version

Summary of AtREG614 (All List)

OrganismArabidopsis thaliana  
IDAtREG614  
SequenceAATACCCC  
Annotation  
PPDB MotifACCCCT  function unknown  
PLACE Motif 
Total Entry Count82  

Entry Sequences (82 entries)

LocusGene modelSequenceDescription
AT1G03200AT1G03200.1GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G04810AT1G04810.1GGGGTATT26S proteasome regulatory subunit, putative; FUNCTIONS IN: enzyme regulator activity, binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Proteasome/cyclosome, regulatory subunit (InterPro:IPR002015), Armadillo-type fold (InterPro:IPR016024), 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit (InterPro:IPR016642); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (TAIR:AT2G32730.1); Has 813 Blast hits to 749 proteins in 190 species: Archae - 12; Bacteria - 25; Metazoa - 307; Fungi - 211; Plants - 86; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink). 
AT1G11480AT1G11480.1AATACCCCeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT1G11480.2AATACCCCeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT1G16900AT1G16900.1GGGGTATTTcurculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein 
AT1G19830AT1G19830.1AAATACCCCauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT1G75580.1); Has 651 Blast hits to 640 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 650; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G22930AT1G22930.1GGGGTATTT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink). 
AT1G22930.2GGGGTATTT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink). 
AT1G23490AT1G23490.1GGGGTATTGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT1G24530AT1G24530.1GGGGTATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G24130.1); Has 34934 Blast hits to 16363 proteins in 585 species: Archae - 32; Bacteria - 4633; Metazoa - 14827; Fungi - 7171; Plants - 3064; Viruses - 0; Other Eukaryotes - 5207 (source: NCBI BLink). 
AT1G28580AT1G28580.2GGGGTATTTGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28570.1); Has 1868 Blast hits to 1834 proteins in 164 species: Archae - 0; Bacteria - 265; Metazoa - 1; Fungi - 5; Plants - 1584; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G29460AT1G29460.1AATACCCCauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29440.1); Has 389 Blast hits to 380 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G67360AT1G67360.1AATACCCCrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G67360.2AATACCCCrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G70530AT1G70530.1AATACCCCprotein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G40380.1); Has 86025 Blast hits to 84934 proteins in 3436 species: Archae - 55; Bacteria - 7756; Metazoa - 37741; Fungi - 6539; Plants - 18862; Viruses - 424; Other Eukaryotes - 14648 (source: NCBI BLink). 
AT1G78040AT1G78040.1AAATACCCCpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G78040.2AAATACCCCpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G19720AT2G19720.1AAATACCCCribosomal protein S15A B (rps15ab); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: rps15ae (ribosomal protein S15A E); structural constituent of ribosome (TAIR:AT4G29430.1); Has 2238 Blast hits to 2238 proteins in 697 species: Archae - 184; Bacteria - 769; Metazoa - 322; Fungi - 129; Plants - 201; Viruses - 0; Other Eukaryotes - 633 (source: NCBI BLink). 
AT2G19730AT2G19730.1GGGGTATTT60S ribosomal protein L28 (RPL28A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28e (InterPro:IPR002672); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L28 (RPL28C) (TAIR:AT4G29410.2); Has 369 Blast hits to 369 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 59; Plants - 72; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT2G19730.2GGGGTATTT60S ribosomal protein L28 (RPL28A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28e (InterPro:IPR002672); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L28 (RPL28C) (TAIR:AT4G29410.2); Has 369 Blast hits to 369 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 59; Plants - 72; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT2G19730.3GGGGTATTT60S ribosomal protein L28 (RPL28A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28e (InterPro:IPR002672); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L28 (RPL28C) (TAIR:AT4G29410.2); Has 369 Blast hits to 369 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 59; Plants - 72; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT2G30470AT2G30470.1AATACCCCHSI2 is a member of a novel family of B3 domain proteins with a sequence similar to the ERF-associated amphiphilic repression (EAR) motif. It functions as an active repressor of the Spo minimal promoter (derived from a gene for sweet potato sporamin A1) through the EAR motif. It contains a plant-specific B3 DNA-binding domain. The Arabidopsis genome contains 42 genes with B3 domains which could be classified into three families that are represented by ABI3, ARF1 and RAV1. HSI2 belongs to the ABI3 family. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50µM ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. 
AT2G33540AT2G33540.1AAATACCCCC-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3); FUNCTIONS IN: phosphoprotein phosphatase activity, CTD phosphatase activity; INVOLVED IN: response to salt stress; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FCP1-like phosphatase, phosphatase domain (InterPro:IPR011947), NLI interacting factor (InterPro:IPR004274), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4); phosphoprotein phosphatase (TAIR:AT5G58003.1); Has 1270 Blast hits to 886 proteins in 180 species: Archae - 0; Bacteria - 80; Metazoa - 438; Fungi - 191; Plants - 138; Viruses - 2; Other Eukaryotes - 421 (source: NCBI BLink). 
