| Locus | Gene model | Sequence | Description |
| AT1G01010 | AT1G01010.1 | AAACGCTG | Arabidopsis NAC domain containing protein 1 (ANAC001); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac069 (Arabidopsis NAC domain containing protein 69); transcription factor (TAIR:AT4G01550.1); Has 1331 Blast hits to 1329 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1331; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01650 | AT1G01650.1 | CAGCGTTTTA | aspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT1G06145 | AT1G06145.1 | AAACGCTG | EMBRYO DEFECTIVE 1444 (EMB1444); INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 13972 Blast hits to 5050 proteins in 152 species: Archae - 1; Bacteria - 4; Metazoa - 54; Fungi - 73; Plants - 13519; Viruses - 0; Other Eukaryotes - 321 (source: NCBI BLink). |
| AT1G07930 | AT1G07930.1 | CAGCGTTT | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink). |
| AT1G07930.2 | CAGCGTTT | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink). |
| AT1G09850 | AT1G09850.1 | CAGCGTTTTG | Arabidopsis thaliana papain-like cysteine peptidase |
| AT1G11960 | AT1G11960.1 | CAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT1G62320.1); Has 746 Blast hits to 706 proteins in 111 species: Archae - 0; Bacteria - 4; Metazoa - 131; Fungi - 370; Plants - 224; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G12990 | AT1G12990.1 | AAACGCTG | glycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT1G13820 | AT1G13820.1 | CAGCGTTTTA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G39220.1); Has 5140 Blast hits to 5134 proteins in 762 species: Archae - 39; Bacteria - 3125; Metazoa - 236; Fungi - 50; Plants - 322; Viruses - 0; Other Eukaryotes - 1368 (source: NCBI BLink). |
| AT1G13970 | AT1G13970.1 | TAAAACGCTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29180.1); Has 129 Blast hits to 129 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 114; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G14590 | AT1G14590.1 | CGCAGCGTTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14590.1 | CGCAGCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14590.1 | CGCAGCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14685 | AT1G14685.1 | AAACGCTG | Arabidopsis GBP Basic Penta Cysteine 1 |
| AT1G14685.2 | AAACGCTG | Arabidopsis GBP Basic Penta Cysteine 1 |
| AT1G14685.3 | AAACGCTG | Arabidopsis GBP Basic Penta Cysteine 1 |
| AT1G17470 | AT1G17470.1 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.1 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.2 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.2 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G18950 | AT1G18950.1 | AAAACGACAGCGTTT | aminoacyl-tRNA synthetase family; FUNCTIONS IN: aminoacyl-tRNA ligase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25580.1); Has 20587 Blast hits to 12449 proteins in 605 species: Archae - 33; Bacteria - 1436; Metazoa - 9619; Fungi - 2230; Plants - 832; Viruses - 219; Other Eukaryotes - 6218 (source: NCBI BLink). |
| AT1G21500 | AT1G21500.1 | CGCAGCGTTT | unknown protein; LOCATED IN: 1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22860 | AT1G22860.1 | TAAACGACAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 284 Blast hits to 266 proteins in 98 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G27360 | AT1G27360.1 | AAACGCTG | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.2 | AAACGCTG | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.3 | AAACGCTG | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.4 | AAACGCTG | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27600 | AT1G27600.1 | CAGCGTTT | glycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G27600.2 | CAGCGTTT | glycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G29700 | AT1G29700.1 | CGCAGCGTTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 321 Blast hits to 321 proteins in 85 species: Archae - 0; Bacteria - 142; Metazoa - 0; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G30810 | AT1G30810.1 | AAACGCTG | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), FY-rich, C-terminal subgroup (InterPro:IPR018516), Transcription factor jumonji (InterPro:IPR013129), FY-rich, N-terminal subgroup (InterPro:IPR018518); BEST Arabidopsis thaliana protein match is: MEE27 (maternal effect embryo arrest 27); transcription factor (TAIR:AT2G34880.1); Has 1543 Blast hits to 1140 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 960; Fungi - 297; Plants - 152; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink). |
| AT1G32530 | AT1G32530.1 | TAAAACGCTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). |
| AT1G53850 | AT1G53850.1 | AAACGCTGCG | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G53850.2 | AAACGCTGCG | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G62600 | AT1G62600.1 | TAAAACGCAGCGTTT | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). |
| AT1G67960 | AT1G67960.1 | CAGCGTTTTG | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT1G69390 | AT1G69390.1 | GCCTTTAAACGACAGCGTTT | Encodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery. |
| AT1G69390.1 | TAAAACGCTG | Encodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery. |
| AT1G71900 | AT1G71900.1 | CAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT1G34470.1); Has 875 Blast hits to 858 proteins in 150 species: Archae - 0; Bacteria - 55; Metazoa - 361; Fungi - 238; Plants - 146; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT1G74240 | AT1G74240.1 | AAACGCTG | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 19112 Blast hits to 10154 proteins in 360 species: Archae - 0; Bacteria - 0; Metazoa - 9866; Fungi - 4980; Plants - 2508; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink). |
| AT1G75670 | AT1G75670.1 | CAGCGTTT | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G75670.2 | CAGCGTTT | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G79790 | AT1G79790.1 | AAACGCTGCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT1G79790.2 | AAACGCTGCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT1G80790 | AT1G80790.1 | CAGCGTTT | XH/XS domain-containing protein / XS zinc finger domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT1G15910.1); Has 67806 Blast hits to 38036 proteins in 1354 species: Archae - 728; Bacteria - 6143; Metazoa - 32571; Fungi - 3879; Plants - 1839; Viruses - 312; Other Eukaryotes - 22334 (source: NCBI BLink). |
| AT2G04350 | AT2G04350.1 | CAGCGTTT | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G04350.2 | CAGCGTTT | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G20260 | AT2G20260.1 | AAACGCTG | Encodes subunit E of photosystem I. |
| AT2G20770 | AT2G20770.1 | AAACGCTG | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT2G21160 | AT2G21160.1 | CAAAACGCTGTCGTTTT | translocon-associated protein alpha (TRAP alpha) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated protein (TRAP), alpha subunit (InterPro:IPR005595); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16595.1); Has 195 Blast hits to 195 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT2G21160.2 | CAAAACGCTGTCGTTTT | translocon-associated protein alpha (TRAP alpha) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated protein (TRAP), alpha subunit (InterPro:IPR005595); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16595.1); Has 195 Blast hits to 195 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT2G21640 | AT2G21640.1 | TAAAACGCTGCG | Encodes a protein of unknown function that is a marker for oxidative stress response. |
| AT2G25950 | AT2G25950.1 | AAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1000 (InterPro:IPR010400); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04780.1); Has 429 Blast hits to 429 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 205; Fungi - 104; Plants - 50; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT2G25950.1 | CAAAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1000 (InterPro:IPR010400); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04780.1); Has 429 Blast hits to 429 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 205; Fungi - 104; Plants - 50; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT2G32060 | AT2G32060.1 | AAACGACAGCGTTT | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32060.2 | AAACGACAGCGTTT | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32060.3 | AAACGACAGCGTTT | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G36885 | AT2G36885.1 | AAAACGGCAGCGTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G36885.2 | AAAACGGCAGCGTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G36895 | AT2G36895.1 | CAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36895.2 | CAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G37400 | AT2G37400.1 | CAGCGTTTTGA | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink). |
| AT2G46060 | AT2G46060.1 | TAAAACGCTG | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G46060.2 | TAAAACGCTG | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G46280 | AT2G46280.1 | AAACGCTG | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G46280.2 | AAACGCTG | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G46280.3 | AAACGCTG | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G47840 | AT2G47840.1 | AAAACGGCAGCGTTT | tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT3G02200 | AT3G02200.1 | CAGCGTTT | proteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT3G02200.2 | CAGCGTTT | proteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT3G04830 | AT3G04830.1 | TAAAACGCAGCGTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G04830.2 | TAAAACGCAGCGTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G04950 | AT3G04950.1 | AAACGCTGCG | unknown protein; Has 344 Blast hits to 344 proteins in 131 species: Archae - 0; Bacteria - 268; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT3G05410 | AT3G05410.1 | AAACGCTG | calcium ion binding; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: oxygen evolving complex, extrinsic to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: PPL1 (PsbP-like protein 1); calcium ion binding (TAIR:AT3G55330.1). |
| AT3G05410.2 | AAACGCTG | calcium ion binding; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: oxygen evolving complex, extrinsic to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: PPL1 (PsbP-like protein 1); calcium ion binding (TAIR:AT3G55330.1). |
| AT3G06310 | AT3G06310.1 | TCAAAACGCAGCGTTT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06310.2 | TCAAAACGCAGCGTTT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06320 | AT3G06320.1 | AAACGCTGCGTTTTGA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G07020 | AT3G07020.1 | CAGCGTTTTA | UDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G07020.2 | CAGCGTTTTA | UDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G10070 | AT3G10070.1 | AAACGCTGCGTTTTA | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. |
| AT3G11830 | AT3G11830.1 | TAAAACGCTGCGTTTTA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, eta subunit (InterPro:IPR012720), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: ATTCP-1; ATP binding / protein binding / unfolded protein binding (TAIR:AT3G20050.1); Has 14866 Blast hits to 14802 proteins in 2423 species: Archae - 394; Bacteria - 5781; Metazoa - 1895; Fungi - 1006; Plants - 468; Viruses - 0; Other Eukaryotes - 5322 (source: NCBI BLink). |
| AT3G12280 | AT3G12280.1 | CAGCGTTT | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. |
| AT3G12290 | AT3G12290.1 | AAACGCTG | tetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00620.1); Has 7113 Blast hits to 7108 proteins in 1554 species: Archae - 77; Bacteria - 3117; Metazoa - 345; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 3287 (source: NCBI BLink). |
| AT3G12800 | AT3G12800.1 | AAACGCTG | SHORT-CHAIN DEHYDROGENASE-REDUCTASE B (SDRB); FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: D2,D4-dienoyl-CoA reductase-related (TAIR:AT2G07640.1); Has 72870 Blast hits to 72725 proteins in 2181 species: Archae - 462; Bacteria - 41132; Metazoa - 3880; Fungi - 3552; Plants - 1537; Viruses - 2; Other Eukaryotes - 22305 (source: NCBI BLink). |
| AT3G12920 | AT3G12920.1 | AAACGCTG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G79110.2); Has 1234 Blast hits to 1231 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 768; Fungi - 0; Plants - 306; Viruses - 33; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT3G14110 | AT3G14110.1 | AAACGCTGCG | Encodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift. |
| AT3G14110.2 | AAACGCTGCG | Encodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift. |
| AT3G14120 | AT3G14120.1 | CGCAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear pore protein 84/107 (InterPro:IPR007252); Has 207 Blast hits to 206 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 57; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G14120.2 | CGCAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear pore protein 84/107 (InterPro:IPR007252); Has 207 Blast hits to 206 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 57; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G14590 | AT3G14590.1 | AAAACGACAGCGTTT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT3G14590.2 | AAAACGACAGCGTTT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT3G15080 | AT3G15080.1 | AAACGGCAGCGTTTTG | exonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1314 Blast hits to 1314 proteins in 179 species: Archae - 0; Bacteria - 14; Metazoa - 651; Fungi - 418; Plants - 111; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT3G17330 | AT3G17330.1 | AAACGCTGCG | evolutionarily conserved C-terminal region 6 (ECT6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT7 (evolutionarily conserved C-terminal region 7) (TAIR:AT1G48110.2); Has 715 Blast hits to 696 proteins in 119 species: Archae - 0; Bacteria - 2; Metazoa - 345; Fungi - 82; Plants - 210; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT3G20960 | AT3G20960.1 | CAGCGTTT | member of CYP705A |
| AT3G21290 | AT3G21290.1 | CAGCGTTTTG | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink). |
| AT3G21300 | AT3G21300.1 | TCAAAACGCTG | RNA methyltransferase family protein; FUNCTIONS IN: methyltransferase activity, RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280), 23S rRNA methyltransferase/RumA (InterPro:IPR001566), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G28450.1); Has 5920 Blast hits to 5453 proteins in 1374 species: Archae - 144; Bacteria - 4401; Metazoa - 174; Fungi - 148; Plants - 63; Viruses - 6; Other Eukaryotes - 984 (source: NCBI BLink). |
| AT3G23940 | AT3G23940.1 | TAAACGACAGCGTTT | dehydratase family; FUNCTIONS IN: catalytic activity, dihydroxy-acid dehydratase activity; INVOLVED IN: branched chain family amino acid biosynthetic process, isoleucine biosynthetic process, metabolic process, valine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dihydroxy-acid dehydratase (InterPro:IPR004404), Dihydroxy-acid and 6-phosphogluconate dehydratase (InterPro:IPR000581); Has 10437 Blast hits to 10433 proteins in 1298 species: Archae - 138; Bacteria - 4265; Metazoa - 2; Fungi - 197; Plants - 21; Viruses - 0; Other Eukaryotes - 5814 (source: NCBI BLink). |
| AT3G26560 | AT3G26560.1 | TAAAACGCAGCGTTTTA | ATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). |
| AT3G45070 | AT3G45070.1 | AAACGCTG | sulfotransferase family protein; FUNCTIONS IN: sulfotransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Sulfotransferase (InterPro:IPR000863); BEST Arabidopsis thaliana protein match is: sulfotransferase family protein (TAIR:AT3G45080.1); Has 2245 Blast hits to 2207 proteins in 147 species: Archae - 0; Bacteria - 151; Metazoa - 1459; Fungi - 1; Plants - 307; Viruses - 0; Other Eukaryotes - 327 (source: NCBI BLink). |
| AT3G47000 | AT3G47000.1 | CCGTTAAACGCTG | glycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G47010.1); Has 6353 Blast hits to 5926 proteins in 906 species: Archae - 20; Bacteria - 3224; Metazoa - 6; Fungi - 919; Plants - 287; Viruses - 0; Other Eukaryotes - 1897 (source: NCBI BLink). |
| AT3G48830 | AT3G48830.1 | TAAAACGCTGCG | polynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: polynucleotide adenylyltransferase activity, RNA binding, nucleotide binding, nucleic acid binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Polynucleotide adenylyltransferase region (InterPro:IPR002646), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 8005 Blast hits to 7486 proteins in 1487 species: Archae - 2; Bacteria - 3572; Metazoa - 1145; Fungi - 573; Plants - 347; Viruses - 8; Other Eukaryotes - 2358 (source: NCBI BLink). |
| AT3G49720 | AT3G49720.1 | TAAAACGCTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G49720.2 | TAAAACGCTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G54190 | AT3G54190.1 | ACCCCTTAAACGCTGCGTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G55070 | AT3G55070.1 | AAACGCTGTCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G55070.2 | AAACGCTGTCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G57550 | AT3G57550.1 | CAGCGTTTTCCGGT | guanylate kinase |
| AT3G57550.2 | CAGCGTTTTCCGGT | guanylate kinase |
| AT3G57560 | AT3G57560.1 | ACGTCAGCGTTTTG | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT3G57570 | AT3G57570.1 | CAAAACGCTGACGT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G61070 | AT3G61070.1 | AAACGCTGCGTTTTA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G61070.2 | AAACGCTGCGTTTTA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G61790 | AT3G61790.1 | CAGCGTTTCCGGTTCA | seven in absentia (SINA) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: seven in absentia (SINA) family protein (TAIR:AT4G27880.1); Has 1422 Blast hits to 1414 proteins in 637 species: Archae - 0; Bacteria - 0; Metazoa - 1099; Fungi - 9; Plants - 250; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT3G62110 | AT3G62110.1 | TAAACGACAGCGTTT | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT4G33440.1); Has 2594 Blast hits to 2590 proteins in 344 species: Archae - 2; Bacteria - 575; Metazoa - 8; Fungi - 1060; Plants - 840; Viruses - 2; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G62450 | AT3G62450.1 | CAGCGTTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G63520 | AT3G63520.1 | CGACGTGGCAGCGTTT | Encodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds. |
| AT4G02400 | AT4G02400.1 | CAGCGTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: rRNA processing; LOCATED IN: small-subunit processome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small-subunit processome, Utp14 (InterPro:IPR006709); BEST Arabidopsis thaliana protein match is: U3 ribonucleoprotein (Utp) family protein (TAIR:AT5G08600.1); Has 7412 Blast hits to 4272 proteins in 301 species: Archae - 10; Bacteria - 517; Metazoa - 2926; Fungi - 722; Plants - 242; Viruses - 149; Other Eukaryotes - 2846 (source: NCBI BLink). |
| AT4G09580 | AT4G09580.1 | CGCAGCGTTT | INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71940.1); Has 2023 Blast hits to 2023 proteins in 496 species: Archae - 2; Bacteria - 1014; Metazoa - 198; Fungi - 27; Plants - 131; Viruses - 0; Other Eukaryotes - 651 (source: NCBI BLink). |
| AT4G12830 | AT4G12830.1 | TAAAACGCAGCGTTTTA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G52510.2); Has 8452 Blast hits to 8450 proteins in 913 species: Archae - 58; Bacteria - 5118; Metazoa - 591; Fungi - 124; Plants - 417; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT4G14315 | AT4G14315.1 | CGCAGCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14315.1 | TAAAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14600 | AT4G14600.1 | TAAAACGCAGCGTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G15470 | AT4G15470.1 | CAGCGTTTTA | EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT1G03070.1); Has 4000 Blast hits to 3999 proteins in 955 species: Archae - 0; Bacteria - 1775; Metazoa - 750; Fungi - 92; Plants - 143; Viruses - 77; Other Eukaryotes - 1163 (source: NCBI BLink). |
| AT4G15802 | AT4G15802.1 | CAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock factor binding 1 (InterPro:IPR009643); Has 178 Blast hits to 178 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G16710 | AT4G16710.1 | TAAACGACAGCGTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G16710.2 | TAAACGACAGCGTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G17070 | AT4G17070.1 | AAAACGACAGCGTTT | peptidyl-prolyl cis-trans isomerase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); Has 114 Blast hits to 110 proteins in 26 species: Archae - 0; Bacteria - 24; Metazoa - 9; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G21810 | AT4G21810.1 | AAACGCTG | DERLIN-2.1 (DER2.1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 644 Blast hits to 643 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 293; Fungi - 119; Plants - 95; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT4G24990 | AT4G24990.1 | AAAACGACAGCGTTT | geranylgeranylated protein ATGP4 |
| AT4G29270 | AT4G29270.1 | AAACGCTG | acid phosphatase class B family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase class B family protein (TAIR:AT4G29260.1); Has 412 Blast hits to 412 proteins in 104 species: Archae - 0; Bacteria - 157; Metazoa - 0; Fungi - 0; Plants - 243; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G29480 | AT4G29480.1 | CAAAACGCTGTCGTTTT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G29490 | AT4G29490.1 | AAAACGACAGCGTTTTG | aminopeptidase/ manganese ion binding; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: metallopeptidase M24 family protein (TAIR:AT1G09300.2); Has 7096 Blast hits to 7089 proteins in 1383 species: Archae - 160; Bacteria - 3987; Metazoa - 333; Fungi - 234; Plants - 49; Viruses - 0; Other Eukaryotes - 2333 (source: NCBI BLink). |
| AT4G29730 | AT4G29730.1 | CAGCGTTT | cell cycle-related repressor genes encoding WD-repeat proteins. |
| AT4G30570 | AT4G30570.1 | TAAAACGCTG | GDP-mannose pyrophosphorylase, putative; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: CYT1 (CYTOKINESIS DEFECTIVE 1); mannose-1-phosphate guanylyltransferase/ nucleotidyltransferase (TAIR:AT2G39770.1); Has 12903 Blast hits to 12895 proteins in 1604 species: Archae - 523; Bacteria - 7994; Metazoa - 333; Fungi - 194; Plants - 189; Viruses - 0; Other Eukaryotes - 3670 (source: NCBI BLink). |
| AT4G30935 | AT4G30935.1 | CAAAACGCAGCGTTT | member of WRKY Transcription Factor; Group I |
| AT4G31360 | AT4G31360.1 | CAGCGTTT | selenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT4G32960 | AT4G32960.1 | TCAAAACGCTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32970.1); Has 78 Blast hits to 78 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G35630 | AT4G35630.1 | AAACGCTGTCGTTTT | Encodes a phosphoserine aminotransferase which is involved in serine biosynthesis in the chloroplast which operates via the phosphorylated pathway. |
| AT4G36390 | AT4G36390.1 | AAACGCTGCGTTTTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), tRNA-i(6)A37 modification enzyme MiaB (InterPro:IPR006463), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT1G72090.1); Has 10307 Blast hits to 10292 proteins in 1299 species: Archae - 219; Bacteria - 4582; Metazoa - 258; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 5193 (source: NCBI BLink). |
| AT4G36400 | AT4G36400.1 | TAAAACGCAGCGTTT | FAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink). |
| AT4G36400.2 | TAAAACGCAGCGTTT | FAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink). |
| AT4G37970 | AT4G37970.1 | ACGTCAGCGTTT | CINNAMYL ALCOHOL DEHYDROGENASE 6 (CAD6); FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 22264 Blast hits to 22252 proteins in 1793 species: Archae - 377; Bacteria - 12614; Metazoa - 1134; Fungi - 1791; Plants - 1846; Viruses - 3; Other Eukaryotes - 4499 (source: NCBI BLink). |
| AT5G02740 | AT5G02740.1 | AAACGCTGTCGTTTA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G02740.2 | AAACGCTGTCGTTTA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G02780 | AT5G02780.1 | AAACGCTGACGT | In2-1 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, male gametophyte, root, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02790.1); Has 3148 Blast hits to 3139 proteins in 533 species: Archae - 8; Bacteria - 840; Metazoa - 693; Fungi - 135; Plants - 1070; Viruses - 0; Other Eukaryotes - 402 (source: NCBI BLink). |
| AT5G02780.2 | AAACGCTGACGT | In2-1 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, male gametophyte, root, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02790.1); Has 3148 Blast hits to 3139 proteins in 533 species: Archae - 8; Bacteria - 840; Metazoa - 693; Fungi - 135; Plants - 1070; Viruses - 0; Other Eukaryotes - 402 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | CGCAGCGTTTTGA | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G03940 | AT5G03940.1 | CAGCGTTTTG | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
| AT5G04040 | AT5G04040.1 | CGCAGCGTTT | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT5G05370 | AT5G05370.1 | TAAACGGCAGCGTTTTG | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05380 | AT5G05380.1 | CAAAACGCTGCCGTTTA | PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G05450 | AT5G05450.1 | TCAAAACGCTGCGTTTTG | DEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae - 410; Bacteria - 10515; Metazoa - 4736; Fungi - 3110; Plants - 1301; Viruses - 7; Other Eukaryotes - 5946 (source: NCBI BLink). |
| AT5G06110 | AT5G06110.1 | CAGCGTTT | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 30941 Blast hits to 21178 proteins in 1608 species: Archae - 101; Bacteria - 5693; Metazoa - 11416; Fungi - 3019; Plants - 1271; Viruses - 136; Other Eukaryotes - 9305 (source: NCBI BLink). |
| AT5G10710 | AT5G10710.1 | AAACGCTGCG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10710.2 | AAACGCTGCG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13280 | AT5G13280.1 | TAAACGACAGCGTTTTA | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). |
| AT5G13390 | AT5G13390.1 | CAGCGTTT | Required for normal pollen development and lipid accumulation within the tapetum |
| AT5G18380 | AT5G18380.1 | TAAAACGCTGCG | 40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). |
| AT5G18380.2 | TAAAACGCTGCG | 40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). |
| AT5G18390 | AT5G18390.1 | CGCAGCGTTTTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink). |
| AT5G20220 | AT5G20220.1 | AAACGCTG | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, zinc ion binding, nucleic acid binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 2110 Blast hits to 1542 proteins in 192 species: Archae - 0; Bacteria - 8; Metazoa - 481; Fungi - 459; Plants - 190; Viruses - 714; Other Eukaryotes - 258 (source: NCBI BLink). |
| AT5G20220.2 | AAACGCTG | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, zinc ion binding, nucleic acid binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 2110 Blast hits to 1542 proteins in 192 species: Archae - 0; Bacteria - 8; Metazoa - 481; Fungi - 459; Plants - 190; Viruses - 714; Other Eukaryotes - 258 (source: NCBI BLink). |
| AT5G24080 | AT5G24080.1 | AAACGCTG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT2G19130.1); Has 83012 Blast hits to 81933 proteins in 3234 species: Archae - 50; Bacteria - 7141; Metazoa - 37012; Fungi - 6145; Plants - 18411; Viruses - 299; Other Eukaryotes - 13954 (source: NCBI BLink). |
| AT5G25510 | AT5G25510.1 | AAACGCTG | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT5G25520 | AT5G25520.1 | CAGCGTTT | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). |
| AT5G25520.2 | CAGCGTTT | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). |
| AT5G27120 | AT5G27120.1 | CGCAGCGTTTTGA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein |
| AT5G40240 | AT5G40240.1 | CAGCGTTTTA | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin-related (TAIR:AT5G40230.1); Has 1618 Blast hits to 1607 proteins in 311 species: Archae - 15; Bacteria - 735; Metazoa - 4; Fungi - 9; Plants - 626; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT5G41760 | AT5G41760.1 | CAGCGTTT | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT5G41760.2 | CAGCGTTT | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT5G49550 | AT5G49550.1 | AAACGCTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 122 Blast hits to 122 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G52100 | AT5G52100.1 | CAGCGTTT | Is essential for chloroplast NAD(P)H dehydrogenase activity, which is involved in electron transfer between PSII and PSI. Likely functions in biogenesis or stabilization of the NAD(P)H dehydrogenase complex. |
| AT5G52350 | AT5G52350.1 | CAGCGTTTTG | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52960 | AT5G52960.1 | CAAAACGCTGCGTTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT5G55140 | AT5G55140.1 | CAAAACGCTGTCGTTTA | ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G55210 | AT5G55210.1 | TAAAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55210.1 | TCAAAACGCAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55220 | AT5G55220.1 | AAACGCTGCGTTTTGA | trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). |
| AT5G55220.1 | CGCAGCGTTTTA | trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). |
| AT5G56140 | AT5G56140.1 | CGCAGCGTTT | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 4346 Blast hits to 2291 proteins in 261 species: Archae - 6; Bacteria - 444; Metazoa - 2561; Fungi - 214; Plants - 674; Viruses - 13; Other Eukaryotes - 434 (source: NCBI BLink). |
| AT5G67510 | AT5G67510.1 | AAACGGCAGCGTTT | 60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |