Organism | Arabidopsis thaliana | |
ID | AtREG619 | |
Sequence | CCAGGCCC | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | GGGCC | one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); |
Total Entry Count | 102 |
Locus | Gene model | Sequence | Description |
AT1G02290 | AT1G02290.1 | CCAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G02330 | AT1G02330.1 | GTGGGCCTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink).  |
AT1G07210 | AT1G07210.1 | TAAATGGGCCTGG | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink).  |
AT1G08460 | AT1G08460.1 | CCAGGCCCAATAAG | HDA08; FUNCTIONS IN: histone deacetylase activity; INVOLVED IN: histone deacetylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylase superfamily (InterPro:IPR000286); BEST Arabidopsis thaliana protein match is: HDA15; histone deacetylase (TAIR:AT3G18520.2); Has 6845 Blast hits to 6725 proteins in 846 species: Archae - 124; Bacteria - 2006; Metazoa - 1106; Fungi - 418; Plants - 273; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).  |
AT1G10417 | AT1G10417.1 | CTGGGCCTGGGCTATT | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens.  |
AT1G14770 | AT1G14770.1 | CCAGGCCCAATAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G14770.2 | CCAGGCCCAATAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G15250 | AT1G15250.1 | CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT | 60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT1G15260 | AT1G15260.1 | CATGGGCCTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16070.1); Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G23100 | AT1G23100.1 | GAATGGGCCTGGGCCACGTA | 10 kDa chaperonin, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Chaperonin Cpn10, conserved site (InterPro:IPR018369), Chaperonin Cpn10 (InterPro:IPR001476); BEST Arabidopsis thaliana protein match is: CPN10 (CHAPERONIN 10); chaperone binding (TAIR:AT1G14980.1); Has 5807 Blast hits to 5744 proteins in 1499 species: Archae - 0; Bacteria - 3188; Metazoa - 245; Fungi - 75; Plants - 201; Viruses - 2; Other Eukaryotes - 2096 (source: NCBI BLink).  |
AT1G23400 | AT1G23400.1 | TTATGGGCCTGGCCTTAGGGCCCAATT | Promotes the splicing of chloroplast group II introns.  |
AT1G27540 | AT1G27540.1 | TACTGGGCCTGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G27540.2 | TACTGGGCCTGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G30520 | AT1G30520.1 | TAATTGGGCCTGGCCTATA | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal.  |
AT1G30680 | AT1G30680.1 | AAATGGGCCAGGCCCAAT | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).  |
AT1G32730 | AT1G32730.1 | CCAGGCCCATATAAAAACGAC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G54100 | AT1G54100.1 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase  |
AT1G54100.2 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase  | |
AT1G56110 | AT1G56110.1 | CCGTTAAATGGGCCTGGCCCATTG | NOP56-like protein  |
AT1G58210 | AT1G58210.1 | AATTGGGCCTGG | EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink).  |
AT1G69680 | AT1G69680.1 | AGATGGGCCTGGGCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Ran-interacting Mog1 protein (InterPro:IPR007681), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 202 Blast hits to 202 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 83; Plants - 25; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
AT1G72020 | AT1G72020.1 | TAAATGGGCCTGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G72090 | AT1G72090.1 | TCGACCCGACCCAGGCCCATTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink).  |
AT1G74410 | AT1G74410.1 | GGGCCTGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G66070.1); Has 5472 Blast hits to 5456 proteins in 200 species: Archae - 0; Bacteria - 2; Metazoa - 1838; Fungi - 348; Plants - 2530; Viruses - 21; Other Eukaryotes - 733 (source: NCBI BLink).  |
AT1G76630 | AT1G76630.1 | CTTGGGCCTGGGCCTAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink).  |
AT1G80230 | AT1G80230.1 | CCAGGCCCAACA | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrial envelope, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT3G15640.1); Has 341 Blast hits to 341 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 189; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT2G20360 | AT2G20360.1 | CAAGGCCCAGGCCCATTT | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink).  |
