| Locus | Gene model | Sequence | Description |
| AT1G09250 | AT1G09250.1 | ATAAGGGC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G06590.2); Has 120 Blast hits to 120 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G18540 | AT1G18540.1 | ATAAGGGCCCATTAG | 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT1G20693 | AT1G20693.1 | ATAAGGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G20693.2 | ATAAGGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G20693.3 | ATAAGGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G23960 | AT1G23960.1 | TATATGGGCCCTTATAGCCCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G23960.2 | TATATGGGCCCTTATAGCCCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G24040 | AT1G24040.1 | TATATGGGCCATAAGGGCCCAATAA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24040.2 | TATATGGGCCATAAGGGCCCAATAA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24050 | AT1G24050.1 | TTATTGGGCCCTTATGGCCCATATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT1G55960 | AT1G55960.1 | TATGGCCCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13062.2); Has 177 Blast hits to 177 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G60987 | AT1G60987.1 | ATAAGGGC | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G62750 | AT1G62750.1 | GCCCTTAT | Nuclear encoded protein consists of the five domains conserved in EF-G proteins, with two GTP-binding sites in the first domain, and an additional transit peptide at the N-terminus. Localized in chloroplasts. Point mutation results in a delay in the onset of germination. At early developmental stage embryos still contain undifferentiated proplastids. The greening of cotyledons is severely impaired in light-grown mutant sco1 seedlings, whereas the following true leaves develop normally as in wild-type plants. |
| AT1G78815 | AT1G78815.1 | GCCCTTAT | LIGHT SENSITIVE HYPOCOTYLS 7 (LSH7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH8 (LIGHT SENSITIVE HYPOCOTYLS 8) (TAIR:AT1G16910.1); Has 183 Blast hits to 183 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G21280 | AT2G21280.1 | CAAAGCCCAATAAGGGCCTTTAA | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system. |
| AT2G21290 | AT2G21290.1 | TTAAAGGCCCTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G22055 | AT2G22055.1 | GCCCTTAT | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. This gene is contained within a highly AT-rich repetitive sequence region. |
| AT2G23900 | AT2G23900.1 | GCCCTTAT | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT3G48950.1); Has 2237 Blast hits to 2231 proteins in 306 species: Archae - 2; Bacteria - 569; Metazoa - 8; Fungi - 715; Plants - 835; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT2G26430 | AT2G26430.1 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26430.2 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26430.3 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G38560 | AT2G38560.1 | TTGGCCCAATAAGGGCCTGG | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
| AT2G39650 | AT2G39650.1 | ATAAGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 215 Blast hits to 215 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 213; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G39970 | AT2G39970.1 | ATAAGGGC | peroxisomal membrane protein (PMP36); FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: peroxisomal membrane, mitochondrial inner membrane, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: ATFOLT1 (ARABIDOPSIS THALIANA FOLATE TRANSPORTER 1); binding / folic acid transporter (TAIR:AT5G66380.1); Has 12085 Blast hits to 8258 proteins in 311 species: Archae - 0; Bacteria - 0; Metazoa - 6388; Fungi - 3049; Plants - 1606; Viruses - 0; Other Eukaryotes - 1042 (source: NCBI BLink). |
| AT2G47470 | AT2G47470.1 | ATAAGGGC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT2G47470.2 | ATAAGGGC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT2G47470.3 | ATAAGGGC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT2G47470.4 | ATAAGGGC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT3G08660 | AT3G08660.1 | ATAAGGGC | phototropic-responsive protein, putative; FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: response to light stimulus, N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: protein binding / signal transducer (TAIR:AT3G08570.1); Has 490 Blast hits to 467 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 0; Plants - 444; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G17020 | AT3G17020.1 | GCCCTTAT | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cold, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein / early nodulin ENOD18 family protein (TAIR:AT3G03270.2); Has 1714 Blast hits to 1682 proteins in 394 species: Archae - 203; Bacteria - 983; Metazoa - 43; Fungi - 48; Plants - 391; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT3G21890 | AT3G21890.1 | ATAAGGGC | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to UV-B, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G15248.1); Has 963 Blast hits to 745 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 953; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT3G22520 | AT3G22520.1 | ATAAGGGC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14840.1); Has 433 Blast hits to 421 proteins in 115 species: Archae - 9; Bacteria - 63; Metazoa - 124; Fungi - 60; Plants - 41; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT3G22530 | AT3G22530.1 | GCCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14830.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G45310 | AT3G45310.1 | GCCCTTAT | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: AALP (Arabidopsis aleurain-like protease); cysteine-type peptidase (TAIR:AT5G60360.1); Has 6209 Blast hits to 6164 proteins in 602 species: Archae - 25; Bacteria - 133; Metazoa - 2840; Fungi - 4; Plants - 1213; Viruses - 129; Other Eukaryotes - 1865 (source: NCBI BLink). |
| AT3G45310.2 | GCCCTTAT | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: AALP (Arabidopsis aleurain-like protease); cysteine-type peptidase (TAIR:AT5G60360.1); Has 6209 Blast hits to 6164 proteins in 602 species: Archae - 25; Bacteria - 133; Metazoa - 2840; Fungi - 4; Plants - 1213; Viruses - 129; Other Eukaryotes - 1865 (source: NCBI BLink). |
| AT3G58090 | AT3G58090.1 | ATAAGGGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT1G65870.1). |
| AT3G63000 | AT3G63000.1 | ATAAGGGC | NPL4-LIKE PROTEIN 1 (NPL41); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NPL4 (InterPro:IPR007717); BEST Arabidopsis thaliana protein match is: NPL4 family protein (TAIR:AT2G47970.1); Has 296 Blast hits to 296 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 86; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT4G11880 | AT4G11880.1 | GCCCTTAT | AGL12, AGL14, and AGL17 are all preferentially expressed in root tissues and therefore represent the only characterized MADS box genes expressed in roots. |
| AT4G12480 | AT4G12480.1 | ATAAGGGC | a putative lipid transfer protein, vernalization-responsive and cold-induced |
| AT4G13670 | AT4G13670.1 | ATAAGGGCTTTAT | PLASTID TRANSCRIPTIONALLY ACTIVE5 (PTAC5); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding, metabolic process; LOCATED IN: plastid chromosome, chloroplast thylakoid membrane, chloroplast, nucleoid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan binding-like (InterPro:IPR002477), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 536 Blast hits to 528 proteins in 143 species: Archae - 7; Bacteria - 168; Metazoa - 136; Fungi - 16; Plants - 42; Viruses - 2; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT4G13830 | AT4G13830.1 | ATAAGGGC | DnaJ-like protein (J20); nuclear gene |
| AT4G13830.2 | ATAAGGGC | DnaJ-like protein (J20); nuclear gene |
| AT4G14270 | AT4G14270.1 | GCCCTTAT | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14270.2 | GCCCTTAT | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G17390 | AT4G17390.1 | AAAAGGCCCAATAAGGGC | 60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G17410 | AT4G17410.1 | GCCCTTATTGGGCCTTTT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae - 2; Bacteria - 71; Metazoa - 5540; Fungi - 1215; Plants - 632; Viruses - 56; Other Eukaryotes - 1215 (source: NCBI BLink). |
| AT4G22360 | AT4G22360.1 | ATAAGGGC | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121), DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT3G19080.1); Has 1341 Blast hits to 971 proteins in 185 species: Archae - 0; Bacteria - 229; Metazoa - 293; Fungi - 295; Plants - 306; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| AT4G26990 | AT4G26990.1 | ATAAGGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54920.1); Has 176 Blast hits to 161 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 20; Plants - 57; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G30370 | AT4G30370.1 | ATAAGGGC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G18670.1); Has 5226 Blast hits to 5210 proteins in 199 species: Archae - 0; Bacteria - 0; Metazoa - 1823; Fungi - 334; Plants - 2376; Viruses - 14; Other Eukaryotes - 679 (source: NCBI BLink). |
| AT4G32190 | AT4G32190.1 | ATAAGGGC | centromeric protein-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 175667 Blast hits to 79884 proteins in 2342 species: Archae - 1846; Bacteria - 27476; Metazoa - 82690; Fungi - 12086; Plants - 6517; Viruses - 595; Other Eukaryotes - 44457 (source: NCBI BLink). |
| AT4G34760 | AT4G34760.1 | GCCCTTAT | auxin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT2G16580.1); Has 759 Blast hits to 747 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 758; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G35420 | AT4G35420.1 | GCCCTTAT | dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, sepal, hypocotyl, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: cinnamyl-alcohol dehydrogenase, putative (CAD) (TAIR:AT5G19440.1); Has 7550 Blast hits to 7537 proteins in 1113 species: Archae - 140; Bacteria - 2852; Metazoa - 261; Fungi - 555; Plants - 1434; Viruses - 44; Other Eukaryotes - 2264 (source: NCBI BLink). |
| AT4G36030 | AT4G36030.1 | ATAAGGGC | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G37250 | AT4G37250.1 | GCCCTTAT | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G23300.1); Has 84705 Blast hits to 60717 proteins in 2650 species: Archae - 63; Bacteria - 5442; Metazoa - 27750; Fungi - 3433; Plants - 38255; Viruses - 214; Other Eukaryotes - 9548 (source: NCBI BLink). |
| AT4G39550 | AT4G39550.1 | GCCCTTAT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae - 6; Bacteria - 90; Metazoa - 1470; Fungi - 6; Plants - 681; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT5G06110 | AT5G06110.1 | ATAAGGGC | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 30941 Blast hits to 21178 proteins in 1608 species: Archae - 101; Bacteria - 5693; Metazoa - 11416; Fungi - 3019; Plants - 1271; Viruses - 136; Other Eukaryotes - 9305 (source: NCBI BLink). |
| AT5G16380 | AT5G16380.1 | ATATGGGCTGAATAAGGGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07470.1); Has 277 Blast hits to 277 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G18200 | AT5G18200.1 | CGCACGTGTATAAGGGC | encodes an adenylyltransferase |
| AT5G58570 | AT5G58570.1 | ATAAGGGC | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G62690 | AT5G62690.1 | GCCCTTAT | encodes tubulin beta-2/beta-3 chain |
| AT5G63910 | AT5G63910.1 | ATAAGGGCCCAAG | encodes for a farnesylcysteine lyase (EC 1.8.3.5 - prenylcysteine oxidase) involved in a salvage pathway of farnesyl diphosphate. |
| ATCG00270 | ATCG00270.1 | ATAAGGGC | PSII D2 protein |
| ATMG01370 | ATMG01370.1 | GCCCTTATGGGCTGGGCCACACACGTG | hypothetical protein |