| Locus | Gene model | Sequence | Description |
| AT1G02080 | AT1G02080.1 | TGTGGGCCTTAA | transcriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G04270 | AT1G04270.1 | TGGGCCCACA | Encodes cytosolic ribosomal protein S15. |
| AT1G04270.2 | TGGGCCCACA | Encodes cytosolic ribosomal protein S15. |
| AT1G05850 | AT1G05850.1 | TAGGGCCCACA | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
| AT1G05860 | AT1G05860.1 | TGTGGGCCCTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G07250 | AT1G07250.1 | TTGGCCCACA | UDP-GLUCOSYL TRANSFERASE 71C4 (UGT71C4); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71C3 (UDP-GLUCOSYL TRANSFERASE 71C3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G07260.1); Has 4707 Blast hits to 4690 proteins in 296 species: Archae - 0; Bacteria - 123; Metazoa - 1851; Fungi - 11; Plants - 2658; Viruses - 37; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT1G09690 | AT1G09690.1 | TGTGGGCCGGTTAT | 60S ribosomal protein L21 (RPL21C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: juvenile leaf, pollen tube; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21A) (TAIR:AT1G09590.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT1G09800 | AT1G09800.1 | TGTGGGCCATCGGCCCACA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink). |
| AT1G14250 | AT1G14250.1 | ATCGGCCCACA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14240.4); Has 1087 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 20; Metazoa - 530; Fungi - 212; Plants - 197; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G16130 | AT1G16130.1 | TGTGGGCC | wall-associated kinase like |
| AT1G32260 | AT1G32260.1 | ACGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G32470 | AT1G32470.1 | TGTGGGCCGAA | glycine cleavage system H protein, mitochondrial, putative; FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity; INVOLVED IN: glycine catabolic process; LOCATED IN: mitochondrion, glycine cleavage complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Single hybrid motif (InterPro:IPR011053), Glycine cleavage H-protein (InterPro:IPR002930), Glycine cleavage H-protein, subgroup (InterPro:IPR017453); BEST Arabidopsis thaliana protein match is: GDCH; glycine dehydrogenase (decarboxylating) (TAIR:AT2G35370.1); Has 4756 Blast hits to 4756 proteins in 1228 species: Archae - 82; Bacteria - 2411; Metazoa - 143; Fungi - 84; Plants - 158; Viruses - 0; Other Eukaryotes - 1878 (source: NCBI BLink). |
| AT1G33120 | AT1G33120.1 | TAAAGGCCCACA | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G35220 | AT1G35220.1 | TCAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 247 Blast hits to 143 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT1G49410 | AT1G49410.1 | TCGGCCCACA | translocase of the outer mitochondrial membrane 6 (TOM6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G71500 | AT1G71500.1 | CTAAGGCCCACATTGGCCCAACT | Rieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae - 0; Bacteria - 101; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72240 | AT1G72240.1 | TGTGGGCCTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22470.1); Has 35 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G73490 | AT1G73490.1 | GTGGCCCACA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATNUC-L1; nucleic acid binding / nucleotide binding (TAIR:AT1G48920.1); Has 51 Blast hits to 47 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G78800 | AT1G78800.1 | TGTGGGCCTTG | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: SUS5; UDP-glycosyltransferase/ sucrose synthase (TAIR:AT5G37180.1); Has 9928 Blast hits to 9895 proteins in 1204 species: Archae - 399; Bacteria - 5805; Metazoa - 243; Fungi - 183; Plants - 319; Viruses - 0; Other Eukaryotes - 2979 (source: NCBI BLink). |
| AT1G80480 | AT1G80480.1 | ACGGCCCACA | PLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink). |
| AT2G02910 | AT2G02910.1 | TGTGGGCCGATGGCCCACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 191 Blast hits to 191 proteins in 22 species: Archae - 6; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT2G19080 | AT2G19080.1 | TGTGGGCCTTTTAAAGCCCAAAA | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G20410 | AT2G20410.1 | TGTGGGCCATCGGCCCACA | activating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G20580 | AT2G20580.1 | TGTGGGCCCATG | encoding the RPN subunits of the 26S proteasome |
| AT2G24280 | AT2G24280.1 | TGTGGGCCTAAA | serine carboxypeptidase S28 family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, lysosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S28 (InterPro:IPR008758); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S28 family protein (TAIR:AT5G65760.1); Has 915 Blast hits to 887 proteins in 113 species: Archae - 0; Bacteria - 3; Metazoa - 520; Fungi - 132; Plants - 108; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G26140 | AT2G26140.1 | TGTGGGCC | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G36120 | AT2G36120.1 | TGTGGGCCTCAACGTGTGA | Encodes a glycine rich protein that is involved in leaf vascular patterning. dot1 mutants have an aberrant open-class venation pattern in leaves and cotyledons, as well as several other leaf development defects. |
| AT2G40090 | AT2G40090.1 | CAAGCCCAATAAGTAAGGCCCACA | member of ATH subfamily |
| AT2G40700 | AT2G40700.1 | AGAGGCCCACA | DEAD/DEAH box helicase, putative (RH17); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G65900.1); Has 26770 Blast hits to 25070 proteins in 1684 species: Archae - 453; Bacteria - 10406; Metazoa - 5242; Fungi - 3151; Plants - 1377; Viruses - 5; Other Eukaryotes - 6136 (source: NCBI BLink). |
| AT2G42210 | AT2G42210.1 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.2 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.3 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.4 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G43120 | AT2G43120.1 | GAAGCCCATCATGGCCCACA | pirin, putative; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: stem, flower; CONTAINS InterPro DOMAIN/s: Pirin, C-terminal (InterPro:IPR008778), Pirin (InterPro:IPR012093), Cupin, RmlC-type (InterPro:IPR011051), Pirin, N-terminal (InterPro:IPR003829); BEST Arabidopsis thaliana protein match is: PRN (PIRIN); calmodulin binding (TAIR:AT3G59220.1); Has 5405 Blast hits to 5403 proteins in 856 species: Archae - 43; Bacteria - 2852; Metazoa - 62; Fungi - 147; Plants - 68; Viruses - 0; Other Eukaryotes - 2233 (source: NCBI BLink). |
| AT2G44270 | AT2G44270.1 | CAAAGCCCATTTATGGCCCACA | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink). |
| AT2G47250 | AT2G47250.1 | TCGGCCCACA | RNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink). |
| AT3G01700 | AT3G01700.1 | TGTGGGCCTGA | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
| AT3G02570 | AT3G02570.1 | AACGGCCCACA | Encodes a protein with phosphomannose isomerase activity. |
| AT3G02950 | AT3G02950.1 | TGTGGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tho complex subunit 7 (InterPro:IPR018018), Tho complex subunit 7/Mft1p (InterPro:IPR008501); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16790.1); Has 2049 Blast hits to 1787 proteins in 271 species: Archae - 31; Bacteria - 158; Metazoa - 1041; Fungi - 168; Plants - 75; Viruses - 26; Other Eukaryotes - 550 (source: NCBI BLink). |
| AT3G03960 | AT3G03960.1 | TTGGCCCACA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, theta subunit (InterPro:IPR012721); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 10959 Blast hits to 10902 proteins in 2114 species: Archae - 388; Bacteria - 4701; Metazoa - 1599; Fungi - 906; Plants - 376; Viruses - 0; Other Eukaryotes - 2989 (source: NCBI BLink). |
| AT3G04760 | AT3G04760.1 | TGTGGGCCAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 26507 Blast hits to 6286 proteins in 193 species: Archae - 4; Bacteria - 28; Metazoa - 952; Fungi - 704; Plants - 23378; Viruses - 0; Other Eukaryotes - 1441 (source: NCBI BLink). |
| AT3G05210 | AT3G05210.1 | TTAAGGCCCACA | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT3G09150 | AT3G09150.1 | TGTGGGCCCTA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G09150.2 | TGTGGGCCCTA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G09150.3 | TGTGGGCCCTA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G16080 | AT3G16080.1 | TCAGGCCCACA | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT3G17880 | AT3G17880.1 | TGTGGGCCAT | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT3G17880.2 | TGTGGGCCAT | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT3G18410 | AT3G18410.1 | AATAGGCCCACA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18410.2 | AATAGGCCCACA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G26770 | AT3G26770.1 | CTAGGCCCACA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G26760.1); Has 84124 Blast hits to 83955 proteins in 2264 species: Archae - 482; Bacteria - 45536; Metazoa - 5627; Fungi - 4443; Plants - 1587; Viruses - 7; Other Eukaryotes - 26442 (source: NCBI BLink). |
| AT3G53020 | AT3G53020.1 | TGTGGGCC | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20. |
| AT3G53030 | AT3G53030.1 | GGCCCACA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
| AT3G56820 | AT3G56820.1 | TGTGGGCCATCGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G60880 | AT3G60880.1 | TGTGGGCCGAA | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. |
| AT3G60880.2 | TGTGGGCCGAA | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. |
| AT3G61860 | AT3G61860.1 | TGTGGGCCTATT | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. |
| AT3G61870 | AT3G61870.1 | AATAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G61870.2 | AATAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G63190 | AT3G63190.1 | TACGGCCCATTAAGGCCCACA | RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR (RRF); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response to bacterium, translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: ribosome recycling factor family protein / ribosome releasing factor family protein (TAIR:AT3G01800.1); Has 5492 Blast hits to 5492 proteins in 1475 species: Archae - 0; Bacteria - 2924; Metazoa - 104; Fungi - 52; Plants - 56; Viruses - 0; Other Eukaryotes - 2356 (source: NCBI BLink). |
| AT4G00170 | AT4G00170.1 | AAGGCCCACA | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT4G17560 | AT4G17560.1 | ACGGCCCACA | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink). |
| AT4G17560.1 | TAAAGGCCCACA | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink). |
| AT4G24290 | AT4G24290.1 | CAATGGGCCCACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G24290.2 | CAATGGGCCCACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G25130 | AT4G25130.1 | TACGGCCCACA | peptide methionine sulfoxide reductase, putative; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: protein modification process, protein metabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase A (InterPro:IPR002569); BEST Arabidopsis thaliana protein match is: PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / peptide-methionine-(S)-S-oxide reductase (TAIR:AT5G61640.1); Has 7185 Blast hits to 7183 proteins in 1356 species: Archae - 86; Bacteria - 3332; Metazoa - 164; Fungi - 91; Plants - 129; Viruses - 1; Other Eukaryotes - 3382 (source: NCBI BLink). |
| AT4G25140 | AT4G25140.1 | TGTGGGCCGTA | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT4G25570 | AT4G25570.1 | AGGGCCCACA | Encodes cytochrome b561. |
| AT4G26520 | AT4G26520.1 | TGTGGGCCAAT | fructose-bisphosphate aldolase, cytoplasmic; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: pentose-phosphate shunt, response to hypoxia; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G26530.2); Has 4378 Blast hits to 4373 proteins in 736 species: Archae - 0; Bacteria - 421; Metazoa - 1256; Fungi - 2; Plants - 338; Viruses - 0; Other Eukaryotes - 2361 (source: NCBI BLink). |
| AT4G26720 | AT4G26720.1 | TGTGGGCCGGGCCTTAT | Encodes catalytic subunit of protein phosphatase X. Expressed at very low levels in A. thaliana flowers, leaves, stems and roots. |
| AT4G26870 | AT4G26870.1 | TGTGGGCCTTTCAAGCCCAACA | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G31180.2); Has 18508 Blast hits to 15212 proteins in 1719 species: Archae - 299; Bacteria - 10385; Metazoa - 672; Fungi - 662; Plants - 233; Viruses - 0; Other Eukaryotes - 6257 (source: NCBI BLink). |
| AT4G28230 | AT4G28230.1 | AGAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; Has 385 Blast hits to 299 proteins in 88 species: Archae - 0; Bacteria - 7; Metazoa - 168; Fungi - 23; Plants - 22; Viruses - 2; Other Eukaryotes - 163 (source: NCBI BLink). |
| AT4G28240 | AT4G28240.1 | GGCCCACA | wound-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G28710 | AT4G28710.1 | TGTGGGCCCCAATAT | member of Myosin-like proteins |
| AT4G29910 | AT4G29910.1 | CCGGCCCACA | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. |
| AT4G32272 | AT4G32272.1 | TGTGGGCCTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT4G33030 | AT4G33030.1 | GGCCCACAAAGGCC | involved in sulfolipid biosynthesis |
| AT4G37660 | AT4G37660.1 | TGTGGGCCTTAG | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5731 Blast hits to 5731 proteins in 1563 species: Archae - 0; Bacteria - 3202; Metazoa - 131; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2136 (source: NCBI BLink). |
| AT4G39260 | AT4G39260.1 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39260.2 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39260.3 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39260.4 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39710 | AT4G39710.1 | TGTGGGCCGAT | immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6176 Blast hits to 5824 proteins in 1083 species: Archae - 68; Bacteria - 2849; Metazoa - 1385; Fungi - 335; Plants - 363; Viruses - 0; Other Eukaryotes - 1176 (source: NCBI BLink). |
| AT5G01400 | AT5G01400.1 | AATAGGCCCACATCGGCCCATTAT | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G01840 | AT5G01840.1 | TGTGGGCC | Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. |
| AT5G03040 | AT5G03040.1 | GGCCCACA | IQ-domain 2 (iqd2); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD1 (IQ-DOMAIN 1); calmodulin binding (TAIR:AT3G09710.1); Has 651 Blast hits to 595 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 25; Plants - 437; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G03040.2 | GGCCCACA | IQ-domain 2 (iqd2); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD1 (IQ-DOMAIN 1); calmodulin binding (TAIR:AT3G09710.1); Has 651 Blast hits to 595 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 25; Plants - 437; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G03360 | AT5G03360.1 | GTGGCCCACA | DC1 domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, hypocotyl, root, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT4G26380.1); Has 2474 Blast hits to 510 proteins in 22 species: Archae - 2; Bacteria - 7; Metazoa - 3; Fungi - 0; Plants - 2453; Viruses - 4; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G07970 | AT5G07970.1 | GGCCCACA | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G07980.1); Has 597 Blast hits to 418 proteins in 73 species: Archae - 0; Bacteria - 68; Metazoa - 170; Fungi - 26; Plants - 66; Viruses - 0; Other Eukaryotes - 267 (source: NCBI BLink). |
| AT5G15410 | AT5G15410.1 | TGTGGGCCGTTTT | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. |
| AT5G15410.2 | TGTGGGCCGTTTT | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. |
| AT5G16200 | AT5G16200.1 | TGTGGGCCTC | 50S ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G66890.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18440 | AT5G18440.1 | CCCAATTGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G18440.2 | CCCAATTGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G22440 | AT5G22440.1 | TGTGGGCCTAAATACTGGGCTTTAA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). |
| AT5G22440.2 | TGTGGGCCTAAATACTGGGCTTTAA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). |
| AT5G23710 | AT5G23710.1 | TTTAGGCCCACA | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpc34-like (InterPro:IPR016049), RNA polymerase Rpc34 (InterPro:IPR007832); Has 254 Blast hits to 241 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT5G40451 | AT5G40451.1 | AAAAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40450.2); Has 9518 Blast hits to 5919 proteins in 574 species: Archae - 29; Bacteria - 1055; Metazoa - 3134; Fungi - 763; Plants - 338; Viruses - 136; Other Eukaryotes - 4063 (source: NCBI BLink). |
| AT5G44040 | AT5G44040.1 | TAAAAGCCATGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G04030.1); Has 753 Blast hits to 701 proteins in 137 species: Archae - 2; Bacteria - 60; Metazoa - 161; Fungi - 91; Plants - 57; Viruses - 6; Other Eukaryotes - 376 (source: NCBI BLink). |
| AT5G51940 | AT5G51940.1 | TGTGGGCCTAAATTGGGCTTG | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At2g04630. |
| AT5G52920 | AT5G52920.1 | TTGGCCCACA | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. |
| AT5G58560 | AT5G58560.1 | ATAAAGCCCAAACTAGGCCCACA | phosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: VTE5 (vitamin E pathway gene5); phosphatidate cytidylyltransferase/ phytol kinase (TAIR:AT5G04490.1); Has 383 Blast hits to 383 proteins in 126 species: Archae - 22; Bacteria - 164; Metazoa - 0; Fungi - 29; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G59840 | AT5G59840.1 | AAAAGGCCCACA | Ras-related GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB8; GTP binding (TAIR:AT3G53610.3); Has 23810 Blast hits to 23756 proteins in 654 species: Archae - 17; Bacteria - 124; Metazoa - 13243; Fungi - 2913; Plants - 2226; Viruses - 19; Other Eukaryotes - 5268 (source: NCBI BLink). |
| AT5G61150 | AT5G61150.1 | TGTGGGCCAA | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. |
| AT5G61150.2 | TGTGGGCCAA | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. |
| AT5G63380 | AT5G63380.1 | TATGGCCCACA | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT5G66240 | AT5G66240.1 | TTGGCCCACA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink). |
| AT5G66240.2 | TTGGCCCACA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink). |
| AT5G66410 | AT5G66410.1 | TGTGGGCCGTA | Encodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. |