AT2G34470AT2G34470.1GGGGTATTEncodes a urease accessory protein which is essential for the activation of plant urease. 
AT2G34470.2GGGGTATTEncodes a urease accessory protein which is essential for the activation of plant urease. 
AT2G34650AT2G34650.1AAATACCCCEncodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. 
AT2G42500AT2G42500.1GGGGTATTencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A. 
AT2G42500.2GGGGTATTencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A. 
AT2G42840AT2G42840.1GGGGTATTAAATGGGEncodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia. 
AT3G01340AT3G01340.1GGGGTATTprotein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink). 
AT3G01340.2GGGGTATTprotein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink). 
AT3G01345AT3G01345.1AATACCCCExpressed protein; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28919.1); Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G05060AT3G05060.1AAATACCCCTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein 
AT3G05070AT3G05070.1TAAGGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G05270AT3G05270.1GGGGTATTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF869, plant (InterPro:IPR008587); BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT1G77580.2); Has 97002 Blast hits to 49715 proteins in 2003 species: Archae - 1158; Bacteria - 12418; Metazoa - 49297; Fungi - 7501; Plants - 3801; Viruses - 453; Other Eukaryotes - 22374 (source: NCBI BLink). 
AT3G05270.2GGGGTATTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF869, plant (InterPro:IPR008587); BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT1G77580.2); Has 97002 Blast hits to 49715 proteins in 2003 species: Archae - 1158; Bacteria - 12418; Metazoa - 49297; Fungi - 7501; Plants - 3801; Viruses - 453; Other Eukaryotes - 22374 (source: NCBI BLink). 
AT3G14240AT3G14240.1GGGGTATTTsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: SLP2; serine-type peptidase (TAIR:AT4G34980.1); Has 5240 Blast hits to 4507 proteins in 782 species: Archae - 159; Bacteria - 2860; Metazoa - 145; Fungi - 483; Plants - 911; Viruses - 0; Other Eukaryotes - 682 (source: NCBI BLink). 
AT3G14760AT3G14760.1AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G15095AT3G15095.1GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink). 
AT3G15095.2GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink). 
AT3G15095.3GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink). 
AT3G17910AT3G17910.1AATACCCCSurfeit 1 (SURF1) mRNA. Similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. 
AT3G22630AT3G22630.1AAATACCCCTGAEncodes 20S proteasome beta subunit PBD1 (PBD1). 
AT3G23290AT3G23290.2AAATACCCCTTALIGHT SENSITIVE HYPOCOTYLS 4 (LSH4); EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH3 (LIGHT SENSITIVE HYPOCOTYLS 3) (TAIR:AT2G31160.1); Has 185 Blast hits to 185 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G23460AT3G23460.1GGGGTATTcyclopropane fatty acid synthase-related; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, sepal, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: cyclopropane fatty acid synthase, putative / CPA-FA synthase, putative (TAIR:AT3G23510.1); Has 5948 Blast hits to 4401 proteins in 639 species: Archae - 0; Bacteria - 2541; Metazoa - 5; Fungi - 55; Plants - 84; Viruses - 0; Other Eukaryotes - 3263 (source: NCBI BLink). 
AT3G26120AT3G26120.1GGGGTATTSimilar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. 
AT3G27090AT3G27090.1GGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42050.1); Has 642 Blast hits to 564 proteins in 35 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 473 (source: NCBI BLink). 
AT3G27830AT3G27830.1AAATACCCC50S ribosomal protein L12-A 
AT3G27850AT3G27850.1AAATACCCCTTA50S ribosomal protein L12-C 
AT3G46830AT3G46830.1AATACCCCARABIDOPSIS RAB GTPASE HOMOLOG A2C (ATRABA2C); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endosome, plasma membrane, cell plate; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ATRABA2D (HOARABIDOPSIS RAB GTPASE HOMOLOG A2D); GTP binding (TAIR:AT5G59150.1); Has 23118 Blast hits to 23078 proteins in 640 species: Archae - 19; Bacteria - 105; Metazoa - 12740; Fungi - 3037; Plants - 2133; Viruses - 19; Other Eukaryotes - 5065 (source: NCBI BLink). 
AT3G51160AT3G51160.1AAATACCCCCatalyzes the first step in the de novo synthesis of GDP-L-fucose. 
AT3G62680AT3G62680.1AATACCCCProline-rich protein 
AT4G00370AT4G00370.1AATACCCCEncodes an inorganic phosphate transporter (PHT4;4). 
AT4G08685AT4G08685.1ATCCACGTCATCAAATACCCCEncodes a protein, expressed in leaves, with similarity to pollen allergens. 
AT4G14800AT4G14800.1AAATACCCCTGAEncodes 20S proteasome beta subunit PBD2 (PBD2). 
AT4G18205AT4G18205.1GGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: PUP7 (PURINE PERMEASE 7); purine transmembrane transporter (TAIR:AT4G18197.1); Has 282 Blast hits to 276 proteins in 29 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 22; Plants - 229; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G22330AT4G22330.1AATACCCCEncodes AtCES1 for Acyl-CoA independent ceramide synthase. 
AT4G27840AT4G27840.1GGGGTATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30630AT4G30630.1AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57910.1); Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G33700AT4G33700.1GGGGTATTCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT2G14520.1); Has 8185 Blast hits to 8163 proteins in 1404 species: Archae - 64; Bacteria - 5471; Metazoa - 234; Fungi - 109; Plants - 119; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink). 
AT4G39980AT4G39980.1AAATACCCCEncodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae. 
AT5G02580AT5G02580.1AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G02580.2AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G05730AT5G05730.1TAAGGGGTATTASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. 
AT5G06700AT5G06700.1GGGGTATTTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12060.1); Has 17239 Blast hits to 5249 proteins in 395 species: Archae - 12; Bacteria - 1942; Metazoa - 4813; Fungi - 2412; Plants - 768; Viruses - 494; Other Eukaryotes - 6798 (source: NCBI BLink). 
AT5G10070AT5G10070.1AAATACCCCRNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). 
AT5G10070.2AAATACCCCRNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). 
AT5G19240AT5G19240.1AAATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19230.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19330AT5G19330.1AAATACCCCTGAarmadillo/beta-catenin repeat family protein / BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding, binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), Armadillo-like helical (InterPro:IPR011989), BTB/POZ fold (InterPro:IPR011333), Armadillo (InterPro:IPR000225), BTB/POZ-like (InterPro:IPR000210), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ABAP1 (ARMADILLO BTB ARABIDOPSIS PROTEIN 1); protein binding (TAIR:AT5G13060.1); Has 13522 Blast hits to 10213 proteins in 289 species: Archae - 10; Bacteria - 57; Metazoa - 9428; Fungi - 689; Plants - 2320; Viruses - 84; Other Eukaryotes - 934 (source: NCBI BLink). 
AT5G19330.2AAATACCCCTGAarmadillo/beta-catenin repeat family protein / BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding, binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), Armadillo-like helical (InterPro:IPR011989), BTB/POZ fold (InterPro:IPR011333), Armadillo (InterPro:IPR000225), BTB/POZ-like (InterPro:IPR000210), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ABAP1 (ARMADILLO BTB ARABIDOPSIS PROTEIN 1); protein binding (TAIR:AT5G13060.1); Has 13522 Blast hits to 10213 proteins in 289 species: Archae - 10; Bacteria - 57; Metazoa - 9428; Fungi - 689; Plants - 2320; Viruses - 84; Other Eukaryotes - 934 (source: NCBI BLink). 
AT5G22070AT5G22070.1AAATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52060.2); Has 333 Blast hits to 332 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G39590AT5G39590.1GGGGTATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571); Has 144 Blast hits to 144 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 9; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT5G48760AT5G48760.1AAATACCCC60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). 
AT5G48760.2AAATACCCC60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). 
AT5G52990AT5G52990.1GGGGTATTvesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G58640AT5G58640.1GGGGTATTTselenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT5G58640.2GGGGTATTTselenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT5G60680AT5G60680.1GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45210.1); Has 210 Blast hits to 210 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G61110AT5G61110.1GGGGTATTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, sepal, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61100.1); Has 41 Blast hits to 36 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT5G65320AT5G65320.1AATACCCCTTAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (bHLH096) (TAIR:AT1G72210.1); Has 641 Blast hits to 636 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 18; Plants - 603; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G66100AT5G66100.1GGGGTATTTLa domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630); BEST Arabidopsis thaliana protein match is: La domain-containing protein (TAIR:AT4G35890.1); Has 14253 Blast hits to 4987 proteins in 345 species: Archae - 17; Bacteria - 1528; Metazoa - 3261; Fungi - 1497; Plants - 230; Viruses - 36; Other Eukaryotes - 7684 (source: NCBI BLink). 
AT5G66760AT5G66760.1GGGGTATTOne of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.