| Locus | Gene model | Sequence | Description |
| AT1G01060 | AT1G01060.1 | ATACCCTT | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01060.2 | ATACCCTT | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01060.3 | ATACCCTT | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01060.4 | ATACCCTT | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G02010 | AT1G02010.1 | TAAGGGTATT | member of KEULE Gene Family |
| AT1G02390 | AT1G02390.1 | AAGGGTATTT | Encodes a member of a family of proteins with glycerol-3-phosphate acyltransferase activity. |
| AT1G02750 | AT1G02750.1 | TAAGGGTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G03790 | AT1G03790.1 | ATACCCTT | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT1G04010 | AT1G04010.1 | TAAGGGTAT | phosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G04020 | AT1G04020.1 | ATACCCTTA | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04020.2 | ATACCCTTA | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04140 | AT1G04140.1 | TAAGGGTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G43930.3); Has 18156 Blast hits to 8656 proteins in 356 species: Archae - 50; Bacteria - 4318; Metazoa - 6686; Fungi - 3683; Plants - 1054; Viruses - 0; Other Eukaryotes - 2365 (source: NCBI BLink). |
| AT1G04140.2 | TAAGGGTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G43930.3); Has 18156 Blast hits to 8656 proteins in 356 species: Archae - 50; Bacteria - 4318; Metazoa - 6686; Fungi - 3683; Plants - 1054; Viruses - 0; Other Eukaryotes - 2365 (source: NCBI BLink). |
| AT1G05960 | AT1G05960.1 | AAGGGTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: cyclin-related (TAIR:AT2G41830.1). |
| AT1G05960.2 | AAGGGTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: cyclin-related (TAIR:AT2G41830.1). |
| AT1G06290 | AT1G06290.1 | AAGGGTATTT | Encodes an acyl-CoA oxidase with specificity for medium chain fatty acids. |
| AT1G06410 | AT1G06410.1 | AAGGGTATT | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G09740 | AT1G09740.1 | ATACCCTT | ethylene-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G11930.1); Has 2952 Blast hits to 2858 proteins in 613 species: Archae - 247; Bacteria - 2061; Metazoa - 48; Fungi - 51; Plants - 388; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G10870 | AT1G10870.1 | AAGGGTAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. |
| AT1G12000 | AT1G12000.1 | AAATACCCTT | pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT1G12440 | AT1G12440.1 | AAGGGTATTT | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G12440.2 | AAGGGTATTT | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G14840 | AT1G14840.1 | ATACCCTTA | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
| AT1G15230 | AT1G15230.1 | AATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15240 | AT1G15240.1 | TAAGGGTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1). |
| AT1G15240.2 | TAAGGGTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1). |
| AT1G16110 | AT1G16110.1 | AAGGGTAT | WAK-like kinase |
| AT1G17470 | AT1G17470.1 | ATACCCTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.2 | ATACCCTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G18800 | AT1G18800.1 | AAATACCCTT | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G19660 | AT1G19660.1 | AAGGGTAT | wound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G19660.2 | AAGGGTAT | wound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G19830 | AT1G19830.1 | ATACCCTT | auxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT1G75580.1); Has 651 Blast hits to 640 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 650; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G22410 | AT1G22410.1 | AATACCCTTA | 2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink). |
| AT1G24530 | AT1G24530.1 | AATACCCTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G24130.1); Has 34934 Blast hits to 16363 proteins in 585 species: Archae - 32; Bacteria - 4633; Metazoa - 14827; Fungi - 7171; Plants - 3064; Viruses - 0; Other Eukaryotes - 5207 (source: NCBI BLink). |
| AT1G27360 | AT1G27360.1 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.2 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.3 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.4 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G28340 | AT1G28340.1 | ATACCCTTA | Receptor Like Protein 4 (AtRLP4); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat protein-related (TAIR:AT1G25570.1); Has 46726 Blast hits to 10140 proteins in 530 species: Archae - 12; Bacteria - 1198; Metazoa - 2417; Fungi - 194; Plants - 40627; Viruses - 0; Other Eukaryotes - 2278 (source: NCBI BLink). |
| AT1G28570 | AT1G28570.1 | AAGGGTAT | GDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28580.1); Has 1842 Blast hits to 1809 proteins in 166 species: Archae - 0; Bacteria - 247; Metazoa - 1; Fungi - 4; Plants - 1579; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G28570.2 | AAGGGTAT | GDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28580.1); Has 1842 Blast hits to 1809 proteins in 166 species: Archae - 0; Bacteria - 247; Metazoa - 1; Fungi - 4; Plants - 1579; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G29150 | AT1G29150.1 | ATACCCTT | specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. |
| AT1G29418 | AT1G29418.1 | AATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT1G30880 | AT1G30880.1 | AAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G30890 | AT1G30890.1 | AATACCCTT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT1G30890.2 | AATACCCTT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT1G34030 | AT1G34030.1 | TAAGGGTAT | 40S ribosomal protein S18 (RPS18B); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding / nucleic acid binding / structural constituent of ribosome (TAIR:AT4G09800.1); Has 5326 Blast hits to 5326 proteins in 1715 species: Archae - 163; Bacteria - 2773; Metazoa - 291; Fungi - 107; Plants - 309; Viruses - 0; Other Eukaryotes - 1683 (source: NCBI BLink). |
| AT1G34350 | AT1G34350.1 | TAAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 140 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT1G48540 | AT1G48540.1 | ATACCCTT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT3G17920.1); Has 5420 Blast hits to 4081 proteins in 277 species: Archae - 0; Bacteria - 1405; Metazoa - 2734; Fungi - 311; Plants - 272; Viruses - 10; Other Eukaryotes - 688 (source: NCBI BLink). |
| AT1G48540.2 | ATACCCTT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT3G17920.1); Has 5420 Blast hits to 4081 proteins in 277 species: Archae - 0; Bacteria - 1405; Metazoa - 2734; Fungi - 311; Plants - 272; Viruses - 10; Other Eukaryotes - 688 (source: NCBI BLink). |
| AT1G51140 | AT1G51140.1 | AAGGGTATTT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42280.1); Has 1045 Blast hits to 1045 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 1030; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G55930 | AT1G55930.1 | TAAGGGTATT | CBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT3G13070.1); Has 10142 Blast hits to 10142 proteins in 1411 species: Archae - 80; Bacteria - 6182; Metazoa - 215; Fungi - 97; Plants - 96; Viruses - 0; Other Eukaryotes - 3472 (source: NCBI BLink). |
| AT1G57790 | AT1G57790.1 | TAAGGGTATTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G56470.1); Has 329 Blast hits to 324 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 329; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G60550 | AT1G60550.1 | AAGGGTATTT | ENOYL-COA HYDRATASE/ISOMERASE D (ECHID); FUNCTIONS IN: naphthoate synthase activity, catalytic activity; INVOLVED IN: vitamin K biosynthetic process, metabolic process, menaquinone biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Enoyl-CoA hydratase/isomerase, conserved site (InterPro:IPR018376), Naphthoate synthase (InterPro:IPR010198), Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHIA (ENOYL-COA HYDRATASE/ISOMERASE A); catalytic (TAIR:AT4G16210.1); Has 24987 Blast hits to 24986 proteins in 1283 species: Archae - 197; Bacteria - 14016; Metazoa - 1333; Fungi - 490; Plants - 307; Viruses - 0; Other Eukaryotes - 8644 (source: NCBI BLink). |
| AT1G61010 | AT1G61010.1 | AAGGGTATTT | CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). |
| AT1G61010.2 | AAGGGTATTT | CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). |
| AT1G61010.3 | AAGGGTATTT | CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). |
| AT1G61780 | AT1G61780.1 | AAGGGTATTTGCCGTTTACCGGAAA | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G61800 | AT1G61800.1 | AAGGGTAT | glucose6-Phosphate/phosphate transporter 2 |
| AT1G64142 | AT1G64142.1 | AAGGGTAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF23 represents a conserved upstream opening reading frame relative to major ORF AT1G64140.1 |
| AT1G66070 | AT1G66070.1 | AATACCCTT | translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor eIF3 subunit (InterPro:IPR013906); BEST Arabidopsis thaliana protein match is: translation initiation factor-related (TAIR:AT5G37475.1); Has 336 Blast hits to 334 proteins in 124 species: Archae - 2; Bacteria - 9; Metazoa - 148; Fungi - 90; Plants - 45; Viruses - 1; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G67620 | AT1G67620.1 | TAAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 3104 Blast hits to 3104 proteins in 983 species: Archae - 0; Bacteria - 1779; Metazoa - 74; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT1G68340 | AT1G68340.1 | AAATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 137 Blast hits to 137 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G68400 | AT1G68400.1 | AAGGGTAT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G26730.1); Has 109181 Blast hits to 85983 proteins in 3222 species: Archae - 64; Bacteria - 9468; Metazoa - 37963; Fungi - 6180; Plants - 40805; Viruses - 358; Other Eukaryotes - 14343 (source: NCBI BLink). |
| AT1G71780 | AT1G71780.1 | ATACCCTTTAGGCCCATCATAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72160 | AT1G72160.1 | ATACCCTT | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 3452 Blast hits to 2934 proteins in 279 species: Archae - 35; Bacteria - 208; Metazoa - 1309; Fungi - 627; Plants - 480; Viruses - 12; Other Eukaryotes - 781 (source: NCBI BLink). |
| AT1G72230 | AT1G72230.1 | ATACCCTT | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972), Blue (type 1) copper domain (InterPro:IPR000923); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT1G22480.1); Has 791 Blast hits to 784 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 786; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G74510 | AT1G74510.1 | AAATACCCTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink). |
| AT1G74510.2 | AAATACCCTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink). |
| AT1G74560 | AT1G74560.1 | ATACCCTTA | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G74560.2 | ATACCCTTA | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G74560.3 | ATACCCTTA | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G75280 | AT1G75280.1 | TAAGGGTATT | isoflavone reductase, putative, identical to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone reductase. Involved in response to oxidative stress. |
| AT1G76480 | AT1G76480.1 | TAAGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20890.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76550 | AT1G76550.1 | TAAGGGTAT | pyrophosphate--fructose-6-phosphate 1-phosphotransferase alpha subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, alpha-subunit complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: pyrophosphate--fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-related (TAIR:AT1G20950.1); Has 2719 Blast hits to 2653 proteins in 853 species: Archae - 15; Bacteria - 1820; Metazoa - 8; Fungi - 4; Plants - 258; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). |
| AT1G77590 | AT1G77590.1 | ATACCCTT | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
| AT1G78570 | AT1G78570.1 | AAGGGTATTT | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in <i>E. coli</i>. |
| AT2G02230 | AT2G02230.1 | TAAGGGTATT | Phloem protein 2-B1 (AtPP2-B1); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: MEE66 (maternal effect embryo arrest 66) (TAIR:AT2G02240.1); Has 319 Blast hits to 306 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 319; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02960 | AT2G02960.1 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.2 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.3 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.4 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.5 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G05840 | AT2G05840.1 | AAGGGTATTT | Encodes 20S proteasome subunit PAA2 (PAA2). |
| AT2G05840.2 | AAGGGTATTT | Encodes 20S proteasome subunit PAA2 (PAA2). |
| AT2G18770 | AT2G18770.1 | AAATACCCTT | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT5G05670.2); Has 734 Blast hits to 734 proteins in 177 species: Archae - 2; Bacteria - 55; Metazoa - 350; Fungi - 108; Plants - 88; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT2G22000 | AT2G22000.1 | AAGGGTATTT | Elicitor peptide 6 precursor (PROPEP6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 10 Blast hits to 10 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G22670 | AT2G22670.1 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G22670.2 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G22670.3 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G24240 | AT2G24240.1 | AATACCCTT | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT4G30940.1); Has 748 Blast hits to 733 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 614; Fungi - 2; Plants - 67; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). |
| AT2G26140 | AT2G26140.1 | AAGGGTATTT | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G28790 | AT2G28790.1 | AAGGGTATTT | osmotin-like protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1026 Blast hits to 1010 proteins in 136 species: Archae - 0; Bacteria - 12; Metazoa - 47; Fungi - 55; Plants - 906; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT2G29530 | AT2G29530.1 | ATACCCTT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT2G29530.2 | ATACCCTT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT2G29530.3 | ATACCCTT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT2G29540 | AT2G29540.1 | AAGGGTAT | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT2G29540.2 | AAGGGTAT | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT2G29540.3 | AAGGGTAT | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT2G30360 | AT2G30360.1 | ATACCCTTA | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT2G35020 | AT2G35020.1 | AAGGGTATT | UTP--glucose-1-phosphate uridylyltransferase family protein; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); BEST Arabidopsis thaliana protein match is: UDP-N-acetylglucosamine pyrophosphorylase-related (TAIR:AT1G31070.2); Has 1002 Blast hits to 999 proteins in 241 species: Archae - 0; Bacteria - 147; Metazoa - 371; Fungi - 175; Plants - 144; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT2G38300 | AT2G38300.1 | TAAGGGTAT | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.10 ten leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT2G40260.1); Has 922 Blast hits to 920 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 4; Plants - 867; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT2G39780 | AT2G39780.1 | AAATACCCTTA | S-like ribonuclease |
| AT2G39780.2 | AAATACCCTTA | S-like ribonuclease |
| AT2G43710 | AT2G43710.1 | AAGGGTATTT | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. |
| AT2G43710.2 | AAGGGTATTT | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. |
| AT2G45720 | AT2G45720.1 | AAGGGTATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT1G01830.3); Has 1636 Blast hits to 1049 proteins in 150 species: Archae - 2; Bacteria - 16; Metazoa - 365; Fungi - 196; Plants - 864; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G45720.2 | AAGGGTATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT1G01830.3); Has 1636 Blast hits to 1049 proteins in 150 species: Archae - 2; Bacteria - 16; Metazoa - 365; Fungi - 196; Plants - 864; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G47030 | AT2G47030.1 | AAATACCCTTA | VGDH1; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: male gametophyte, flower, pollen tube; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: VGD1 (VANGUARD1); enzyme inhibitor/ pectinesterase (TAIR:AT2G47040.1); Has 1439 Blast hits to 1399 proteins in 267 species: Archae - 0; Bacteria - 422; Metazoa - 1; Fungi - 130; Plants - 885; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G47610 | AT2G47610.1 | TAAGGGTAT | 60S ribosomal protein L7A (RPL7aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aB) (TAIR:AT3G62870.1); Has 1594 Blast hits to 1594 proteins in 293 species: Archae - 217; Bacteria - 0; Metazoa - 627; Fungi - 243; Plants - 175; Viruses - 0; Other Eukaryotes - 332 (source: NCBI BLink). |
| AT3G01570 | AT3G01570.1 | TAAGGGTAT | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G05010 | AT3G05010.1 | AATACCCTT | transmembrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, transmembrane-40 (InterPro:IPR018781); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27210.1); Has 103 Blast hits to 103 proteins in 34 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G06670 | AT3G06670.1 | TAAGGGTATT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT3G09720 | AT3G09720.1 | AATACCCTTA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink). |
| AT3G10650 | AT3G10650.1 | ATACCCTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: nucleoporin-related (TAIR:AT5G20200.1); Has 51621 Blast hits to 25162 proteins in 1378 species: Archae - 161; Bacteria - 11485; Metazoa - 15659; Fungi - 10121; Plants - 1099; Viruses - 600; Other Eukaryotes - 12496 (source: NCBI BLink). |
| AT3G12610 | AT3G12610.1 | AAGGGTAT | Plays role in DNA-damage repair/toleration. Partially complements RecA- phenotypes. |
| AT3G14050 | AT3G14050.1 | AAGGGTATTT | RELA-SPOT HOMOLOG 2 (RSH2); FUNCTIONS IN: GTP diphosphokinase activity; INVOLVED IN: response to abscisic acid stimulus, response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8188 Blast hits to 8061 proteins in 1323 species: Archae - 2; Bacteria - 4464; Metazoa - 186; Fungi - 38; Plants - 129; Viruses - 2; Other Eukaryotes - 3367 (source: NCBI BLink). |
| AT3G14172 | AT3G14172.1 | AAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink). |
| AT3G14230 | AT3G14230.1 | TAAGGGTAT | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G14230.2 | TAAGGGTAT | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G14230.3 | TAAGGGTAT | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G15380 | AT3G15380.1 | AAATACCCTT | choline transporter-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF580 (InterPro:IPR007603); BEST Arabidopsis thaliana protein match is: choline transporter-related (TAIR:AT4G38640.1); Has 687 Blast hits to 679 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 406; Fungi - 83; Plants - 66; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT3G15620 | AT3G15620.1 | AAATACCCTTA | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT3G15620.2 | AAATACCCTTA | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT3G15630 | AT3G15630.1 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52720.1); Has 35 Blast hits to 35 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G16175 | AT3G16175.1 | AAGGGTAT | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52191.1); Has 207 Blast hits to 207 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 96; Fungi - 4; Plants - 99; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G17330 | AT3G17330.1 | AAGGGTATTT | evolutionarily conserved C-terminal region 6 (ECT6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT7 (evolutionarily conserved C-terminal region 7) (TAIR:AT1G48110.2); Has 715 Blast hits to 696 proteins in 119 species: Archae - 0; Bacteria - 2; Metazoa - 345; Fungi - 82; Plants - 210; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT3G19790 | AT3G19790.1 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G19790.2 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G20670 | AT3G20670.1 | AAGGGTATTT | Encodes HTA13, a histone H2A protein. |
| AT3G23230 | AT3G23230.1 | AAGGGTATT | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G23880 | AT3G23880.1 | ATACCCTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G06240.1); Has 1320 Blast hits to 1317 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1318; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G25800 | AT3G25800.1 | AAGGGTAT | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G25800.2 | AAGGGTAT | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G27060 | AT3G27060.1 | AATACCCTT | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G27060.1 | TGTCGTTTATACCCTTA | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G50120 | AT3G50120.1 | AAGGGTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, leaf apex, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF247, plant (InterPro:IPR004158); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50170.1); Has 535 Blast hits to 475 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 535; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52340 | AT3G52340.1 | AAGGGTATT | sucrose-phosphatase (SPP2) |
| AT3G52340.2 | AAGGGTATT | sucrose-phosphatase (SPP2) |
| AT3G52340.3 | AAGGGTATT | sucrose-phosphatase (SPP2) |
| AT3G53890 | AT3G53890.1 | AAGGGTAT | 40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT3G53890.2 | AAGGGTAT | 40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT3G56200 | AT3G56200.1 | AAGGGTATTT | Encodes a putative amino acid transporter. |
| AT3G56590 | AT3G56590.1 | ATACCCTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G10810.1); Has 14277 Blast hits to 9531 proteins in 665 species: Archae - 26; Bacteria - 1625; Metazoa - 4928; Fungi - 2262; Plants - 3165; Viruses - 515; Other Eukaryotes - 1756 (source: NCBI BLink). |
| AT3G56590.2 | ATACCCTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G10810.1); Has 14277 Blast hits to 9531 proteins in 665 species: Archae - 26; Bacteria - 1625; Metazoa - 4928; Fungi - 2262; Plants - 3165; Viruses - 515; Other Eukaryotes - 1756 (source: NCBI BLink). |
| AT3G59500 | AT3G59500.1 | ATACCCTT | integral membrane HRF1 family protein; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT1G30890.2); Has 337 Blast hits to 337 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 90; Plants - 38; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT3G59540 | AT3G59540.1 | AAATACCCTT | 60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G59660 | AT3G59660.1 | AAGGGTATTT | C2 domain-containing protein / GRAM domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), GRAM (InterPro:IPR004182), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: VAD1 (VASCULAR ASSOCIATED DEATH1) (TAIR:AT1G02120.1); Has 2203 Blast hits to 1975 proteins in 157 species: Archae - 0; Bacteria - 0; Metazoa - 1394; Fungi - 230; Plants - 395; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G60860 | AT3G60860.1 | AAGGGTATTT | guanine nucleotide exchange family protein; FUNCTIONS IN: binding, ARF guanyl-nucleotide exchange factor activity, guanyl-nucleotide exchange factor activity; INVOLVED IN: regulation of ARF protein signal transduction; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SEC7-like (InterPro:IPR000904), Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF1981, SEC7 associated (InterPro:IPR015403); BEST Arabidopsis thaliana protein match is: EDA10 (embryo sac development arrest 10); ARF guanyl-nucleotide exchange factor/ binding / guanyl-nucleotide exchange factor (TAIR:AT1G01960.1); Has 2220 Blast hits to 2027 proteins in 177 species: Archae - 0; Bacteria - 24; Metazoa - 1229; Fungi - 446; Plants - 144; Viruses - 0; Other Eukaryotes - 377 (source: NCBI BLink). |
| AT3G61160 | AT3G61160.1 | TAAGGGTAT | shaggy-related protein kinase beta / ASK-beta (ASK2); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK32 (SHAGGY-LIKE PROTEIN KINASE 32); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G00720.1); Has 77717 Blast hits to 76780 proteins in 2266 species: Archae - 34; Bacteria - 5889; Metazoa - 33698; Fungi - 7803; Plants - 14511; Viruses - 397; Other Eukaryotes - 15385 (source: NCBI BLink). |
| AT3G61160.2 | TAAGGGTAT | shaggy-related protein kinase beta / ASK-beta (ASK2); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK32 (SHAGGY-LIKE PROTEIN KINASE 32); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G00720.1); Has 77717 Blast hits to 76780 proteins in 2266 species: Archae - 34; Bacteria - 5889; Metazoa - 33698; Fungi - 7803; Plants - 14511; Viruses - 397; Other Eukaryotes - 15385 (source: NCBI BLink). |
| AT4G02715 | AT4G02715.1 | AAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 22 Blast hits to 22 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G03180 | AT4G03180.1 | TAAGGGTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 869 Blast hits to 650 proteins in 112 species: Archae - 2; Bacteria - 20; Metazoa - 199; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 516 (source: NCBI BLink). |
| AT4G04020 | AT4G04020.1 | TAAGGGTAT | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. |
| AT4G08960 | AT4G08960.1 | TAAGGGTAT | phosphotyrosyl phosphatase activator (PTPA) family protein; FUNCTIONS IN: phosphatase activator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphotyrosyl phosphatase activator, PTPA (InterPro:IPR004327); Has 593 Blast hits to 585 proteins in 175 species: Archae - 0; Bacteria - 4; Metazoa - 247; Fungi - 211; Plants - 54; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G09000 | AT4G09000.1 | AAATACCCTT | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | AAATACCCTT | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G10310 | AT4G10310.1 | AAATACCCTT | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT4G10925 | AT4G10925.1 | AATACCCTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G10925.2 | AATACCCTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G12420 | AT4G12420.1 | ATACCCTTA | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT4G13100 | AT4G13100.1 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, calmodulin binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G25030.2); Has 401 Blast hits to 397 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 12; Plants - 97; Viruses - 14; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G13100.3 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, calmodulin binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G25030.2); Has 401 Blast hits to 397 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 12; Plants - 97; Viruses - 14; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G13830 | AT4G13830.1 | AAATACCCTT | DnaJ-like protein (J20); nuclear gene |
| AT4G13830.2 | AAATACCCTT | DnaJ-like protein (J20); nuclear gene |
| AT4G16070 | AT4G16070.1 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity, carboxylesterase activity; INVOLVED IN: lipid catabolic process, lipid metabolic process; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G14075.1); Has 2035 Blast hits to 1241 proteins in 172 species: Archae - 0; Bacteria - 55; Metazoa - 1126; Fungi - 205; Plants - 189; Viruses - 42; Other Eukaryotes - 418 (source: NCBI BLink). |
| AT4G16410 | AT4G16410.1 | AAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF751 (InterPro:IPR008470); Has 136 Blast hits to 136 proteins in 35 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT4G23330 | AT4G23330.1 | AAGGGTATT | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: EIF3A (EUKARYOTIC TRANSLATION INITIATION FACTOR 3A); translation initiation factor (TAIR:AT4G11420.1); Has 31 Blast hits to 25 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25520 | AT4G25520.1 | ATACCCTT | SEUSS-LIKE 1 (SLK1); FUNCTIONS IN: transcription regulator activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: SLK3 (SEUSS-LIKE 3); transcription regulator (TAIR:AT4G25515.1); Has 16774 Blast hits to 7715 proteins in 383 species: Archae - 0; Bacteria - 502; Metazoa - 5522; Fungi - 1321; Plants - 618; Viruses - 192; Other Eukaryotes - 8619 (source: NCBI BLink). |
| AT4G26860 | AT4G26860.1 | CGTTTTGAAAGGGTAT | pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: alanine racemase family protein (TAIR:AT1G11930.2); Has 5001 Blast hits to 5001 proteins in 1281 species: Archae - 14; Bacteria - 2219; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT4G27260 | AT4G27260.1 | ATACCCTT | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT4G27440 | AT4G27440.1 | AAGGGTAT | light-dependent NADPH:protochlorophyllide oxidoreductase B |
| AT4G27440.2 | AAGGGTAT | light-dependent NADPH:protochlorophyllide oxidoreductase B |
| AT4G30960 | AT4G30960.1 | TAAGGGTAT | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. |
| AT4G31990 | AT4G31990.1 | AAGGGTATT | encodes a plastid-localized aspartate aminotransferase |
| AT4G31990.2 | AAGGGTATT | encodes a plastid-localized aspartate aminotransferase |
| AT4G31990.3 | AAGGGTATT | encodes a plastid-localized aspartate aminotransferase |
| AT4G32030 | AT4G32030.1 | ATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 35 Blast hits to 33 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G32030.2 | ATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 35 Blast hits to 33 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G32350 | AT4G32350.1 | AAATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79910.1); Has 2466 Blast hits to 1931 proteins in 180 species: Archae - 0; Bacteria - 43; Metazoa - 915; Fungi - 124; Plants - 233; Viruses - 5; Other Eukaryotes - 1146 (source: NCBI BLink). |
| AT4G34730 | AT4G34730.1 | ATACCCTTA | ribosome-binding factor A family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K homology-like, alpha/beta (InterPro:IPR015946), Ribosome-binding factor A (InterPro:IPR000238); Has 2908 Blast hits to 2907 proteins in 1057 species: Archae - 0; Bacteria - 2230; Metazoa - 5; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 649 (source: NCBI BLink). |
| AT4G37420 | AT4G37420.1 | TAAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27200.1); Has 141 Blast hits to 141 proteins in 46 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT4G38240 | AT4G38240.1 | TAAGGGTAT | Encodes N-acetyl glucosaminyl transferase I, the first enzyme in the pathway of complex glycan biosynthesis. |
| AT4G38240.2 | TAAGGGTAT | Encodes N-acetyl glucosaminyl transferase I, the first enzyme in the pathway of complex glycan biosynthesis. |
| AT4G38620 | AT4G38620.1 | ATACCCTT | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. |
| AT4G38680 | AT4G38680.1 | ATACCCTT | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT4G38920 | AT4G38920.1 | ATACCCTT | VACUOLAR-TYPE H(+)-ATPASE C3 (ATVHA-C3); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: AVA-P1; ATPase/ proton-transporting ATPase, rotational mechanism (TAIR:AT4G34720.1); Has 1818 Blast hits to 1637 proteins in 400 species: Archae - 127; Bacteria - 312; Metazoa - 519; Fungi - 315; Plants - 225; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). |
| AT4G39950 | AT4G39950.1 | TAAGGGTATT | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT5G02760 | AT5G02760.1 | TTTGACCCATACCCTT | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3788 Blast hits to 3786 proteins in 222 species: Archae - 2; Bacteria - 8; Metazoa - 1298; Fungi - 398; Plants - 1308; Viruses - 2; Other Eukaryotes - 772 (source: NCBI BLink). |
| AT5G02870 | AT5G02870.1 | AATACCCTT | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT5G02870.2 | AATACCCTT | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT5G04050 | AT5G04050.1 | ATACCCTT | FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: intron maturase, type II family protein (TAIR:AT1G74350.1). |
| AT5G04050.2 | ATACCCTT | FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: intron maturase, type II family protein (TAIR:AT1G74350.1). |
| AT5G04140 | AT5G04140.1 | AAATACCCTT | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04140.2 | AAATACCCTT | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G05200 | AT5G05200.1 | TAAGGGTATTT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink). |
| AT5G05210 | AT5G05210.1 | AAATACCCTTA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G05210.2 | AAATACCCTTA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G09540 | AT5G09540.1 | AAATACCCTTA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding, response to salt stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G64360.4); Has 752 Blast hits to 732 proteins in 227 species: Archae - 8; Bacteria - 304; Metazoa - 100; Fungi - 51; Plants - 254; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G12190 | AT5G12190.1 | ATACCCTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G14870.1); Has 4144 Blast hits to 3915 proteins in 315 species: Archae - 0; Bacteria - 181; Metazoa - 2335; Fungi - 721; Plants - 421; Viruses - 0; Other Eukaryotes - 486 (source: NCBI BLink). |
| AT5G14910 | AT5G14910.1 | AAGGGTATTT | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18630 | AT5G18630.1 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G18630.2 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G18630.3 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G19060 | AT5G19060.1 | AAGGGTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G06150.1); Has 19 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G19380 | AT5G19380.1 | AAATACCCTT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G19380.2 | AAATACCCTT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G22840 | AT5G22840.1 | ATACCCTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase-related (TAIR:AT3G44850.1); Has 30632 Blast hits to 23585 proteins in 791 species: Archae - 4; Bacteria - 858; Metazoa - 13844; Fungi - 4830; Plants - 4193; Viruses - 23; Other Eukaryotes - 6880 (source: NCBI BLink). |
| AT5G27740 | AT5G27740.1 | AATACCCTTA | EMBRYO DEFECTIVE 2775 (EMB2775); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding; INVOLVED IN: DNA replication; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: emb1968 (embryo defective 1968); ATP binding / ATPase/ DNA binding / DNA clamp loader/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G21690.1); Has 8053 Blast hits to 8003 proteins in 1440 species: Archae - 377; Bacteria - 2705; Metazoa - 463; Fungi - 373; Plants - 162; Viruses - 67; Other Eukaryotes - 3906 (source: NCBI BLink). |
| AT5G39400 | AT5G39400.1 | ATACCCTTA | PTEN1; FUNCTIONS IN: phosphatase activity; INVOLVED IN: N-terminal protein myristoylation, pollen development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN2 (ARABIDOPSIS THALIANA PTEN 2); phosphatase/ protein tyrosine phosphatase (TAIR:AT3G19420.1); Has 1145 Blast hits to 1141 proteins in 148 species: Archae - 6; Bacteria - 19; Metazoa - 735; Fungi - 150; Plants - 35; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). |
| AT5G40710 | AT5G40710.1 | AAGGGTAT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT5G63280.1); Has 79 Blast hits to 77 proteins in 32 species: Archae - 0; Bacteria - 2; Metazoa - 42; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G46440 | AT5G46440.1 | GGCCTAAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46460.1); Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G46790 | AT5G46790.1 | ATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17870.1); Has 179 Blast hits to 179 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 178; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G47120 | AT5G47120.1 | TAAGGGTATT | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. |
| AT5G54250 | AT5G54250.1 | AAGGGTAT | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT5G54250.2 | AAGGGTAT | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT5G55640 | AT5G55640.1 | TAAGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57050 | AT5G57050.1 | AAATACCCTT | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT5G57050.2 | AAATACCCTT | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT5G58787 | AT5G58787.1 | AAGGGTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 957 Blast hits to 956 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 440; Fungi - 36; Plants - 203; Viruses - 88; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT5G58787.2 | AAGGGTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 957 Blast hits to 956 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 440; Fungi - 36; Plants - 203; Viruses - 88; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT5G60160 | AT5G60160.1 | AAGGGTATTT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT5G61060 | AT5G61060.1 | ATACCCTT | Encodes a member of the histone deacetylase family. |
| AT5G63310 | AT5G63310.1 | AAGGGTATTT | Maintains intracellular dNTP levels except ATP. Plays a role in response to oxidative stress and UV. Involved in phytochrome-mediated light signaling. Participates in auxin-regulated processes, partly through the modulation of auxin transport. H-bonding with His-197 inside the nucleotide-binding pocket is critical for NDPK2 functioning. |
| AT5G63770 | AT5G63770.1 | AAGGGTAT | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
| AT5G63810 | AT5G63810.1 | AAGGGTATTT | member of Glycoside Hydrolase Family 35 |
| AT5G65830 | AT5G65830.1 | AATACCCTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP44 (Receptor Like Protein 44); protein binding (TAIR:AT3G49750.1); Has 35662 Blast hits to 8354 proteins in 444 species: Archae - 26; Bacteria - 823; Metazoa - 1315; Fungi - 106; Plants - 31516; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink). |
| AT5G65950 | AT5G65950.1 | ATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G66500 | AT5G66500.1 | ATACCCTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, cauline leaf, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G13600.1); Has 10819 Blast hits to 4139 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 15; Plants - 10655; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| ATCG00270 | ATCG00270.1 | AAGGGTAT | PSII D2 protein |