-related (TAIR:AT3G21260.3); Has 458 Blast hits to 458 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 80; Plants - 73; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT2G34590AT2G34590.1ATAAAGCCtransketolase family protein; FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, transketolase activity; INVOLVED IN: pollen tube development; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 9465 Blast hits to 9457 proteins in 1366 species: Archae - 92; Bacteria - 4722; Metazoa - 387; Fungi - 143; Plants - 155; Viruses - 0; Other Eukaryotes - 3966 (source: NCBI BLink). 
AT2G37150AT2G37150.1GGCTTTATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT4G34040.1); Has 6107 Blast hits to 5877 proteins in 225 species: Archae - 0; Bacteria - 10; Metazoa - 1921; Fungi - 408; Plants - 2669; Viruses - 36; Other Eukaryotes - 1063 (source: NCBI BLink). 
AT2G37150.2GGCTTTATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT4G34040.1); Has 6107 Blast hits to 5877 proteins in 225 species: Archae - 0; Bacteria - 10; Metazoa - 1921; Fungi - 408; Plants - 2669; Viruses - 36; Other Eukaryotes - 1063 (source: NCBI BLink). 
AT2G40460AT2G40460.1GGCTTTATproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR3 (PEPTIDE TRANSPORTER 3); dipeptide transporter/ transporter/ tripeptide transporter (TAIR:AT5G46050.1); Has 4449 Blast hits to 4227 proteins in 774 species: Archae - 0; Bacteria - 1953; Metazoa - 561; Fungi - 279; Plants - 1140; Viruses - 0; Other Eukaryotes - 516 (source: NCBI BLink). 
AT2G40510AT2G40510.1ATAAAGCCCAAGCCCACTA40S ribosomal protein S26 (RPS26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26B) (TAIR:AT2G40590.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT2G40590AT2G40590.1ATAAAGCCTAAGCCCACTA40S ribosomal protein S26 (RPS26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT2G41160AT2G41160.1ATTTGGGCTTTATubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin-associated (UBA)/TS-N domain-containing protein (TAIR:AT3G56740.1); Has 179 Blast hits to 179 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 65; Plants - 43; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT2G42300AT2G42300.1ATAAAGCCCAATAGGCCCAATTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G42300.2ATAAAGCCCAATAGGCCCAATTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G43150AT2G43150.1GGCTTTATproline-rich extensin-like family protein; FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Extensin-like region (InterPro:IPR006706); Has 117548 Blast hits to 32359 proteins in 1305 species: Archae - 300; Bacteria - 16136; Metazoa - 48351; Fungi - 15669; Plants - 18324; Viruses - 3530; Other Eukaryotes - 15238 (source: NCBI BLink). 
AT2G45140AT2G45140.1ATAAAGCCEncodes a Plant VAMP-Associated protein that localizes to the ER and binds to the sitosterol-binding protein ORP3a. The WFDE motif in ORP3a appears to be important for this direct interaction. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. 
AT2G46490AT2G46490.1ATAAAGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G46505AT2G46505.1AAAAGCCCAGTATAAAGCCCAACTEncodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. 
AT2G48060AT2G48060.1GGCTTTATTGAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: shoot, sperm cell; Has 17 Blast hits to 17 proteins in 8 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G01130AT3G01130.1TAAAGGCCCATATAAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01130.2TAAAGGCCCATATAAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01150AT3G01150.1ATGGGCTTTATEncodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. 
AT3G01150.2ATGGGCTTTATEncodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. 
AT3G02450AT3G02450.1GGCTTTATcell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink). 
AT3G02460AT3G02460.1ATAAAGCCplant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink). 
AT3G02460.2ATAAAGCCplant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink). 
AT3G03570AT3G03570.1ATAAAGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP013022 (InterPro:IPR016607); BEST Arabidopsis thaliana protein match is: signal transducer (TAIR:AT4G40050.1); Has 153 Blast hits to 150 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT3G04560AT3G04560.1GGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink). 
AT3G06040AT3G06040.1ATAAAGCCribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT3G06040.2ATAAAGCCribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT3G06040.3ATAAAGCCribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT3G06380AT3G06380.1GGCTTTATMember of TLP family 
AT3G07150AT3G07150.1ATAAAGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G08510AT3G08510.1CTTAATGGGCTTTATPhosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. 
AT3G08510.2CTTAATGGGCTTTATPhosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. 
AT3G08510.3CTTAATGGGCTTTATPhosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. 
AT3G08520AT3G08520.1ATAAAGCCCATTAAG60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G09080AT3G09080.1GGCTTTATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink). 
AT3G09085AT3G09085.1ATAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink). 
AT3G09630AT3G09630.1TTATTGGGCTTTAT60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT3G09630.2TTATTGGGCTTTAT60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT3G09920AT3G09920.1GGCTTTATPHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE (PIP5K9); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: amino acid metabolic process, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G60890.1); Has 21682 Blast hits to 6213 proteins in 379 species: Archae - 0; Bacteria - 2219; Metazoa - 3466; Fungi - 306; Plants - 724; Viruses - 0; Other Eukaryotes - 14967 (source: NCBI BLink). 
AT3G09920.2GGCTTTATPHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE (PIP5K9); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: amino acid metabolic process, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G60890.1); Has 21682 Blast hits to 6213 proteins in 379 species: Archae - 0; Bacteria - 2219; Metazoa - 3466; Fungi - 306; Plants - 724; Viruses - 0; Other Eukaryotes - 14967 (source: NCBI BLink). 
AT3G10405AT3G10405.1ATAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen development; LOCATED IN: chloroplast; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G11120AT3G11120.1TATGGGCTTTATTGGGC60S ribosomal protein L41 (RPL41E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G11270AT3G11270.1TTTAGGCCCATATAATTGGGCTTTATmaternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT3G12210AT3G12210.1CTGCCACGTGGCTTTATsequence-specific DNA binding; FUNCTIONS IN: sequence-specific DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583); Has 163 Blast hits to 163 proteins in 72 species: Archae - 1; Bacteria - 0; Metazoa - 86; Fungi - 51; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G12210.2CTGCCACGTGGCTTTATsequence-specific DNA binding; FUNCTIONS IN: sequence-specific DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583); Has 163 Blast hits to 163 proteins in 72 species: Archae - 1; Bacteria - 0; Metazoa - 86; Fungi - 51; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G12300AT3G12300.1GGCTTTATTAGTGGGCCGAGGCCCAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT3G13230AT3G13230.1TTATGGGCTTTATRNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT3G15810AT3G15810.1ATAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80120.1); Has 208 Blast hits to 208 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 7; Plants - 201; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G17430AT3G17430.1TATAGGCCCATAAAGCCCAATphosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT1G48230.1); Has 1446 Blast hits to 1445 proteins in 173 species: Archae - 0; Bacteria - 5; Metazoa - 374; Fungi - 259; Plants - 650; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). 
AT3G17626AT3G17626.1TTATGGGCTTTATTATTGGGCTTTTAGCCCAACTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT3G18040AT3G18040.1ATAAAGCCMAP KINASE 9 
AT3G19590AT3G19590.1ATATGGGCTTTATTAGCCCAATWD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink). 
AT3G19680AT3G19680.1ATAAAGCCCACTunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50040.1); Has 728 Blast hits to 127 proteins in 32 species: Archae - 0; Bacteria - 22; Metazoa - 26; Fungi - 20; Plants - 72; Viruses - 0; Other Eukaryotes - 588 (source: NCBI BLink). 
AT3G25070AT3G25070.1ATAAAGCCGCCTTTAACGGEncodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. 
AT3G26410AT3G26410.1TAAATGGGCTTTATTGGGCCCATGmethyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G26420AT3G26420.1CATGGGCCCAATAAAGCCCATTTAZinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. 
AT3G45030AT3G45030.1TTATTGGGCTTTAT40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT3G46100AT3G46100.1ATAAAGCCCAGCCCATTAGhistidyl-tRNA synthetase 
AT3G46560AT3G46560.1ATAAAGCCCACCAGGCCCAATAAEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT3G46960AT3G46960.1ATAAAGCCATP binding / ATP-dependent helicase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DSH, C-terminal (InterPro:IPR012961), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), RNA helicase, ATP-dependent, SK12/DOB1 (InterPro:IPR016438), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: HEN2 (hua enhancer 2); ATP-dependent helicase/ RNA helicase (TAIR:AT2G06990.1); Has 7311 Blast hits to 5276 proteins in 657 species: Archae - 463; Bacteria - 1480; Metazoa - 1237; Fungi - 1015; Plants - 265; Viruses - 46; Other Eukaryotes - 2805 (source: NCBI BLink). 
AT3G49400AT3G49400.1ATAAAGCCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT3G50080AT3G50080.1ATAAAGCCCATTGGGCCAAEncodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. 
AT3G50630AT3G50630.1GGCTTTATKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. 
AT3G51820AT3G51820.1TTTTGGGCTTTATEncodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. 
AT3G53320AT3G53320.1TTATGGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37070.1); Has 10077 Blast hits to 5050 proteins in 411 species: Archae - 0; Bacteria - 1106; Metazoa - 4046; Fungi - 1512; Plants - 226; Viruses - 108; Other Eukaryotes - 3079 (source: NCBI BLink). 
AT3G54430AT3G54430.1ATAAAGCCGTTTTA member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. 
AT3G54620AT3G54620.1ATAAAGCCbZIP transcription factor-like protein mRNA 
AT3G54620.2ATAAAGCCbZIP transcription factor-like protein mRNA 
AT3G55110AT3G55110.1GGCTTTATABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ATWBC19 (White-Brown Complex homolog 19); ATPase, coupled to transmembrane movement of substances (TAIR:AT3G55130.1); Has 227231 Blast hits to 207994 proteins in 2641 species: Archae - 4288; Bacteria - 157682; Metazoa - 7085; Fungi - 4180; Plants - 2671; Viruses - 12; Other Eukaryotes - 51313 (source: NCBI BLink). 
AT3G55480AT3G55480.1TGATGGGCTTTATadaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). 
AT3G55480.2TGATGGGCTTTATadaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). 
AT3G57580AT3G57580.1GGCTTTATF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57590.1); Has 751 Blast hits to 714 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 749; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G59340AT3G59340.1GAGCCCAATAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). 
AT3G60080AT3G60080.1ATAAAGCCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G44330.1); Has 6748 Blast hits to 6680 proteins in 214 species: Archae - 0; Bacteria - 92; Metazoa - 2365; Fungi - 617; Plants - 2650; Viruses - 6; Other Eukaryotes - 1018 (source: NCBI BLink). 
AT3G60820AT3G60820.1CAAAGCCCAAATAAGGCCCATTATAAAGCCEncodes 20S proteasome beta subunit PBF1 (PBF1). 
AT3G60820.2CAAAGCCCAAATAAGGCCCATTATAAAGCCEncodes 20S proteasome beta subunit PBF1 (PBF1). 
AT3G62220AT3G62220.1GGCTTTATserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink). 
AT3G62360AT3G62360.1TAGTGGGCTTTATAAAGCCCATTAAGCCCTAcarbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G62370AT3G62370.1TAGGGCTTAATGGGCTTTATAAAGCCCACTAunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G62680AT3G62680.1ATAAAGCCCProline-rich protein 
AT4G01000AT4G01000.1ATAAAGCCCAubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: splicing factor-related (TAIR:AT3G06455.1); Has 6590 Blast hits to 3359 proteins in 562 species: Archae - 0; Bacteria - 34; Metazoa - 2857; Fungi - 799; Plants - 1435; Viruses - 158; Other Eukaryotes - 1307 (source: NCBI BLink). 
AT4G01070AT4G01070.1ATAAAGCCthe glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta 
AT4G01400AT4G01400.2GTGGGCCTTATTTGGGCTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). 
AT4G03080AT4G03080.1ATAAAGCCBRI1 SUPPRESSOR 1 (BSU1)-LIKE 1 (BSL1); FUNCTIONS IN: hydrolase activity, manganese ion binding, protein serine/threonine phosphatase activity, iron ion binding, phosphoprotein phosphatase activity; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Metallophosphoesterase (InterPro:IPR004843), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Serine/threonine protein phosphatase, BSU1 (InterPro:IPR012391), Kelch-type beta propeller (InterPro:IPR015915), Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase (InterPro:IPR006186); BEST Arabidopsis thaliana protein match is: kelch repeat-containing serine/threonine phosphoesterase family protein (TAIR:AT2G27210.1); Has 8464 Blast hits to 6996 proteins in 403 species: Archae - 49; Bacteria - 206; Metazoa - 3422; Fungi - 1329; Plants - 1405; Viruses - 5; Other Eukaryotes - 2048 (source: NCBI BLink). 
AT4G03260AT4G03260.1GGGCTTTATleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). 
AT4G03260.2GGGCTTTATleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). 
AT4G08300AT4G08300.1ATAAAGCCnodulin MtN21 family protein; LOCATED IN: membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT1G44800.1); Has 2087 Blast hits to 2074 proteins in 338 species: Archae - 27; Bacteria - 934; Metazoa - 4; Fungi - 2; Plants - 631; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). 
AT4G12420AT4G12420.1GGCTTTATEncodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. 
AT4G13670AT4G13670.1ATAAGGGCTTTATPLASTID TRANSCRIPTIONALLY ACTIVE5 (PTAC5); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding, metabolic process; LOCATED IN: plastid chromosome, chloroplast thylakoid membrane, chloroplast, nucleoid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan binding-like (InterPro:IPR002477), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 536 Blast hits to 528 proteins in 143 species: Archae - 7; Bacteria - 168; Metazoa - 136; Fungi - 16; Plants - 42; Viruses - 2; Other Eukaryotes - 165 (source: NCBI BLink). 
AT4G14110AT4G14110.1GGCTTTATRepresses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex. 
AT4G14615AT4G14615.1GTGGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52825.1); Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G14870AT4G14870.1ATTTGGGCTTTATAAGGCCCATAAP-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecE subunit of protein translocation complex (InterPro:IPR005807); Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G14905AT4G14905.1AAATGGGCTTTATAGGCCCATTTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G14905.2AAATGGGCTTTATAGGCCCATTTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G15000AT4G15000.1ATAAAGCCCAAAT60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT4G15000.2ATAAAGCCCAAAT60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT4G17570AT4G17570.1ATAAAGCCzinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT5G47140.1); Has 593 Blast hits to 574 proteins in 91 species: Archae - 0; Bacteria - 4; Metazoa - 17; Fungi - 134; Plants - 403; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT4G17650AT4G17650.1ATAAAGCCCATTGGGCCCAACAaromatic-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Has 1885 Blast hits to 1881 proteins in 667 species: Archae - 0; Bacteria - 1017; Metazoa - 157; Fungi - 73; Plants - 26; Viruses - 1; Other Eukaryotes - 611 (source: NCBI BLink). 
AT4G27500AT4G27500.1ATAAAGCCCinteracts with H+-ATPase, and regulates its activity 
AT4G28730AT4G28730.1ATAAAGCCglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink). 
AT4G29060AT4G29060.1GGCTTTATembryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink). 
AT4G29060.2GGCTTTATembryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink). 
AT4G29480AT4G29480.1ATAAAGCCmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G31120AT4G31120.1ATAAAGCCCATTAGAAAAGCCCInvolved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. 
AT4G31120.2ATAAAGCCCATTAGAAAAGCCCInvolved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. 
AT4G32040AT4G32040.1GGCTTTATA member of Class II KN1-like homeodomain transcription factors factors (together with KNAT3 and KNAT4), with greatest homology to the maize knox1 homeobox protein. Regulates photomorphogenic responses and represses late steps in gibberellin biosynthesis. KNAT5 promoter activity showed cell-type specific pattern along longitudinal root axis, primarily in the epidermis of the distal end of primary root elongation zone. 
AT4G32280AT4G32280.1ATAAAGCCAuxin inducible protein. 
AT4G33110AT4G33110.1ATAAAGCCACGcoclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33120.1); Has 6032 Blast hits to 6030 proteins in 921 species: Archae - 32; Bacteria - 2504; Metazoa - 56; Fungi - 238; Plants - 239; Viruses - 0; Other Eukaryotes - 2963 (source: NCBI BLink). 
AT4G33120AT4G33120.1ATAAAGCCACGcoclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33110.1); Has 5982 Blast hits to 5978 proteins in 904 species: Archae - 32; Bacteria - 2580; Metazoa - 59; Fungi - 244; Plants - 209; Viruses - 0; Other Eukaryotes - 2858 (source: NCBI BLink). 
AT4G33820AT4G33820.1ATAAAGCCglycosyl hydrolase family 10 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 10 (InterPro:IPR001000), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 10 protein (TAIR:AT4G33810.1); Has 1353 Blast hits to 1346 proteins in 274 species: Archae - 0; Bacteria - 668; Metazoa - 27; Fungi - 278; Plants - 160; Viruses - 0; Other Eukaryotes - 220 (source: NCBI BLink). 
AT4G39070AT4G39070.1ATAAAGCCzinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: STH2 (SALT TOLERANCE HOMOLOG2); transcription factor/ zinc ion binding (TAIR:AT1G75540.1); Has 1235 Blast hits to 854 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1150; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT4G39420AT4G39420.1ATAAAGCCCAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible. 
AT4G39420.2ATAAAGCCCAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible. 
AT4G39630AT4G39630.1GGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G01300AT5G01300.1TTTAGGCCCAATAAAGCCCAATATphosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT5G01300.2TTTAGGCCCAATAAAGCCCAATATphosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT5G01520AT5G01520.1GGGCTTTATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 1238 Blast hits to 1237 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 65; Plants - 210; Viruses - 109; Other Eukaryotes - 261 (source: NCBI BLink). 
AT5G01520.2GGGCTTTATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 1238 Blast hits to 1237 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 65; Plants - 210; Viruses - 109; Other Eukaryotes - 261 (source: NCBI BLink). 
AT5G02100AT5G02100.1ATAAAGCCCAACAEncodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. 
AT5G05220AT5G05220.1ATAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: stamen; EXPRESSED DURING: 4 anthesis; Has 17 Blast hits to 10 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G05310AT5G05310.1TTTAACGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). 
AT5G05310.2TTTAACGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). 
AT5G05310.3TTTAACGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). 
AT5G07960AT5G07960.1TAGGGCTTTATunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0139 (InterPro:IPR005351); Has 146 Blast hits to 146 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G10110AT5G10110.1CTATTGGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G10560AT5G10560.1ATAAAGCCCglycosyl hydrolase family 3 protein; FUNCTIONS IN: xylan 1,4-beta-xylosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT1G78060.1); Has 5112 Blast hits to 4512 proteins in 661 species: Archae - 16; Bacteria - 2460; Metazoa - 12; Fungi - 920; Plants - 292; Viruses - 0; Other Eukaryotes - 1412 (source: NCBI BLink). 
AT5G11240AT5G11240.1GTGGGCTTTATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink). 
AT5G13780AT5G13780.1ATAAAGCCGCN5-related N-acetyltransferase, putative; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT1G03150.1); Has 1600 Blast hits to 1599 proteins in 383 species: Archae - 137; Bacteria - 234; Metazoa - 600; Fungi - 262; Plants - 103; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink). 
AT5G14050AT5G14050.1GGGCTTTATTGGGCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink). 
AT5G14430AT5G14430.1ATAAAGCCCAATAAGdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14430.1ATAAAGCCCAATATdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14430.2ATAAAGCCCAATAAGdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14430.2ATAAAGCCCAATATdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14760AT5G14760.1GGCTTTATAt5g14760 encodes for L-aspartate oxidase involved in the early steps of NAD biosynthesis. In contrary to the EC 1.4.3.16 (l-aspartate oxidase - deaminating) the enzyme catalyzes the reaction L-aspartate + O2 = iminoaspartate (alpha-iminosuccinate) + H2O2 
AT5G15200AT5G15200.1TAAAGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G15200.1TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G15200.2TAAAGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G15200.2TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G16650AT5G16650.1ATAAAGCCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G33735.1); Has 16083 Blast hits to 16080 proteins in 1936 species: Archae - 108; Bacteria - 5268; Metazoa - 3302; Fungi - 1476; Plants - 1210; Viruses - 11; Other Eukaryotes - 4708 (source: NCBI BLink). 
AT5G18390AT5G18390.1TAGGGCTTTATpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink). 
AT5G19840AT5G19840.1GGCTTTATtranscription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT3G20810.2); Has 1237 Blast hits to 1234 proteins in 236 species: Archae - 0; Bacteria - 265; Metazoa - 548; Fungi - 149; Plants - 105; Viruses - 6; Other Eukaryotes - 164 (source: NCBI BLink). 
AT5G22690AT5G22690.1GGCTTTATdisease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: protein binding, transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157), Leucine-rich repeat 3 (InterPro:IPR011713); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT5G46470.1); Has 11710 Blast hits to 8495 proteins in 293 species: Archae - 12; Bacteria - 380; Metazoa - 722; Fungi - 5; Plants - 10309; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink). 
AT5G23120AT5G23120.1ATAAAGCCencodes a stability and/or assembly factor of photosystem II 
AT5G24640AT5G24640.1ATAAAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G24650AT5G24650.1ATAAAGCCCAAATmitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G26740AT5G26740.1GGCTTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05940.1); Has 662 Blast hits to 655 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 312; Fungi - 124; Plants - 129; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). 
AT5G26740.2GGCTTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05940.1); Has 662 Blast hits to 655 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 312; Fungi - 124; Plants - 129; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). 
AT5G26740.3GGCTTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05940.1); Has 662 Blast hits to 655 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 312; Fungi - 124; Plants - 129; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). 
AT5G27920AT5G27920.1ATAAAGCCF-box family protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 10236 Blast hits to 3505 proteins in 207 species: Archae - 0; Bacteria - 631; Metazoa - 4869; Fungi - 921; Plants - 2316; Viruses - 19; Other Eukaryotes - 1480 (source: NCBI BLink). 
AT5G35360AT5G35360.1CTTAATGGGCTTTATEncodes biotin carboxylase subunit (CAC2). 
AT5G35360.2CTTAATGGGCTTTATEncodes biotin carboxylase subunit (CAC2). 
AT5G37510AT5G37510.1TAAAAGCCCATAAAGCCCAAAAEncodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. 
AT5G37510.2TAAAAGCCCATAAAGCCCAAAAEncodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. 
AT5G39740AT5G39740.1TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT5G40370AT5G40370.1CAAGGCCCAATAAAGCCCATTAAglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). 
AT5G40370.2CAAGGCCCAATAAAGCCCATTAAglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). 
AT5G45775AT5G45775.1TTATGGGCTTTAT60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). 
AT5G45775.2TTATGGGCTTTAT60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). 
AT5G45900AT5G45900.1ATAAAGCCGACCCGACCCGGComponent of autophagy conjugation pathway. Required for proper senescence. 
AT5G50960AT5G50960.1CTTAATGGGCTTTATHighly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. 
AT5G51160AT5G51160.1GGCTTTATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.2); Has 19441 Blast hits to 9219 proteins in 402 species: Archae - 30; Bacteria - 1030; Metazoa - 11449; Fungi - 756; Plants - 1298; Viruses - 45; Other Eukaryotes - 4833 (source: NCBI BLink). 
AT5G52510AT5G52510.1ATAAAGCCscarecrow-like transcription factor 8 (SCL8); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: SCL1 (SCARECROW-LIKE 1); transcription factor (TAIR:AT1G21450.1); Has 1239 Blast hits to 1228 proteins in 191 species: Archae - 0; Bacteria - 4; Metazoa - 13; Fungi - 19; Plants - 1170; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT5G53420AT5G53420.1GGCTTTATGGGCTTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27900.2); Has 863 Blast hits to 863 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 840; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT5G53420.3GGCTTTATGGGCTTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27900.2); Has 863 Blast hits to 863 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 840; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT5G55140AT5G55140.1TAATTGGGCCCAGATAAAGCCCAAATribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT5G56670AT5G56670.1ATAAAGCCCAATAG40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). 
AT5G56670.1TATGGGCCCATAAAGCCCAATAT40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). 
AT5G57840AT5G57840.1ATAAAGCCencodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091) 
AT5G58560AT5G58560.1ATAAAGCCCAAACTAGGCCCACAphosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: VTE5 (vitamin E pathway gene5); phosphatidate cytidylyltransferase/ phytol kinase (TAIR:AT5G04490.1); Has 383 Blast hits to 383 proteins in 126 species: Archae - 22; Bacteria - 164; Metazoa - 0; Fungi - 29; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT5G58640AT5G58640.1AGTGGGCTTTATselenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT5G58640.2AGTGGGCTTTATselenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT5G59850AT5G59850.1AAAGGCCCAAAATAAAGCCCATTAT40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink). 
AT5G62000AT5G62000.1GGCTTTATEncodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. 
AT5G62000.2GGCTTTATEncodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. 
AT5G62000.3GGCTTTATEncodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. 
AT5G62810AT5G62810.1ATAAAGCCmutant has a defect in the intracellular transport of thiolase from the cytosol to glyoxysomes (formerly known as ped2) 
AT5G63520AT5G63520.1ATAAAGCCCAATGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G64610AT5G64610.1ATAAAGCCEncodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. 
AT5G64830AT5G64830.1AAAACCGGTTAGGGCTTTATprogrammed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). 
AT5G64830.2AAAACCGGTTAGGGCTTTATprogrammed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). 
AT5G65110AT5G65110.1ATAAAGCCCAAAAGCCCACEncodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. 
AT5G65110.2ATAAAGCCCAAAAGCCCACEncodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. 
AT5G65650AT5G65650.1AAATGGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G65940AT5G65940.1ATAAAGCCCATTAThydrolyzes beta-hydroxyisobutyryl-CoA 
AT5G65940.2ATAAAGCCCATTAThydrolyzes beta-hydroxyisobutyryl-CoA 
AT5G65940.3ATAAAGCCCATTAThydrolyzes beta-hydroxyisobutyryl-CoA 
AT5G65960AT5G65960.1ATAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 294 Blast hits to 294 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 21; Plants - 119; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT5G67100AT5G67100.1TTTTGGGCTTTATEncodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering. 
AT5G67220AT5G67220.1ATAAAGCCCATnitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, oxidation reduction, tRNA processing, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7771 Blast hits to 7769 proteins in 1423 species: Archae - 42; Bacteria - 4261; Metazoa - 411; Fungi - 347; Plants - 96; Viruses - 0; Other Eukaryotes - 2614 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.