| Locus | Gene model | Sequence | Description |
| AT1G01540 | AT1G01540.1 | CGACATCG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G01330.1); Has 85830 Blast hits to 84796 proteins in 3163 species: Archae - 57; Bacteria - 8048; Metazoa - 37643; Fungi - 6516; Plants - 18556; Viruses - 420; Other Eukaryotes - 14590 (source: NCBI BLink).  |
| AT1G01540.2 | CGACATCG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G01330.1); Has 85830 Blast hits to 84796 proteins in 3163 species: Archae - 57; Bacteria - 8048; Metazoa - 37643; Fungi - 6516; Plants - 18556; Viruses - 420; Other Eukaryotes - 14590 (source: NCBI BLink).  |
| AT1G09100 | AT1G09100.1 | CGACATCG | Encodes RPT5b (Regulatory Particle 5b), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype.  |
| AT1G09270 | AT1G09270.3 | CGATGTCG | Protein interacts with Agrobacterium proteins VirD2 and VirE2.  |
| AT1G11660 | AT1G11660.1 | CGACATCG | heat shock protein, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP91; ATP binding (TAIR:AT1G79930.1); Has 18340 Blast hits to 18232 proteins in 2790 species: Archae - 102; Bacteria - 6666; Metazoa - 2927; Fungi - 1006; Plants - 621; Viruses - 73; Other Eukaryotes - 6945 (source: NCBI BLink).  |
| AT1G11660.2 | CGACATCG | heat shock protein, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP91; ATP binding (TAIR:AT1G79930.1); Has 18340 Blast hits to 18232 proteins in 2790 species: Archae - 102; Bacteria - 6666; Metazoa - 2927; Fungi - 1006; Plants - 621; Viruses - 73; Other Eukaryotes - 6945 (source: NCBI BLink).  |
| AT1G11800 | AT1G11800.1 | CGATGTCG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Zinc finger, RanBP2-type (InterPro:IPR001876); Has 273 Blast hits to 263 proteins in 68 species: Archae - 0; Bacteria - 12; Metazoa - 134; Fungi - 10; Plants - 55; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT1G12244 | AT1G12244.1 | CGATGTCG | DNA binding / hydrolase, acting on ester bonds / nuclease/ nucleic acid binding / recombinase; FUNCTIONS IN: hydrolase activity, acting on ester bonds, recombinase activity, DNA binding, nuclease activity, nucleic acid binding; INVOLVED IN: DNA repair, nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, DNA recombination, response to DNA damage stimulus; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Resolvase, RNase H-like fold (InterPro:IPR006641), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Resolvase, holliday junction-type, YqgF-like (InterPro:IPR005227); Has 2009 Blast hits to 2009 proteins in 796 species: Archae - 0; Bacteria - 1622; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).  |
| AT1G12270 | AT1G12270.1 | AAAACGACATCG | stress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 29103 Blast hits to 13265 proteins in 843 species: Archae - 964; Bacteria - 7395; Metazoa - 8026; Fungi - 1794; Plants - 2170; Viruses - 39; Other Eukaryotes - 8715 (source: NCBI BLink).  |
| AT1G13120 | AT1G13120.1 | TAAACGACATCG | embryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink).  |
| AT1G15880 | AT1G15880.1 | CGATGTCGTTTA | Golgi SNARE 11 protein (GOS11)  |
| AT1G15890 | AT1G15890.1 | TAAACGACATCG | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G43730.1); Has 12716 Blast hits to 11782 proteins in 513 species: Archae - 12; Bacteria - 543; Metazoa - 2689; Fungi - 133; Plants - 9121; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink).  |
| AT1G16710 | AT1G16710.1 | TCACACGTGCGACATCG | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides.  |
| AT1G16810 | AT1G16810.1 | CGATGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT1G16810.2 | CGATGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT1G21790 | AT1G21790.1 | CGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G23400 | AT1G23400.1 | CGATGTCG | Promotes the splicing of chloroplast group II introns.  |
| AT1G27690 | AT1G27690.1 | CGATGTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: glycerol biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19540.1); Has 114 Blast hits to 112 proteins in 14 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G29250 | AT1G29250.1 | CGATGTCGTTT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT1G29260 | AT1G29260.1 | AAACGACATCG | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function.  |
| AT1G31020 | AT1G31020.1 | CGATGTCGTTTC | Arabidopsis thioredoxin o2 (ATO2); INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATO1 (Arabidopsis thioredoxin O1) (TAIR:AT2G35010.2); Has 8280 Blast hits to 8267 proteins in 1604 species: Archae - 109; Bacteria - 3630; Metazoa - 858; Fungi - 399; Plants - 738; Viruses - 3; Other Eukaryotes - 2543 (source: NCBI BLink).  |
| AT1G50770 | AT1G50770.1 | GAAACGACATCGTGTCAT | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50790.1); Has 864 Blast hits to 735 proteins in 105 species: Archae - 0; Bacteria - 129; Metazoa - 142; Fungi - 42; Plants - 412; Viruses - 1; Other Eukaryotes - 138 (source: NCBI BLink).  |
| AT1G55080 | AT1G55080.1 | CGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 64498 Blast hits to 23302 proteins in 980 species: Archae - 12; Bacteria - 3118; Metazoa - 24455; Fungi - 7046; Plants - 5363; Viruses - 296; Other Eukaryotes - 24208 (source: NCBI BLink).  |
| AT1G55090 | AT1G55090.1 | CGATGTCG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, NAD+ synthase (glutamine-hydrolyzing) activity, ATP binding; INVOLVED IN: nitrogen compound metabolic process, NAD biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010), NAD+ synthase (InterPro:IPR003694), Glutamine-dependent NAD(+) synthetase, GAT region (InterPro:IPR014445); Has 3609 Blast hits to 3596 proteins in 1316 species: Archae - 149; Bacteria - 2377; Metazoa - 135; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 843 (source: NCBI BLink).  |
| AT1G55250 | AT1G55250.1 | CGATGTCGTTTA | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B.  |
| AT1G55880 | AT1G55880.1 | CGACATCG | pyridoxal-5'-phosphate-dependent enzyme, beta family protein; FUNCTIONS IN: lyase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: amino acid metabolic process, cysteine biosynthetic process from serine, metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Cysteine synthase/cystathionine beta-synthase P-phosphate-binding site (InterPro:IPR001216), Pyridoxal phosphate-dependent enzyme, beta subunit (InterPro:IPR001926); BEST Arabidopsis thaliana protein match is: cysteine synthase, putative / O-acetylserine (thiol)-lyase, putative / O-acetylserine sulfhydrylase, putative (TAIR:AT5G28030.2); Has 11031 Blast hits to 11019 proteins in 1463 species: Archae - 236; Bacteria - 5849; Metazoa - 328; Fungi - 337; Plants - 322; Viruses - 0; Other Eukaryotes - 3959 (source: NCBI BLink).  |
| AT1G55880.2 | CGACATCG | pyridoxal-5'-phosphate-dependent enzyme, beta family protein; FUNCTIONS IN: lyase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: amino acid metabolic process, cysteine biosynthetic process from serine, metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Cysteine synthase/cystathionine beta-synthase P-phosphate-binding site (InterPro:IPR001216), Pyridoxal phosphate-dependent enzyme, beta subunit (InterPro:IPR001926); BEST Arabidopsis thaliana protein match is: cysteine synthase, putative / O-acetylserine (thiol)-lyase, putative / O-acetylserine sulfhydrylase, putative (TAIR:AT5G28030.2); Has 11031 Blast hits to 11019 proteins in 1463 species: Archae - 236; Bacteria - 5849; Metazoa - 328; Fungi - 337; Plants - 322; Viruses - 0; Other Eukaryotes - 3959 (source: NCBI BLink).  |
| AT1G58190 | AT1G58190.1 | CGATGTCGTTTA | Receptor Like Protein 9 (AtRLP9); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP14 (Receptor Like Protein 14); protein binding (TAIR:AT1G74180.1); Has 147042 Blast hits to 23181 proteins in 886 species: Archae - 108; Bacteria - 9080; Metazoa - 49718; Fungi - 1830; Plants - 74982; Viruses - 105; Other Eukaryotes - 11219 (source: NCBI BLink).  |
| AT1G60960 | AT1G60960.1 | CGATGTCG | member of Fe(II) transporter isolog family  |
| AT1G62250 | AT1G62250.1 | CGACATCG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G62250.2 | CGACATCG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G69390 | AT1G69390.1 | CGACATCG | Encodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery.  |
| AT1G69680 | AT1G69680.1 | CGATGTCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Ran-interacting Mog1 protein (InterPro:IPR007681), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 202 Blast hits to 202 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 83; Plants - 25; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT1G73080 | AT1G73080.1 | AAAACGACATCG | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks.  |
| AT1G76700 | AT1G76700.1 | CGACATCG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT1G21080.1); Has 15728 Blast hits to 15653 proteins in 1913 species: Archae - 105; Bacteria - 5182; Metazoa - 3292; Fungi - 1431; Plants - 1171; Viruses - 18; Other Eukaryotes - 4529 (source: NCBI BLink).  |
| AT1G78100 | AT1G78100.1 | CGATGTCG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G22220.1); Has 82 Blast hits to 81 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G79200 | AT1G79200.1 | CGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; Has 3292 Blast hits to 2186 proteins in 154 species: Archae - 0; Bacteria - 21; Metazoa - 1599; Fungi - 418; Plants - 200; Viruses - 0; Other Eukaryotes - 1054 (source: NCBI BLink).  |
| AT2G02970 | AT2G02970.1 | CGACATCG | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14230.1); Has 1085 Blast hits to 1080 proteins in 167 species: Archae - 0; Bacteria - 20; Metazoa - 529; Fungi - 212; Plants - 199; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  |
| AT2G18250 | AT2G18250.1 | CGACATCG | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis.  |
| AT2G23080 | AT2G23080.1 | CGATGTCGTTTA | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink).  |
| AT2G23080.2 | CGATGTCGTTTA | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink).  |
| AT2G35190 | AT2G35190.1 | CGATGTCGTGGCGGGTCCCAC | plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate.  |
| AT2G45690 | AT2G45690.1 | AAAACGACATCG | Encodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica.  |
| AT3G02530 | AT3G02530.1 | AAAACGACATCG | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: membrane, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, zeta subunit (InterPro:IPR012722), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT5G16070.1); Has 13554 Blast hits to 13062 proteins in 2289 species: Archae - 391; Bacteria - 5634; Metazoa - 1855; Fungi - 975; Plants - 487; Viruses - 0; Other Eukaryotes - 4212 (source: NCBI BLink).  |
| AT3G04780 | AT3G04780.1 | CGATGTCGTTTT | Encodes a protein with little sequence identity with any other protein of known structure or function. Part of this protein shows a 42% sequence identity with the C-terminal domain of the 32-kD human thioredoxin-like protein.  |
| AT3G04790 | AT3G04790.1 | AAAACGACATCG | ribose 5-phosphate isomerase-related; FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: defense response to bacterium, reductive pentose-phosphate cycle; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribose 5-phosphate isomerase (InterPro:IPR004788); BEST Arabidopsis thaliana protein match is: ribose-5-phosphate isomerase (TAIR:AT2G01290.1); Has 3164 Blast hits to 3164 proteins in 1122 species: Archae - 153; Bacteria - 1911; Metazoa - 90; Fungi - 101; Plants - 84; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink).  |
| AT3G06440 | AT3G06440.1 | AAAACGACATCG | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galectin, carbohydrate recognition domain (InterPro:IPR001079), Glycosyl transferase, family 31 (InterPro:IPR002659), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: GALT1 (GALACTOSYLTRANSFERASE1); UDP-galactose:N-glycan beta-1,3-galactosyltransferase/ transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G26810.1); Has 1799 Blast hits to 1791 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 1426; Fungi - 5; Plants - 334; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
| AT3G06440.2 | AAAACGACATCG | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galectin, carbohydrate recognition domain (InterPro:IPR001079), Glycosyl transferase, family 31 (InterPro:IPR002659), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: GALT1 (GALACTOSYLTRANSFERASE1); UDP-galactose:N-glycan beta-1,3-galactosyltransferase/ transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G26810.1); Has 1799 Blast hits to 1791 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 1426; Fungi - 5; Plants - 334; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
| AT3G06510 | AT3G06510.1 | CGATGTCG | Encodes a protein with beta-glucosidase activity, mutants show increased sensitivity to freezing  |
| AT3G06510.2 | CGATGTCG | Encodes a protein with beta-glucosidase activity, mutants show increased sensitivity to freezing  |
| AT3G10360 | AT3G10360.1 | CGATGTCG | Arabidopsis Pumilio 4 (APUM4); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid binding NABP (InterPro:IPR012940), Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM1 (Arabidopsis Pumilio 1); RNA binding / binding (TAIR:AT2G29200.1); Has 2567 Blast hits to 1403 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 660; Fungi - 804; Plants - 438; Viruses - 0; Other Eukaryotes - 661 (source: NCBI BLink).  |
| AT3G10530 | AT3G10530.1 | CGATGTCG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BING4, C-terminal (InterPro:IPR012952), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.3); Has 6810 Blast hits to 4312 proteins in 298 species: Archae - 16; Bacteria - 2174; Metazoa - 1948; Fungi - 1292; Plants - 310; Viruses - 0; Other Eukaryotes - 1070 (source: NCBI BLink).  |
| AT3G11070 | AT3G11070.1 | AAAACGACATCG | outer membrane OMP85 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: outer membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Bacterial surface antigen (D15) (InterPro:IPR000184), Surface antigen variable number (InterPro:IPR010827); BEST Arabidopsis thaliana protein match is: outer membrane OMP85 family protein (TAIR:AT5G05520.1); Has 1201 Blast hits to 1199 proteins in 376 species: Archae - 0; Bacteria - 505; Metazoa - 124; Fungi - 83; Plants - 38; Viruses - 0; Other Eukaryotes - 451 (source: NCBI BLink).  |
| AT3G13230 | AT3G13230.1 | CGATGTCGTTTT | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
| AT3G14270 | AT3G14270.1 | CGATGTCG | Encodes a FYVE domain protein containing the following domains: FYVE + Chaperonin + PIP5K.  |
| AT3G15070 | AT3G15070.1 | CGATGTCGTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G53190.2); Has 5164 Blast hits to 5155 proteins in 208 species: Archae - 0; Bacteria - 4; Metazoa - 1886; Fungi - 403; Plants - 1788; Viruses - 38; Other Eukaryotes - 1045 (source: NCBI BLink).  |
| AT3G15150 | AT3G15150.1 | CGACATCG | zinc ion binding; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MIZ-type (InterPro:IPR004181); Has 205 Blast hits to 205 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 36; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT3G15160 | AT3G15160.1 | CGATGTCG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 67 Blast hits to 65 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT3G15660 | AT3G15660.1 | GAAACGACATCG | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  |
| AT3G15660.2 | GAAACGACATCG | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  |
| AT3G18760 | AT3G18760.1 | CGATGTCGTTTT | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 21 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G18760.2 | CGATGTCGTTTT | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 21 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G25920 | AT3G25920.1 | CGATGTCGTTTA | encodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex  |
| AT3G26580 | AT3G26580.1 | TAAACGACATCG | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide region (InterPro:IPR013026); Has 2147 Blast hits to 1154 proteins in 168 species: Archae - 2; Bacteria - 99; Metazoa - 1301; Fungi - 180; Plants - 105; Viruses - 57; Other Eukaryotes - 403 (source: NCBI BLink).  |
| AT3G49400 | AT3G49400.1 | AAAACGACATCG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
| AT3G49400.1 | CGACATCG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
| AT3G57560 | AT3G57560.1 | GAAACGACATCG | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis  |
| AT3G57570 | AT3G57570.1 | CGATGTCGTTTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT3G58680 | AT3G58680.1 | CGACATCG | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated.  |
| AT3G61460 | AT3G61460.1 | ACGACACGATGTCGTTTA | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide.  |
| AT4G02210 | AT4G02210.1 | CGATGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G05520 | AT4G05520.1 | CGATGTCG | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290).  |
| AT4G05520.2 | CGATGTCG | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290).  |
| AT4G10760 | AT4G10760.1 | CGACATCG | MRNA ADENOSINE METHYLASE (MTA); FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, methyltransferase activity; INVOLVED IN: embryonic development ending in seed dormancy, mRNA methylation; LOCATED IN: nuclear speck, chloroplast; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MT-A70 (InterPro:IPR007757); BEST Arabidopsis thaliana protein match is: EMB1691 (EMBRYO DEFECTIVE 1691); S-adenosylmethionine-dependent methyltransferase/ methyltransferase/ nucleic acid binding (TAIR:AT4G09980.1); Has 784 Blast hits to 758 proteins in 172 species: Archae - 6; Bacteria - 154; Metazoa - 259; Fungi - 58; Plants - 65; Viruses - 6; Other Eukaryotes - 236 (source: NCBI BLink).  |
| AT4G11670 | AT4G11670.1 | CGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06970.1); Has 147 Blast hits to 87 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 138; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G11670.1 | TCAAAACGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06970.1); Has 147 Blast hits to 87 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 138; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G12010 | AT4G12010.1 | CGACATCG | disease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: protein binding, transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157), Leucine-rich repeat 3 (InterPro:IPR011713); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT4G19510.1); Has 22360 Blast hits to 15112 proteins in 670 species: Archae - 19; Bacteria - 1728; Metazoa - 4451; Fungi - 229; Plants - 14971; Viruses - 4; Other Eukaryotes - 958 (source: NCBI BLink).  |
| AT4G22300 | AT4G22300.1 | CGATGTCGTTTC | encodes a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis  |
| AT4G22310 | AT4G22310.1 | GAAACGACATCG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14695.1); Has 630 Blast hits to 630 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 302; Fungi - 164; Plants - 96; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
| AT4G24370 | AT4G24370.1 | GAAACGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT4G29480 | AT4G29480.1 | GAAACGACATCG | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT4G29490 | AT4G29490.1 | CGATGTCGTTTC | aminopeptidase/ manganese ion binding; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: metallopeptidase M24 family protein (TAIR:AT1G09300.2); Has 7096 Blast hits to 7089 proteins in 1383 species: Archae - 160; Bacteria - 3987; Metazoa - 333; Fungi - 234; Plants - 49; Viruses - 0; Other Eukaryotes - 2333 (source: NCBI BLink).  |
| AT4G31770 | AT4G31770.1 | GAAACGACATCG | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
| AT4G33945 | AT4G33945.1 | GAAACGACATCG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); Has 252 Blast hits to 236 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 5; Plants - 68; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT4G37040 | AT4G37040.1 | CGACATCG | encodes a methionine aminopeptidase  |
| AT4G38560 | AT4G38560.1 | CGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); BEST Arabidopsis thaliana protein match is: pEARLI4 (TAIR:AT2G20960.1); Has 131 Blast hits to 121 proteins in 30 species: Archae - 7; Bacteria - 12; Metazoa - 16; Fungi - 0; Plants - 75; Viruses - 2; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT4G38560.2 | CGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); BEST Arabidopsis thaliana protein match is: pEARLI4 (TAIR:AT2G20960.1); Has 131 Blast hits to 121 proteins in 30 species: Archae - 7; Bacteria - 12; Metazoa - 16; Fungi - 0; Plants - 75; Viruses - 2; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT4G38600 | AT4G38600.1 | GAAACGACATCG | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content.  |
| AT4G38600.2 | GAAACGACATCG | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content.  |
| AT5G01270 | AT5G01270.1 | CGATGTCG | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses.  |
| AT5G02770 | AT5G02770.1 | CGATGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).  |
| AT5G09590 | AT5G09590.1 | CGATGTCG | heat shock protein 70 (Hsc70-5); nuclear  |
| AT5G10240 | AT5G10240.1 | CGACATCG | Encodes asparagine synthetase (ASN3).  |
| AT5G10240.2 | CGACATCG | Encodes asparagine synthetase (ASN3).  |
| AT5G10910 | AT5G10910.1 | CGATGTCG | mraW methylase family protein; FUNCTIONS IN: methyltransferase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial methyltransferase (InterPro:IPR002903); Has 5437 Blast hits to 5435 proteins in 1466 species: Archae - 0; Bacteria - 2709; Metazoa - 101; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2607 (source: NCBI BLink).  |
| AT5G18065 | AT5G18065.1 | CGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29760.1); Has 28 Blast hits to 28 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G21430 | AT5G21430.1 | AAAACGACATCG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Has 46 Blast hits to 46 proteins in 21 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT5G21430.2 | AAAACGACATCG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Has 46 Blast hits to 46 proteins in 21 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT5G23900 | AT5G23900.1 | CGATGTCGTTTA | 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
| AT5G27620 | AT5G27620.1 | TAAACGACATCG | core cell cycle genes  |
| AT5G27720 | AT5G27720.1 | CGACATCG | embryo defective 1644 (emb1644); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 1164 Blast hits to 1156 proteins in 179 species: Archae - 0; Bacteria - 6; Metazoa - 536; Fungi - 265; Plants - 172; Viruses - 5; Other Eukaryotes - 180 (source: NCBI BLink).  |
| AT5G27930 | AT5G27930.1 | CGATGTCG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G05640.2); Has 3920 Blast hits to 3918 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 1223; Fungi - 465; Plants - 1295; Viruses - 5; Other Eukaryotes - 930 (source: NCBI BLink).  |
| AT5G27930.2 | CGATGTCG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G05640.2); Has 3920 Blast hits to 3918 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 1223; Fungi - 465; Plants - 1295; Viruses - 5; Other Eukaryotes - 930 (source: NCBI BLink).  |
| AT5G40080 | AT5G40080.1 | CGACATCG | 60S ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: 60S ribosomal protein-related (TAIR:AT5G39800.1); Has 141 Blast hits to 141 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 78; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT5G50320 | AT5G50320.1 | CGATGTCGTTTA | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Two lines with RNAi constructs directed against HAG3 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation.  |
| AT5G50800 | AT5G50800.1 | CGATGTCG | nodulin MtN3 family protein; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MtN3 and saliva related transmembrane protein, conserved region (InterPro:IPR018169), RAG1-activating protein 1 homologue (InterPro:IPR018179), MtN3 and saliva related transmembrane protein (InterPro:IPR004316); BEST Arabidopsis thaliana protein match is: nodulin MtN3 family protein (TAIR:AT4G25010.1); Has 585 Blast hits to 542 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 231; Fungi - 0; Plants - 290; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
| AT5G50970 | AT5G50970.1 | CGACATCGTGGCTT | WD-40 repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G19920.1); Has 1904 Blast hits to 1568 proteins in 194 species: Archae - 0; Bacteria - 413; Metazoa - 642; Fungi - 248; Plants - 168; Viruses - 0; Other Eukaryotes - 433 (source: NCBI BLink).  |
| AT5G53300 | AT5G53300.1 | CGATGTCGTTTC | Encodes a ubiquitin conjugating enzyme.  |
| AT5G53300.2 | CGATGTCGTTTC | Encodes a ubiquitin conjugating enzyme.  |
| AT5G53300.3 | CGATGTCGTTTC | Encodes a ubiquitin conjugating enzyme.  |
| AT5G53310 | AT5G53310.1 | GAAACGACATCG | myosin heavy chain-related; FUNCTIONS IN: motor activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myosin tail 2 (InterPro:IPR010926); Has 312 Blast hits to 312 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 37; Plants - 16; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT5G55810 | AT5G55810.1 | CGATGTCGTTTC | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity.  |
| AT5G57070 | AT5G57070.1 | CGACATCG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, 4 leaf senescence stage, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G72790.1); Has 40764 Blast hits to 20744 proteins in 931 species: Archae - 87; Bacteria - 3708; Metazoa - 18338; Fungi - 5555; Plants - 6701; Viruses - 1377; Other Eukaryotes - 4998 (source: NCBI BLink).  |
| AT5G57460 | AT5G57460.1 | TAAACGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
| AT5G63470 | AT5G63470.1 | CGATGTCGTTTT | NUCLEAR FACTOR Y, SUBUNIT C4 (NF-YC4); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YC1 (NUCLEAR FACTOR Y, SUBUNIT C1); DNA binding / transcription activator/ transcription factor (TAIR:AT3G48590.1); Has 950 Blast hits to 950 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 232; Plants - 264; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT5G63470.2 | CGATGTCGTTTT | NUCLEAR FACTOR Y, SUBUNIT C4 (NF-YC4); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YC1 (NUCLEAR FACTOR Y, SUBUNIT C1); DNA binding / transcription activator/ transcription factor (TAIR:AT3G48590.1); Has 950 Blast hits to 950 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 232; Plants - 264; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT5G65210 | AT5G65210.6 | CGACATCG | TGA1; FUNCTIONS IN: transcription factor activity, calmodulin binding, DNA binding; INVOLVED IN: defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: TGA4 (TGACG MOTIF-BINDING FACTOR 4); DNA binding / calmodulin binding / transcription factor (TAIR:AT5G10030.1); Has 474 Blast hits to 473 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 439; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |