Organism | Arabidopsis thaliana | |
ID | AtREG629 | |
Sequence | CCGGTATA | |
Annotation | ||
PPDB Motif | ||
PLACE Motif | ||
Total Entry Count | 79 |
Locus | Gene model | Sequence | Description |
AT1G01790 | AT1G01790.1 | TATACCGG | K efflux antiporter KEA1  |
AT1G08780 | AT1G08780.1 | TATACCGG | ABI3-INTERACTING PROTEIN 3 (AIP3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin beta-like (InterPro:IPR002777), Prefoldin, subunit 4 (InterPro:IPR016661); Has 256 Blast hits to 255 proteins in 137 species: Archae - 2; Bacteria - 0; Metazoa - 87; Fungi - 83; Plants - 32; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT1G11870 | AT1G11870.1 | TATACCGG | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
AT1G11870.2 | TATACCGG | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  | |
AT1G11870.3 | TATACCGG | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  | |
AT1G18150 | AT1G18150.1 | TTAACCGGTATA | ATMPK8,  |
AT1G18150.2 | TTAACCGGTATA | ATMPK8,  | |
AT1G18540 | AT1G18540.1 | CCGGTATA | 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT1G22270 | AT1G22270.1 | TATACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78190.1); Has 289 Blast hits to 289 proteins in 134 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT1G25375 | AT1G25375.1 | CCGGTATA | metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 3890 Blast hits to 3889 proteins in 863 species: Archae - 83; Bacteria - 2082; Metazoa - 121; Fungi - 86; Plants - 75; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink).  |
AT1G25380 | AT1G25380.1 | TATACCGG | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G47490.1); Has 21875 Blast hits to 10577 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10770; Fungi - 5942; Plants - 2991; Viruses - 5; Other Eukaryotes - 2167 (source: NCBI BLink).  |
AT1G26370 | AT1G26370.1 | CCGGTATA | RNA helicase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 6916 Blast hits to 6404 proteins in 949 species: Archae - 2; Bacteria - 1916; Metazoa - 1973; Fungi - 797; Plants - 383; Viruses - 390; Other Eukaryotes - 1455 (source: NCBI BLink).  |
AT1G26530 | AT1G26530.1 | CCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT1G28250 | AT1G28250.1 | AAACCGGAATATACCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 10 Blast hits to 10 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G48430 | AT1G48430.1 | TATACCGGTTTT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink).  |
AT1G48440 | AT1G48440.1 | AAAACCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G50530 | AT1G50530.1 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G50570.2); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G56590 | AT1G56590.1 | CCGGTATA | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: HAP13 (HAPLESS 13); protein binding (TAIR:AT1G60780.1); Has 1451 Blast hits to 1434 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 782; Fungi - 300; Plants - 105; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink).  |
AT1G61150 | AT1G61150.1 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT1G61150.2 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.3 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.4 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.5 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.6 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.7 | CCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G62570 | AT1G62570.1 | CCGGTATA | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates  |
AT2G01470 | AT2G01470.1 | CCGGTATA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER.  |
AT2G07728 | AT2G07728.1 | CCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G24090 | AT2G24090.1 | TATACCGGTTTT | ribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink).  |
AT2G28520 | AT2G28520.1 | TATACCGG | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network.  |
AT2G28550 | AT2G28550.1 | CCGGTATA | RELATED TO AP2.7 (RAP2.7); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: organ morphogenesis, regulation of transcription, DNA-dependent, vegetative to reproductive phase transition; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: TOE2; DNA binding / transcription factor (TAIR:AT5G60120.1); Has 3106 Blast hits to 2890 proteins in 180 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 3041; Viruses - 7; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT2G28550.2 | CCGGTATA | RELATED TO AP2.7 (RAP2.7); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: organ morphogenesis, regulation of transcription, DNA-dependent, vegetative to reproductive phase transition; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: TOE2; DNA binding / transcription factor (TAIR:AT5G60120.1); Has 3106 Blast hits to 2890 proteins in 180 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 3041; Viruses - 7; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT2G31710 | AT2G31710.1 | TATACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05780.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G32520 | AT2G32520.1 | TATACCGGGCCCAGA | dienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase (InterPro:IPR002155), Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT1G35420.1); Has 2362 Blast hits to 2362 proteins in 596 species: Archae - 20; Bacteria - 1757; Metazoa - 54; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 466 (source: NCBI BLink).  |
AT2G33250 | AT2G33250.1 | TATACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G41540 | AT2G41540.1 | CCGGTATA | Encodes a protein with NAD-dependent glycerol-3-phosphate (G3P) dehydrogenase which was shown to complement an Escherichia coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-function mutation in the gpsA gene.  |
AT2G41540.2 | CCGGTATA | Encodes a protein with NAD-dependent glycerol-3-phosphate (G3P) dehydrogenase which was shown to complement an Escherichia coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-function mutation in the gpsA gene.  | |
AT2G41540.3 | CCGGTATA | Encodes a protein with NAD-dependent glycerol-3-phosphate (G3P) dehydrogenase which was shown to complement an Escherichia coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-function mutation in the gpsA gene.  | |
AT2G45820 | AT2G45820.1 | CCGGTATA | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink).  |
AT3G12760 | AT3G12760.1 | TATACCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defective in cullin neddylation (InterPro:IPR014764), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Protein of unknown function DUF298 (InterPro:IPR005176), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15860.2); Has 628 Blast hits to 626 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 408; Fungi - 99; Plants - 64; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |
AT3G18210 | AT3G18210.1 | TATACCGG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G18210.2 | TATACCGG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink).  | |
AT3G18215 | AT3G18215.1 | CCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae - 0; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT3G18270 | AT3G18270.1 | CCGGTATA | a cytochrome P450 pseudogene. the second half of the gene overlaps perfectly with the other gene model.  |
AT3G19790 | AT3G19790.1 | CCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT3G19790.2 | CCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT3G23880 | AT3G23880.1 | TATACCGGTATA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G06240.1); Has 1320 Blast hits to 1317 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1318; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G24030 | AT3G24030.1 | CTAAACCGGTATA | hydroxyethylthiazole kinase family protein; FUNCTIONS IN: catalytic activity, hydroxyethylthiazole kinase activity; INVOLVED IN: thiamin biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hydroxyethylthiazole kinase (InterPro:IPR000417), Hydroxyethylthiazole kinase, monofunctional (InterPro:IPR011144); Has 1376 Blast hits to 1376 proteins in 593 species: Archae - 84; Bacteria - 1080; Metazoa - 1; Fungi - 85; Plants - 22; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
AT3G48750 | AT3G48750.1 | AACCCGGTATA | A-type cyclin-dependent kinase. Together with its specific inhibitor, the Kip-related protein, KRP2 they regulate the mitosis-to-endocycle transition during leaf development. Dominant negative mutations abolish cell division. Loss of function phenotype has reduced fertility with failure to transmit via pollen. Pollen development is arrested at the second mitotic division. Expression is regulated by environmental and chemical signals. Part of the promoter is responsible for expression in trichomes. Functions as a positive regulator of cell proliferation during development of the male gametophyte, embryo and endosperm. Phosphorylation of threonine 161 is required for activation of its associated kinase.  |
AT3G51500 | AT3G51500.1 | AAAACCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G51510 | AT3G51510.1 | AAAACCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G51820 | AT3G51820.1 | CCGGTATA | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP.  |
AT3G56130 | AT3G56130.1 | TATACCGG | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1272 Blast hits to 1272 proteins in 462 species: Archae - 11; Bacteria - 891; Metazoa - 0; Fungi - 2; Plants - 68; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink).  |
AT4G03390 | AT4G03390.1 | CCGGTATA | STRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink).  |
AT4G04740 | AT4G04740.1 | TTTCCGGTATA | member of Calcium Dependent Protein Kinase  |
AT4G09730 | AT4G09730.1 | CCGGTATA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G06980.1); Has 26614 Blast hits to 26065 proteins in 1716 species: Archae - 427; Bacteria - 10484; Metazoa - 4922; Fungi - 3195; Plants - 1331; Viruses - 9; Other Eukaryotes - 6246 (source: NCBI BLink).  |
AT4G11240 | AT4G11240.1 | CCGGTATA | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers.  |
AT4G23920 | AT4G23920.1 | CCGGTATA | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis.  |
AT4G24740 | AT4G24740.1 | TATACCGG | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins.  |
AT4G27700 | AT4G27700.1 | GTAAACCGGTATA | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 465 Blast hits to 463 proteins in 140 species: Archae - 23; Bacteria - 218; Metazoa - 0; Fungi - 0; Plants - 156; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT4G28360 | AT4G28360.1 | TATACCGG | ribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink).  |
AT4G33400 | AT4G33400.1 | CCGGTATA | dem protein-related / defective embryo and meristems protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Vacuolar import and degradation, Vid27-related (InterPro:IPR013863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19240.1); Has 171 Blast hits to 171 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 88; Plants - 38; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
AT4G33410 | AT4G33410.1 | TATACCGG | signal peptide peptidase family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT2G43070.1); Has 697 Blast hits to 691 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 390; Fungi - 77; Plants - 139; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).  |
AT4G36440 | AT4G36440.1 | TATACCGGATCCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02830 | AT5G02830.1 | TATACCGG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G18940.1); Has 14432 Blast hits to 5047 proteins in 162 species: Archae - 3; Bacteria - 24; Metazoa - 323; Fungi - 205; Plants - 13092; Viruses - 0; Other Eukaryotes - 785 (source: NCBI BLink).  |
AT5G02840 | AT5G02840.1 | CCGGTATA | CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.  |
AT5G02840.2 | CCGGTATA | CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.  | |
AT5G02840.3 | CCGGTATA | CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.  | |
AT5G10200 | AT5G10200.1 | TATACCGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT5G43120.1); Has 1566 Blast hits to 1469 proteins in 175 species: Archae - 0; Bacteria - 3; Metazoa - 907; Fungi - 260; Plants - 202; Viruses - 4; Other Eukaryotes - 190 (source: NCBI BLink).  |
AT5G13680 | AT5G13680.1 | CTAAACCGGTATA | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.  |
AT5G13690 | AT5G13690.1 | TATACCGGTTTAG | alpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT5G17840 | AT5G17840.1 | CCGGTATAGTCCGGTTAT | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G20660 | AT5G20660.2 | TATACCGG | 24 kDa vacuolar protein, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M28 (InterPro:IPR007484); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT1G67420.1); Has 935 Blast hits to 925 proteins in 208 species: Archae - 6; Bacteria - 236; Metazoa - 415; Fungi - 154; Plants - 39; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT5G41330 | AT5G41330.1 | ACCGGTTTATACCGGTTAT | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT3G09030.1); Has 474 Blast hits to 473 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 378; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT5G42860 | AT5G42860.1 | GAACCGGTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45688.1); Has 116 Blast hits to 115 proteins in 22 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 8; Plants - 91; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT5G55710 | AT5G55710.1 | ACGCCGTTTTATACCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: tic20 protein-related (TAIR:AT2G47840.1); Has 268 Blast hits to 268 proteins in 76 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).  |
AT5G56140 | AT5G56140.1 | CCGGTATA | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 4346 Blast hits to 2291 proteins in 261 species: Archae - 6; Bacteria - 444; Metazoa - 2561; Fungi - 214; Plants - 674; Viruses - 13; Other Eukaryotes - 434 (source: NCBI BLink).  |
AT5G57120 | AT5G57120.1 | ATAAACCGGTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  |
AT5G61840 | AT5G61840.1 | TATACCGG | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |