version

Summary of AtREG621 (All List)

OrganismArabidopsis thaliana  
IDAtREG621  
SequenceTAACCGGA  
Annotation  
PPDB MotifAACCG(G/A)  overlapping GT1 box  
PLACE MotifCNGTTR  Binding site for all animal MYB and at least two plant MYB proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis; ATMYB2 is involved in regulation of genes that are responsive to water stress in Arabidopsis; A petunia MYB protein (MYB.Ph3) is involved in regulation of flavonoid biosynthesis (Solano et al. EMBO J 14:1773 (1995)); See S000355;  
Total Entry Count225  

Entry Sequences (225 entries)

LocusGene modelSequenceDescription
AT1G02160AT1G02160.1TAACCGGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02160.2TAACCGGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G03250AT1G03250.1TTAACCGGAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 29; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT1G03890AT1G03890.1TTTCCGGTTAAAcupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf, seed; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: CRA1 (CRUCIFERINA); nutrient reservoir (TAIR:AT5G44120.3); Has 691 Blast hits to 656 proteins in 126 species: Archae - 0; Bacteria - 61; Metazoa - 2; Fungi - 0; Plants - 627; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G04690AT1G04690.1CTTAACCGGAAPOTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink). 
AT1G05270AT1G05270.1ATCCGGTTAAATraB family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32340.1); Has 515 Blast hits to 497 proteins in 174 species: Archae - 89; Bacteria - 148; Metazoa - 111; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). 
AT1G05430AT1G05430.1TCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G05720AT1G05720.1ATAACCGGAselenoprotein family protein; FUNCTIONS IN: selenium binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sep15/SelM redox (InterPro:IPR014912); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT1G06515AT1G06515.1ATCCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30942.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 10; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G06650AT1G06650.1GTCCGGTTAencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase 
AT1G06650.2GTCCGGTTAencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase 
AT1G07110AT1G07110.1ATAACCGGAAEncodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. 
AT1G07110.1ATCCGGTTATEncodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. 
AT1G09140AT1G09140.1ATCCGGTTAEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. 
AT1G09140.2ATCCGGTTAEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. 
AT1G09150AT1G09150.1TAACCGGATpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink). 
AT1G09630AT1G09630.1TTTCCGGTTAAGEncodes a putative GTP-binding protein. Associates with organelles on a pathway from the Golgi to the plasma membrane in interphase. In dividing cells acts at the cell plate. 
AT1G09640AT1G09640.1CTTAACCGGAAAelongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell, pollen tube, leaf, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G57720.2); Has 6774 Blast hits to 6759 proteins in 920 species: Archae - 2; Bacteria - 2995; Metazoa - 1594; Fungi - 400; Plants - 499; Viruses - 0; Other Eukaryotes - 1284 (source: NCBI BLink). 
AT1G09840AT1G09840.1ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink). 
AT1G09840.2ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink). 
AT1G09840.3ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink). 
AT1G09840.4ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink). 
AT1G09840.5ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink). 
AT1G09840.6ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink). 
AT1G10660AT1G10660.1GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G10660.2GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G10660.3GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G10660.4GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G11190AT1G11190.1TTCCGGTTAAEncodes a bifunctional nuclease that acts on both RNA and DNA involved in nucleic acid degradation to facilitate nucleotide and phosphate recovery during senescence. It has mismatch-specific endonuclease activity with wide recognition of single base mismatches as well as the ability to cleave indel types of mismatches (heteroduplexes with loops). 
AT1G12390AT1G12390.1TTTAACCGGAAAcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT1G13350AT1G13350.1ATCCGGTTAAGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink). 
AT1G14400AT1G14400.1ACGGTTTAATTCCGGTTAubiquitin carrier protein 
AT1G14400.2ACGGTTTAATTCCGGTTAubiquitin carrier protein 
AT1G15810AT1G15810.1TAACCGGAAAAGTCAAribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink). 
AT1G16010AT1G16010.1TTCCGGTTAAmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). 
AT1G16010.2TTCCGGTTAAmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). 
AT1G16700AT1G16700.1GTCCGGTTANADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). 
AT1G17430AT1G17430.1TTTAACCGGAATTAACCGGAChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G72620.1); Has 3179 Blast hits to 3177 proteins in 659 species: Archae - 36; Bacteria - 2008; Metazoa - 134; Fungi - 8; Plants - 175; Viruses - 0; Other Eukaryotes - 818 (source: NCBI BLink). 
AT1G19330AT1G19330.1TCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G19330.2TCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G21930AT1G21930.1TTTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G42150.3); Has 24 Blast hits to 24 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G22960AT1G22960.1TTGAACCGGTCCGGTTAAGpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink). 
AT1G24265AT1G24265.1GTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G24265.2GTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G24706AT1G24706.1CTTAACCGGACCCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink). 
AT1G27060AT1G27060.1ATCCGGTTAregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: Ran GTPase binding / chromatin binding / zinc ion binding (TAIR:AT5G12350.1); Has 15042 Blast hits to 4459 proteins in 302 species: Archae - 65; Bacteria - 1621; Metazoa - 6396; Fungi - 635; Plants - 1177; Viruses - 2; Other Eukaryotes - 5146 (source: NCBI BLink). 
AT1G27100AT1G27100.1ATAACCGGATACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69900.1); Has 184 Blast hits to 118 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 8; Plants - 166; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G31730AT1G31730.1AAAACCGGATTCCGGTTAAAepsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). 
AT1G31814AT1G31814.1TTAACCGGAAfamily member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885 
AT1G42960AT1G42960.1ATAACCGGATexpressed protein localized to the inner membrane of the chloroplast. 
AT1G50380AT1G50380.1TAACCGGAAprolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink). 
AT1G51390AT1G51390.1TGGTTCGGTTAAATCCGGTTAAAEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. 
AT1G51630AT1G51630.1ATCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plant-type cell wall; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21190.1); Has 396 Blast hits to 395 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 396; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G51630.1ATCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plant-type cell wall; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21190.1); Has 396 Blast hits to 395 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 396; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G54870AT1G54870.1ATCCGGTTAbinding / catalytic/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G05260.1); Has 83077 Blast hits to 82922 proteins in 2231 species: Archae - 482; Bacteria - 45268; Metazoa - 5002; Fungi - 4212; Plants - 1573; Viruses - 5; Other Eukaryotes - 26535 (source: NCBI BLink). 
AT1G56280AT1G56280.1ATAACCGGAAEncodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal 
AT1G60380AT1G60380.1TTCCGGTTAAapical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G61900AT1G61900.1ATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G61900.2ATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G64550AT1G64550.1TTAACCGGATmember of GCN subfamily 
AT1G73060AT1G73060.1TTCCGGTTCAATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G74240AT1G74240.1TCCGGTTAmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 19112 Blast hits to 10154 proteins in 360 species: Archae - 0; Bacteria - 0; Metazoa - 9866; Fungi - 4980; Plants - 2508; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink). 
AT1G75280AT1G75280.1TTCCGGTTAAisoflavone reductase, putative, identical to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone reductase. Involved in response to oxidative stress. 
AT1G78700AT1G78700.1ATAACCGGAAAbrassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink). 
AT2G01735AT2G01735.1TAACCGGATencodes a RING-H2 zinc finger protein essential for seed development. 
AT2G04700AT2G04700.1TTCCGGTTATTTCCGGTTTGferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). 
AT2G05220AT2G05220.1TTTCCGGTTAAA40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G05220.2TTTCCGGTTAAA40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G17880AT2G17880.1CTTAACCGGACDNAJ heat shock protein, putative; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (J11) (TAIR:AT4G36040.1); Has 13518 Blast hits to 13518 proteins in 1859 species: Archae - 87; Bacteria - 4830; Metazoa - 2737; Fungi - 1089; Plants - 967; Viruses - 5; Other Eukaryotes - 3803 (source: NCBI BLink). 
AT2G18465AT2G18465.1TTAAACCGGTCCGGTTADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G42080.1); Has 685 Blast hits to 685 proteins in 152 species: Archae - 6; Bacteria - 112; Metazoa - 268; Fungi - 15; Plants - 75; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink). 
AT2G18940AT2G18940.1TTCCGGTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G02860.1); Has 28771 Blast hits to 6230 proteins in 192 species: Archae - 4; Bacteria - 37; Metazoa - 1100; Fungi - 676; Plants - 25361; Viruses - 0; Other Eukaryotes - 1593 (source: NCBI BLink). 
AT2G23080AT2G23080.1GTCCGGTTATcasein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). 
AT2G23080.2GTCCGGTTATcasein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). 
AT2G24090AT2G24090.1TAACCGGAATAAACCGAAGTAAACCGGATribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink). 
AT2G29670AT2G29670.1TCCGGTTAAbinding; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G07280.3); Has 351 Blast hits to 210 proteins in 32 species: Archae - 10; Bacteria - 88; Metazoa - 2; Fungi - 0; Plants - 203; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). 
AT2G30260AT2G30260.1TTCCGGTTAAencodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. 
AT2G30530AT2G30530.1ATAACCGGAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01970.1); Has 5828 Blast hits to 755 proteins in 128 species: Archae - 0; Bacteria - 29; Metazoa - 881; Fungi - 129; Plants - 81; Viruses - 12; Other Eukaryotes - 4696 (source: NCBI BLink). 
AT2G31340AT2G31340.1ATAACCGGAAembryo defective 1381 (emb1381); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G33840AT2G33840.1TAACCGGATtRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink). 
AT2G33855AT2G33855.1TTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G33855.1TTTAACCGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G36360AT2G36360.1ATAACCGGATkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink). 
AT2G36360.2ATAACCGGATkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink). 
AT3G02190AT3G02190.1TAACCGGAA60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G02190.1TTTCCGGTTAAA60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G02200AT3G02200.1TTCCGGTTAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT3G02200.1TTTAACCGGAAAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT3G02200.2TTCCGGTTAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT3G02200.2TTTAACCGGAAAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT3G04680AT3G04680.1TTAACCGGAAAEncodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. 
AT3G04680.2TTAACCGGAAAEncodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. 
AT3G05020AT3G05020.1ATCCGGTTAAAencodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. 
AT3G05190AT3G05190.1TTTCCGGTTATaminotransferase class IV family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544), Aminotransferase, class IV, conserved site (InterPro:IPR018300); BEST Arabidopsis thaliana protein match is: aminotransferase class IV family protein (TAIR:AT5G27410.1); Has 9097 Blast hits to 9096 proteins in 1178 species: Archae - 99; Bacteria - 4133; Metazoa - 10; Fungi - 55; Plants - 190; Viruses - 0; Other Eukaryotes - 4610 (source: NCBI BLink). 
AT3G06960AT3G06960.1ATAACCGGAAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06960.2ATAACCGGAAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G09410AT3G09410.1TTCCGGTTAAApectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G09410.3TTCCGGTTAAApectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G11400AT3G11400.1TTCCGGTTAOne of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). 
AT3G11400.2TTCCGGTTAOne of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). 
AT3G11470AT3G11470.1ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G11470.2ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G11470.3ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G12260AT3G12260.1TAACCGGAAATAATTACGcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT3G12550AT3G12550.1TCCGGTTAAXH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G48670.2); Has 23408 Blast hits to 15451 proteins in 943 species: Archae - 218; Bacteria - 2032; Metazoa - 11697; Fungi - 1231; Plants - 587; Viruses - 80; Other Eukaryotes - 7563 (source: NCBI BLink). 
AT3G12560AT3G12560.1TTAACCGGAEncodes a telomeric DNA-binding protein. 
AT3G14330AT3G14330.1TTTAACCGGAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 13083 Blast hits to 5154 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 59; Fungi - 57; Plants - 12750; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink). 
AT3G16840AT3G16840.1TTAACCGGATATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). 
AT3G16910AT3G16910.1TAACCGGAAAEncodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. 
AT3G17365AT3G17365.1TTCCGGTTATcatalytic/ methyltransferase; FUNCTIONS IN: methyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: catalytic/ methyltransferase (TAIR:AT3G60910.1); Has 889 Blast hits to 888 proteins in 188 species: Archae - 17; Bacteria - 122; Metazoa - 263; Fungi - 34; Plants - 84; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink). 
AT3G19190AT3G19190.1ATCCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT3G22970AT3G22970.1TTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G22970.2TTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G25860AT3G25860.1ATCCGGTTATNuclear encoded dihydrolipoamide S-acetyltransferase (LTA2) that encodes teh Pyruvate Decarboxylase E2 subunit. Mutant has embryo defect. 
AT3G44340AT3G44340.1ATAACCGGAThomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. 
AT3G44340.2ATAACCGGAThomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. 
AT3G46100AT3G46100.1TTTAACCGGAChistidyl-tRNA synthetase 
AT3G47340AT3G47340.1ATCCGGTTAencodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. 
AT3G47340.2ATCCGGTTAencodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. 
AT3G47340.3ATCCGGTTAencodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. 
AT3G47450AT3G47450.1TTCCGGTTATEncodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts. 
AT3G47450.2TTCCGGTTATEncodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts. 
AT3G50670AT3G50670.1ATCCGGTTAEncodes U1 snRNP 70K 
AT3G50670.2ATCCGGTTAEncodes U1 snRNP 70K 
AT3G51440AT3G51440.1GTCCGGTTAstrictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). 
AT3G53890AT3G53890.1TTCCGGTTA40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT3G53890.2TTCCGGTTA40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT3G55850AT3G55850.1TTCCGGTTATGACCGGTTEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. 
AT3G55850.1TTTCCGGTTATEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. 
AT3G57340AT3G57340.1TAACCGGAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT3G57340.2TAACCGGAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT4G03380AT4G03380.1TTTCCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: NAF1 (NUCLEAR ASSEMBLY FACTOR 1) (TAIR:AT1G03530.1); Has 13 Blast hits to 13 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G04870AT4G04870.1TTCCGGTTAAEncodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. 
AT4G05410AT4G05410.1GTCCGGTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink). 
AT4G11130AT4G11130.1TCCGGTTAEncodes RNA-dependent RNA polymerase that is required for endogenous siRNA (but not miRNA) formation. Nomenclature according to Xie, et al. (2004). 
AT4G13780AT4G13780.1CTTAACCGGATmethionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative; FUNCTIONS IN: methionine-tRNA ligase activity, tRNA binding, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, methionyl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: tRNA-binding region domain-containing protein (TAIR:AT2G40660.1); Has 12421 Blast hits to 12391 proteins in 1665 species: Archae - 324; Bacteria - 5389; Metazoa - 513; Fungi - 358; Plants - 127; Viruses - 3; Other Eukaryotes - 5707 (source: NCBI BLink). 
AT4G14270AT4G14270.1ATAACCGGATProtein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. 
AT4G14270.2ATAACCGGATProtein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. 
AT4G14880AT4G14880.1TTAACCGGACEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. 
AT4G14880.2TTAACCGGACEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. 
AT4G14960AT4G14960.1TTCCGGTTAAGEncodes an alpha-tubulin isoform required for right handed helical growth. 
AT4G14960.2TTCCGGTTAAGEncodes an alpha-tubulin isoform required for right handed helical growth. 
AT4G17310AT4G17310.1ATCCGGTTAAGunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47455.7); Has 115 Blast hits to 115 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G17310.2ATCCGGTTAAGunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47455.7); Has 115 Blast hits to 115 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18593AT4G18593.1GTCCGGTTAAACCGGdual specificity protein phosphatase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 272 Blast hits to 272 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 76; Plants - 42; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT4G19985AT4G19985.1ATAACCGGATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT4G19985.1ATAACCGGATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT4G19985.1TCCGGTTATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT4G20330AT4G20330.1TAACCGGAtranscription initiation factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIIE, beta subunit (InterPro:IPR016656), Transcription factor TFIIE beta subunit-like, DNA-binding (InterPro:IPR017935); BEST Arabidopsis thaliana protein match is: transcription initiation factor-related (TAIR:AT4G21010.1); Has 212 Blast hits to 212 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 68; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G20960AT4G20960.1TTTCCGGTTAencodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis 
AT4G25740AT4G25740.1TAACCGGAC40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). 
AT4G25740.2TAACCGGAC40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). 
AT4G26910AT4G26910.1TAACCGGAA2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink). 
AT4G26910.2TAACCGGAA2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink). 
AT4G27130AT4G27130.1ATAACCGGAAeukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT5G54760.2); Has 620 Blast hits to 617 proteins in 201 species: Archae - 6; Bacteria - 1; Metazoa - 295; Fungi - 109; Plants - 120; Viruses - 3; Other Eukaryotes - 86 (source: NCBI BLink). 
AT4G29350AT4G29350.1TTTAACCGGATEncodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression. 
AT4G29480AT4G29480.1TTTCCGGTTAmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G29810AT4G29810.1TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G29810.2TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G29810.3TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G30310AT4G30310.1ATCCGGTTATribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink). 
AT4G30310.2ATCCGGTTATribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink). 
AT4G30310.3ATCCGGTTATribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink). 
AT4G34490AT4G34490.1TAACCGGAACYCLASE ASSOCIATED PROTEIN 
AT4G39610AT4G39610.1CTTAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G21990.1); Has 140 Blast hits to 140 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G03660AT5G03660.1ATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09980.1); Has 5235 Blast hits to 3832 proteins in 426 species: Archae - 74; Bacteria - 462; Metazoa - 2482; Fungi - 239; Plants - 192; Viruses - 22; Other Eukaryotes - 1764 (source: NCBI BLink). 
AT5G03900AT5G03900.1TAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G03900.2TAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G03970AT5G03970.1ATCCGGTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G03970.2ATCCGGTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G05200AT5G05200.1TTAACCGGAAAABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink). 
AT5G05210AT5G05210.1TTTCCGGTTAAnucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). 
AT5G05210.2TTTCCGGTTAAnucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). 
AT5G06550AT5G06550.1TTCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell surface receptor linked signal transduction; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1299 Blast hits to 1289 proteins in 204 species: Archae - 0; Bacteria - 195; Metazoa - 777; Fungi - 106; Plants - 94; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). 
AT5G06580AT5G06580.1TTAACCGGAEncodes a protein with glycolate dehydrogenase activity, which was shown to complement various subunits of the E. coli glycolate oxidase complex. It has not been ruled out that the enzyme might be involved in other catalytic activities in vivo. 
AT5G06830AT5G06830.1ATAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF773 (InterPro:IPR008491); Has 301 Blast hits to 298 proteins in 82 species: Archae - 7; Bacteria - 7; Metazoa - 191; Fungi - 5; Plants - 24; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G07230AT5G07230.1TAACCGGATprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, sepal, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G62080.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G08335AT5G08335.1ATAACCGGAAEncodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development. 
AT5G08400AT5G08400.1TTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29400.1); Has 258 Blast hits to 258 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT5G08400.2TTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29400.1); Has 258 Blast hits to 258 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT5G09290AT5G09290.1TCCGGTTAT3'(2'),5'-bisphosphate nucleotidase, putative / inositol polyphosphate 1-phosphatase, putative; FUNCTIONS IN: 3'(2'),5'-bisphosphate nucleotidase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: sulfur metabolic process; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase (InterPro:IPR000760), 3(2),5 -bisphosphate nucleotidase HAL2 (InterPro:IPR006239); BEST Arabidopsis thaliana protein match is: SAL2; 3'(2'),5'-bisphosphate nucleotidase/ inositol or phosphatidylinositol phosphatase (TAIR:AT5G64000.1); Has 7391 Blast hits to 7391 proteins in 1133 species: Archae - 37; Bacteria - 3751; Metazoa - 361; Fungi - 190; Plants - 183; Viruses - 0; Other Eukaryotes - 2869 (source: NCBI BLink). 
AT5G09760AT5G09760.1CTTAACCGGACpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, chloroplast, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G64640.1); Has 1447 Blast hits to 1415 proteins in 271 species: Archae - 0; Bacteria - 416; Metazoa - 1; Fungi - 117; Plants - 911; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G12290AT5G12290.1TTAACCGGAAAEncodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. 
AT5G13280AT5G13280.1ATAACCGGAAAsp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). 
AT5G13340AT5G13340.1GTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10890.1); Has 84499 Blast hits to 39808 proteins in 1650 species: Archae - 415; Bacteria - 7950; Metazoa - 42451; Fungi - 5813; Plants - 2221; Viruses - 437; Other Eukaryotes - 25212 (source: NCBI BLink). 
AT5G13350AT5G13350.1TTAACCGGACauxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: auxin-responsive GH3 family protein (TAIR:AT5G13370.1); Has 800 Blast hits to 739 proteins in 112 species: Archae - 0; Bacteria - 240; Metazoa - 51; Fungi - 2; Plants - 218; Viruses - 0; Other Eukaryotes - 289 (source: NCBI BLink). 
AT5G15920AT5G15920.1ATAACCGGACstructural maintenance of chromosomes (SMC) family protein (MSS2); FUNCTIONS IN: ATP binding; INVOLVED IN: chromosome segregation; LOCATED IN: chromosome, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); BEST Arabidopsis thaliana protein match is: MIM (hypersensitive to MMS, irradiation and MMC); ATP binding (TAIR:AT5G61460.1); Has 53696 Blast hits to 28151 proteins in 1680 species: Archae - 715; Bacteria - 7485; Metazoa - 25639; Fungi - 3625; Plants - 1389; Viruses - 117; Other Eukaryotes - 14726 (source: NCBI BLink). 
AT5G16290AT5G16290.1GTCCGGTTATacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink). 
AT5G16290.2GTCCGGTTATacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink). 
AT5G16300AT5G16300.1TAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.1TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.2TAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.2TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.3TAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.3TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G17840AT5G17840.1CCGGTATAGTCCGGTTATchaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G24080AT5G24080.1TCCGGTTATprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT2G19130.1); Has 83012 Blast hits to 81933 proteins in 3234 species: Archae - 50; Bacteria - 7141; Metazoa - 37012; Fungi - 6145; Plants - 18411; Viruses - 299; Other Eukaryotes - 13954 (source: NCBI BLink). 
AT5G24360AT5G24360.1TTTAACCGATCCGGTTATINOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink). 
AT5G25070AT5G25070.1TTTCCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink). 
AT5G25757AT5G25757.1ATAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25754.1); Has 298 Blast hits to 292 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 59; Plants - 28; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT5G26110AT5G26110.1ATAACCGGAAATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G26110.2ATAACCGGAAATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G27270AT5G27270.1TTTAACCGGATEMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink). 
AT5G27440AT5G27440.1TTTCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27450AT5G27450.1TTTAACCGGAAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27450.2TTTAACCGGAAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27830AT5G27830.1TTTCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G27830.2TTTCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G27830.3TTTCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G35790AT5G35790.1ATCCGGTTAAGEncodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is more prevalent in developing organs but absent in the root. 
AT5G45900AT5G45900.1GTCCGGTTAAComponent of autophagy conjugation pathway. Required for proper senescence. 
AT5G48240AT5G48240.1CTTAACCGGAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). 
AT5G48240.2CTTAACCGGAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). 
AT5G48240.3CTTAACCGGAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). 
AT5G50430AT5G50430.1ATCCGGTTAAAubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink). 
AT5G50430.2ATCCGGTTAAAubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink). 
AT5G50430.3ATCCGGTTAAAubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink). 
AT5G52882AT5G52882.1ATCCGGTTAATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT4G28000.1); Has 27413 Blast hits to 25805 proteins in 1860 species: Archae - 929; Bacteria - 10210; Metazoa - 4036; Fungi - 2467; Plants - 1717; Viruses - 25; Other Eukaryotes - 8029 (source: NCBI BLink). 
AT5G52975AT5G52975.1ATAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52965.1); Has 87 Blast hits to 82 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G57270AT5G57270.1ATCCGGTTAunknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25870.1); Has 336 Blast hits to 336 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT5G57270.2ATCCGGTTAunknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25870.1); Has 336 Blast hits to 336 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT5G57270.3ATCCGGTTAunknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25870.1); Has 336 Blast hits to 336 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT5G60750AT5G60750.1GTCCGGTTAAGCAAX amino terminal protease family protein; FUNCTIONS IN: endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT1G14270.1); Has 2314 Blast hits to 2314 proteins in 559 species: Archae - 36; Bacteria - 1888; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 319 (source: NCBI BLink). 
AT5G63910AT5G63910.1ATCCGGTTAencodes for a farnesylcysteine lyase (EC 1.8.3.5 - prenylcysteine oxidase) involved in a salvage pathway of farnesyl diphosphate. 
AT5G67300AT5G67300.1CTTAACCGGTTTCCGGTTATMember of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. 
ATCG00490ATCG00490.1ATCCGGTTATlarge subunit of RUBISCO. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.