AT2G20610 | AT2G20610.1 | CCAGGCCCAAAC | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis.  |
AT2G20610.2 | CCAGGCCCAAAC | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis.  | |
AT2G22990 | AT2G22990.1 | CTTGGGCCTGG | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.  |
AT2G22990.2 | CTTGGGCCTGG | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.  | |
AT2G22990.3 | CTTGGGCCTGG | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.  | |
AT2G22990.4 | CTTGGGCCTGG | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.  | |
AT2G22990.5 | CTTGGGCCTGG | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.  | |
AT2G22990.6 | CTTGGGCCTGG | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.  | |
AT2G28910 | AT2G28910.1 | CCAGGCCCAGCC | Encodes a CAX-interacting protein (CXIP4). The gene product is located in the nucleus of GFP-CXIP4-expressing yeast cells. When transiently expressed in the tobacco leaves, GFP-CXIP4 locates to the nucleus as well as in discrete areas of the cytoplasm (which do not overlap with mitochondria).  |
AT2G28910.1 | CCAGGCCCAGCCCAAAT | Encodes a CAX-interacting protein (CXIP4). The gene product is located in the nucleus of GFP-CXIP4-expressing yeast cells. When transiently expressed in the tobacco leaves, GFP-CXIP4 locates to the nucleus as well as in discrete areas of the cytoplasm (which do not overlap with mitochondria).  | |
AT2G34490 | AT2G34490.1 | CCAGGCCC | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-<i>epi</i>-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH.  |
AT2G35490 | AT2G35490.1 | ATAATGGGCCTGG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G35500 | AT2G35500.1 | CCAGGCCCATT | shikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).  |
AT2G38560 | AT2G38560.1 | TTGGCCCAATAAGGGCCTGG | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy.  |
AT3G11400 | AT3G11400.1 | GGGCCTGG | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3).  |
AT3G11400.2 | GGGCCTGG | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3).  | |
AT3G16080 | AT3G16080.1 | CCAGGCCCATTTA | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT3G17770 | AT3G17770.1 | AATTGGGCCTGGCCCATAT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT1G48430.1); Has 2619 Blast hits to 2616 proteins in 532 species: Archae - 8; Bacteria - 1790; Metazoa - 84; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 554 (source: NCBI BLink).  |
AT3G24820 | AT3G24820.1 | CCAGGCCCATTT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT3G24830 | AT3G24830.1 | AAATGGGCCTGG | 60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae - 212; Bacteria - 283; Metazoa - 292; Fungi - 127; Plants - 164; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink).  |
AT3G46560 | AT3G46560.1 | ATAAAGCCCACCAGGCCCAATAA | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
AT3G54920 | AT3G54920.1 | GATGGGCCTGGTTATGGGCCTAAC | Powdery mildew resistant mutant encodes a pectate lyase-like protein  |
AT3G58690 | AT3G58690.1 | TTTTGGGCCTGG | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G54820.1); Has 86522 Blast hits to 85517 proteins in 2739 species: Archae - 60; Bacteria - 8012; Metazoa - 37169; Fungi - 6786; Plants - 19292; Viruses - 369; Other Eukaryotes - 14834 (source: NCBI BLink).  |
AT3G62080 | AT3G62080.1 | TTAATGGGCCTGG | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).  |
AT3G62290 | AT3G62290.1 | CCAGGCCCACTA | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.  |
AT3G63370 | AT3G63370.1 | ATATGGGCCTGG | pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink).  |
AT4G00058 | AT4G00058.1 | CAATGGGCTCAAGCCCAGGCCCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.  |
AT4G09900 | AT4G09900.1 | GTGGGCCTGGGCTTTGGGCCTG | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro.  |
AT4G17510 | AT4G17510.1 | CCAGGCCCGTTA | UBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT4G27830 | AT4G27830.1 | CCAGGCCC | BETA GLUCOSIDASE 10 (BGLU10); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU9 (BETA GLUCOSIDASE 9); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G27820.1); Has 5737 Blast hits to 5502 proteins in 797 species: Archae - 98; Bacteria - 3121; Metazoa - 603; Fungi - 137; Plants - 848; Viruses - 0; Other Eukaryotes - 930 (source: NCBI BLink).  |
AT4G30660 | AT4G30660.1 | CCAGGCCCATTTA | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT4G30660.2 | CCAGGCCCATTTA | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT4G34830 | AT4G34830.1 | CCAGGCCCAATAA | LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink).  |
AT4G34840 | AT4G34840.1 | TTATTGGGCCTGG | ATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT4G37910 | AT4G37910.1 | GGGCCTGG | mitochondrial heat shock protein 70-1 (mtHsc70-1); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to salt stress, response to heat; LOCATED IN: mitochondrion, cell wall, plasma membrane, mitochondrial matrix; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Chaperone DnaK (InterPro:IPR012725), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: MTHSC70-2 (MITOCHONDRIAL HSP70 2); ATP binding (TAIR:AT5G09590.1); Has 25409 Blast hits to 25308 proteins in 3114 species: Archae - 101; Bacteria - 9998; Metazoa - 2940; Fungi - 1134; Plants - 697; Viruses - 241; Other Eukaryotes - 10298 (source: NCBI BLink).  |
AT4G38210 | AT4G38210.1 | AGATGGGCCTGG | expansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.  |
AT4G39210 | AT4G39210.1 | AAATGGGCCTGG | Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots.  |
AT5G01350 | AT5G01350.1 | AGATGGGCCTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G03290 | AT5G03290.1 | TTATTGGGCCTGG | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink).  |
AT5G05610 | AT5G05610.1 | GATGGGCCATGGGCCAGGCCCATTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
AT5G05610.2 | GATGGGCCATGGGCCAGGCCCATTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  | |
AT5G06210 | AT5G06210.1 | CCAGGCCCATAT | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP5 (glycine-rich RNA-binding protein 5); ATP binding / RNA binding (TAIR:AT1G74230.1); Has 20400 Blast hits to 15032 proteins in 629 species: Archae - 10; Bacteria - 1085; Metazoa - 11634; Fungi - 2516; Plants - 3112; Viruses - 0; Other Eukaryotes - 2043 (source: NCBI BLink).  |
AT5G07340 | AT5G07340.1 | CCAGGCCC | calnexin, putative; FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin 1 (CNX1) (TAIR:AT5G61790.1); Has 1287 Blast hits to 1216 proteins in 289 species: Archae - 0; Bacteria - 58; Metazoa - 600; Fungi - 146; Plants - 196; Viruses - 11; Other Eukaryotes - 276 (source: NCBI BLink).  |
AT5G07920 | AT5G07920.1 | TAATGGGCCTGGGCCCT | diacylglycerol kinase  |
AT5G08530 | AT5G08530.1 | ATTTGGGCCTGG | 51 kDa subunit of complex I (CI51); FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, NAD or NADH binding, FMN binding, NADH dehydrogenase (ubiquinone) activity, oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase, 51 kDa subunit, conserved site (InterPro:IPR001949), NADH-ubiquinone oxidoreductase, 51 kDa subunit (InterPro:IPR011538), NADH-ubiquinone oxidoreductase, F subunit (InterPro:IPR011537); Has 6830 Blast hits to 6821 proteins in 987 species: Archae - 16; Bacteria - 2579; Metazoa - 179; Fungi - 80; Plants - 67; Viruses - 0; Other Eukaryotes - 3909 (source: NCBI BLink).  |
AT5G08535 | AT5G08535.1 | CCAGGCCCAAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G08535.2 | CCAGGCCCAAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT5G11330 | AT5G11330.1 | ATATTGGGCCTGG | monooxygenase family protein; FUNCTIONS IN: oxidoreductase activity, monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: CTF2B; monooxygenase/ oxidoreductase (TAIR:AT2G29720.1); Has 2280 Blast hits to 2280 proteins in 460 species: Archae - 2; Bacteria - 1124; Metazoa - 4; Fungi - 594; Plants - 114; Viruses - 0; Other Eukaryotes - 442 (source: NCBI BLink).  |
AT5G11330.1 | TCTGGGCCTGG | monooxygenase family protein; FUNCTIONS IN: oxidoreductase activity, monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: CTF2B; monooxygenase/ oxidoreductase (TAIR:AT2G29720.1); Has 2280 Blast hits to 2280 proteins in 460 species: Archae - 2; Bacteria - 1124; Metazoa - 4; Fungi - 594; Plants - 114; Viruses - 0; Other Eukaryotes - 442 (source: NCBI BLink).  | |
AT5G11340 | AT5G11340.1 | CCAGGCCCAATAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT5G16800.2); Has 2784 Blast hits to 2784 proteins in 681 species: Archae - 121; Bacteria - 1284; Metazoa - 435; Fungi - 175; Plants - 77; Viruses - 0; Other Eukaryotes - 692 (source: NCBI BLink).  |
AT5G11340.1 | CCAGGCCCAGA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT5G16800.2); Has 2784 Blast hits to 2784 proteins in 681 species: Archae - 121; Bacteria - 1284; Metazoa - 435; Fungi - 175; Plants - 77; Viruses - 0; Other Eukaryotes - 692 (source: NCBI BLink).  | |
AT5G13310 | AT5G13310.1 | CCATTAAGCCAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae - 0; Bacteria - 44; Metazoa - 138; Fungi - 38; Plants - 34; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT5G20160 | AT5G20160.1 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT5G20160.2 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20160.3 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G22100 | AT5G22100.1 | CCAGGCCC | RNA cyclase family protein; FUNCTIONS IN: RNA-3'-phosphate cyclase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA 3'-terminal phosphate cyclase- like (InterPro:IPR000228), RNA 3'-terminal phosphate cyclase, insert region (InterPro:IPR013796), RNA 3'-terminal phosphate cyclase-like, eukaryotic (InterPro:IPR016443), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); Has 760 Blast hits to 750 proteins in 310 species: Archae - 113; Bacteria - 208; Metazoa - 233; Fungi - 95; Plants - 22; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).  |
AT5G23080 | AT5G23080.1 | GACCCGAACCAGGCCCAGA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.  |
AT5G23080.2 | GACCCGAACCAGGCCCAGA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.  | |
AT5G23090 | AT5G23090.1 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
AT5G23090.2 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  | |
AT5G23090.3 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  | |
AT5G23090.4 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  | |
AT5G23900 | AT5G23900.1 | CCAGGCCCATTTA | 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT5G42220 | AT5G42220.1 | AAAAGGCCAGGCCCAG | ubiquitin family protein; INVOLVED IN: protein modification process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25270.1); Has 9149 Blast hits to 5042 proteins in 638 species: Archae - 2; Bacteria - 184; Metazoa - 4041; Fungi - 1003; Plants - 1687; Viruses - 163; Other Eukaryotes - 2069 (source: NCBI BLink).  |
AT5G45730 | AT5G45730.1 | GGGCCTGG | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT3G07000.1); Has 1228 Blast hits to 487 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 1213; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G47690 | AT5G47690.1 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  |
AT5G47690.2 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  | |
AT5G47690.3 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  | |
AT5G48730 | AT5G48730.1 | ATTTGGGCCTGGCCCAATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13431 Blast hits to 4993 proteins in 158 species: Archae - 3; Bacteria - 10; Metazoa - 241; Fungi - 171; Plants - 12464; Viruses - 0; Other Eukaryotes - 542 (source: NCBI BLink).  |
AT5G54520 | AT5G54520.1 | TACACGTGGGCCTGG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G10580.1); Has 17905 Blast hits to 12742 proteins in 467 species: Archae - 38; Bacteria - 2465; Metazoa - 8443; Fungi - 2995; Plants - 1496; Viruses - 0; Other Eukaryotes - 2468 (source: NCBI BLink).  |
AT5G57590 | AT5G57590.1 | CCAGGCCCATTAG | Mutant complemented by E coli Bio A gene encoding 7,8-diaminopelargonic acid aminotransferase.  |
AT5G58420 | AT5G58420.1 | GTTTGGGCCTGG | 40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).  |
AT5G61790 | AT5G61790.1 | ATGGCCCAGGCCCAATAA | calnexin 1 (CNX1); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin, putative (TAIR:AT5G07340.1); Has 1344 Blast hits to 1252 proteins in 297 species: Archae - 2; Bacteria - 61; Metazoa - 623; Fungi - 137; Plants - 191; Viruses - 36; Other Eukaryotes - 294 (source: NCBI BLink).  |
AT5G61865 | AT5G61865.1 | TATATGGGCCTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; Has 51 Blast hits to 51 proteins in 26 species: Archae - 3; Bacteria - 6; Metazoa - 23; Fungi - 3; Plants - 4; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G61970 | AT5G61970.1 | TAAATGGGCCTGG | signal recognition particle-related / SRP-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 286 Blast hits to 286 proteins in 120 species: Archae - 2; Bacteria - 4; Metazoa - 134; Fungi - 62; Plants - 27; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |