| Locus | Gene model | Sequence | Description |
| AT1G01100 | AT1G01100.1 | AAAGTCAA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
| AT1G01100.2 | AAAGTCAA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
| AT1G01100.3 | AAAGTCAA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
| AT1G01100.4 | AAAGTCAA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
| AT1G01180 | AT1G01180.1 | AGACACGTAAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, hypocotyl; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19270.1); Has 228 Blast hits to 228 proteins in 32 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
| AT1G01550 | AT1G01550.1 | TTGACTTT | BYPASS1, required to prevent constitutive production of a root-derived graft-transmissible signal  |
| AT1G01550.2 | TTGACTTT | BYPASS1, required to prevent constitutive production of a root-derived graft-transmissible signal  |
| AT1G01650 | AT1G01650.1 | AAAGTCAA | aspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
| AT1G01750 | AT1G01750.1 | AAAGTCAA | ACTIN DEPOLYMERIZING FACTOR 11 (ADF11); FUNCTIONS IN: actin binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Actin-binding, cofilin/tropomyosin type (InterPro:IPR002108); BEST Arabidopsis thaliana protein match is: ADF8 (ACTIN DEPOLYMERIZING FACTOR 8); actin binding (TAIR:AT4G00680.1); Has 1202 Blast hits to 1183 proteins in 208 species: Archae - 0; Bacteria - 3; Metazoa - 637; Fungi - 111; Plants - 307; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink).  |
| AT1G02360 | AT1G02360.1 | CCGTTAAAGTCAAAAGTCAA | chitinase, putative; FUNCTIONS IN: chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: stem, leaf whorl, cotyledon, root; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 19 (InterPro:IPR016283), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT4G01700.1); Has 1395 Blast hits to 1389 proteins in 323 species: Archae - 0; Bacteria - 316; Metazoa - 35; Fungi - 2; Plants - 988; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink).  |
| AT1G02410 | AT1G02410.1 | TTGACTTT | cytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink).  |
| AT1G02690 | AT1G02690.1 | AAAGTCAA | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  |
| AT1G02690.2 | AAAGTCAA | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  |
| AT1G02750 | AT1G02750.1 | TTGACTTTAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G02860 | AT1G02860.1 | CGTTTTGACTTT | Encodes a likely ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses.  |
| AT1G02860.2 | CGTTTTGACTTT | Encodes a likely ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses.  |
| AT1G02930 | AT1G02930.1 | TTGACTTT | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).  |
| AT1G03040 | AT1G03040.1 | AAAGTCAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G03220 | AT1G03220.1 | AAAGTCAA | extracellular dermal glycoprotein, putative / EDGP, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: response to salt stress; LOCATED IN: cell wall, plasma membrane, membrane, plant-type cell wall; EXPRESSED IN: stem, root, callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03230.1); Has 790 Blast hits to 787 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 790; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G03230 | AT1G03230.1 | AAAGTCAA | extracellular dermal glycoprotein, putative / EDGP, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: response to salt stress; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: stem, root; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03220.1); Has 798 Blast hits to 797 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 798; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G03470 | AT1G03470.1 | TTGACTTT | kinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT1G03470.2 | TTGACTTT | kinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT1G04820 | AT1G04820.1 | TTGACTTT | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.  |
| AT1G05060 | AT1G05060.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 15 Blast hits to 15 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G05240 | AT1G05240.1 | AAAGTCAA | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: plant-type cell wall; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT1G05250.1); Has 2736 Blast hits to 2721 proteins in 173 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 33; Plants - 2677; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink).  |
| AT1G05500 | AT1G05500.1 | AAAGTCAA | NTMC2T2.1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: SYTD (TAIR:AT5G11100.1); Has 9319 Blast hits to 5090 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 6456; Fungi - 877; Plants - 1262; Viruses - 0; Other Eukaryotes - 724 (source: NCBI BLink).  |
| AT1G06120 | AT1G06120.1 | AAAGTCAA | fatty acid desaturase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); BEST Arabidopsis thaliana protein match is: fatty acid desaturase family protein (TAIR:AT1G06090.1); Has 2696 Blast hits to 2696 proteins in 596 species: Archae - 0; Bacteria - 1082; Metazoa - 689; Fungi - 152; Plants - 71; Viruses - 3; Other Eukaryotes - 699 (source: NCBI BLink).  |
| AT1G06410 | AT1G06410.1 | TTGACTTT | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants.  |
| AT1G07170 | AT1G07170.1 | AAAGTCAAATAAGGCC | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
| AT1G07170.1 | TTGACTTT | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
| AT1G07170.2 | AAAGTCAAATAAGGCC | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
| AT1G07170.2 | TTGACTTT | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
| AT1G07230 | AT1G07230.1 | AAAGTCAA | hydrolase, acting on ester bonds; FUNCTIONS IN: hydrolase activity, acting on ester bonds; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoesterase (InterPro:IPR007312); BEST Arabidopsis thaliana protein match is: phosphoesterase family protein (TAIR:AT2G26870.1); Has 1409 Blast hits to 1383 proteins in 225 species: Archae - 10; Bacteria - 1165; Metazoa - 0; Fungi - 100; Plants - 90; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).  |
| AT1G07310 | AT1G07310.1 | AAAGTCAA | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT5G23950.1); Has 14464 Blast hits to 9550 proteins in 585 species: Archae - 8; Bacteria - 824; Metazoa - 5733; Fungi - 2653; Plants - 3332; Viruses - 448; Other Eukaryotes - 1466 (source: NCBI BLink).  |
| AT1G07320 | AT1G07320.1 | TTGACTTT | encodes a plastid ribosomal protein L4  |
| AT1G07320.2 | TTGACTTT | encodes a plastid ribosomal protein L4  |
| AT1G07320.3 | TTGACTTT | encodes a plastid ribosomal protein L4  |
| AT1G07320.4 | TTGACTTT | encodes a plastid ribosomal protein L4  |
| AT1G08360 | AT1G08360.1 | AAAGTCAA | 60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink).  |
| AT1G08470 | AT1G08470.1 | TTGACTTT | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 898 Blast hits to 891 proteins in 185 species: Archae - 1; Bacteria - 239; Metazoa - 198; Fungi - 13; Plants - 301; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
| AT1G08480 | AT1G08480.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, plastid, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G08540 | AT1G08540.1 | TTGACTTT | Enodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light.  |
| AT1G08680 | AT1G08680.1 | AAAGTCAA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.  |
| AT1G08680.2 | AAAGTCAA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.  |
| AT1G08680.3 | AAAGTCAA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.  |
| AT1G09195 | AT1G09195.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Ppx/GppA phosphatase (InterPro:IPR003695); Has 1514 Blast hits to 1514 proteins in 543 species: Archae - 16; Bacteria - 1249; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink).  |
| AT1G09195.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Ppx/GppA phosphatase (InterPro:IPR003695); Has 1514 Blast hits to 1514 proteins in 543 species: Archae - 16; Bacteria - 1249; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink).  |
| AT1G09220 | AT1G09220.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G56310.1); Has 11726 Blast hits to 4343 proteins in 82 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 10; Plants - 11583; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).  |
| AT1G09420 | AT1G09420.1 | AAAGTCAA | Encodes a protein similar to glucose-6-phosphate dehydrogenase but, based on amino acid differences in the active site and lack of activity, does not encode a functional G6PDH. The amino acid sequence for the consensus sequence of the G6PDH active site (DHYLGKE) differs in three places in this protein. gc exon splice site at 20574 is based on protein alignment, and is not confirmed experimentally.  |
| AT1G09430 | AT1G09430.1 | TTGACTTT | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity.  |
| AT1G10410 | AT1G10410.1 | TTGACTTT | INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: CW14 (TAIR:AT1G59650.1); Has 144 Blast hits to 144 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 2; Plants - 115; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
| AT1G10990 | AT1G10990.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G10990.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G11050 | AT1G11050.1 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: RKF3 (RECEPTOR-LIKE KINASE IN IN FLOWERS 3); kinase/ receptor signaling protein serine/threonine kinase (TAIR:AT2G48010.1); Has 83015 Blast hits to 82195 proteins in 3011 species: Archae - 51; Bacteria - 7345; Metazoa - 36417; Fungi - 6499; Plants - 18575; Viruses - 312; Other Eukaryotes - 13816 (source: NCBI BLink).  |
| AT1G11475 | AT1G11475.1 | TTGACTTT | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10.  |
| AT1G11500 | AT1G11500.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21310.1); Has 50 Blast hits to 50 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G12030 | AT1G12030.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62420.1); Has 213 Blast hits to 213 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 211; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G12250 | AT1G12250.1 | AAAGTCAA | thylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink).  |
| AT1G12250.2 | AAAGTCAA | thylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink).  |
| AT1G12350 | AT1G12350.1 | TTGACTTT | At1g12350 encodes phosphopantothenoylcysteine synthetase (phosphopantothenoylcysteine ligase). Its molecular function was shown to add cysteine forming (R)-4-phospho-N-pantothenoylcysteine (PPC)  |
| AT1G12480 | AT1G12480.1 | TTGACTTT | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane.  |
| AT1G12760 | AT1G12760.1 | TTGACTTT | protein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).  |
| AT1G12760.2 | TTGACTTT | protein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).  |
| AT1G13000 | AT1G13000.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT1G13000.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT1G13150 | AT1G13150.1 | AAAGTCAA | member of CYP86C  |
| AT1G13480 | AT1G13480.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1262 (InterPro:IPR010683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13520.1); Has 67 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G13480.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1262 (InterPro:IPR010683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13520.1); Has 67 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G13750 | AT1G13750.1 | TTGACTTT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Fibronectin, type III (InterPro:IPR003961), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP27 (PURPLE ACID PHOSPHATASE 27); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT5G50400.1); Has 1113 Blast hits to 1105 proteins in 225 species: Archae - 0; Bacteria - 236; Metazoa - 176; Fungi - 60; Plants - 415; Viruses - 0; Other Eukaryotes - 226 (source: NCBI BLink).  |
| AT1G14010 | AT1G14010.1 | CACGTGTTGACTTT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
| AT1G14820 | AT1G14820.1 | AAAGTCAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT1G14820.2 | AAAGTCAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT1G14820.3 | AAAGTCAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT1G14830 | AT1G14830.1 | TTGACTTT | Encodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts.  |
| AT1G15430 | AT1G15430.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G15430.2 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G15700 | AT1G15700.1 | TTGACTTT | One of two genes that encode the gamma subunit of Arabidopsis chloroplast ATP synthase. It is thought to be involved in the regulation of the ATP synthase activity.  |
| AT1G15810 | AT1G15810.1 | TAACCGGAAAAGTCAA | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink).  |
| AT1G16150 | AT1G16150.1 | TTGACTTT | Encodes a cell-wall associated kinase like protein of the receptor-like kinase (RLK) superfamily. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+.  |
| AT1G16160 | AT1G16160.1 | TTGACTTT | WAK-like kinase  |
| AT1G16430 | AT1G16430.1 | TTGACTTT | surfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G07950.1); Has 176 Blast hits to 176 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 4; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT1G16670 | AT1G16670.1 | TTGACTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G09010.1); Has 86261 Blast hits to 85145 proteins in 3101 species: Archae - 56; Bacteria - 7465; Metazoa - 37883; Fungi - 6798; Plants - 18959; Viruses - 382; Other Eukaryotes - 14718 (source: NCBI BLink).  |
| AT1G17860 | AT1G17860.1 | TTGACTTTGACTTT | trypsin and protease inhibitor family protein / Kunitz family protein; FUNCTIONS IN: endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I3, Kunitz legume (InterPro:IPR002160), Kunitz inhibitor ST1-like (InterPro:IPR011065); BEST Arabidopsis thaliana protein match is: trypsin and protease inhibitor family protein / Kunitz family protein (TAIR:AT1G73260.1); Has 508 Blast hits to 508 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 507; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G18000 | AT1G18000.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18010.1); Has 489 Blast hits to 485 proteins in 115 species: Archae - 0; Bacteria - 49; Metazoa - 129; Fungi - 254; Plants - 41; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT1G18490 | AT1G18490.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT1G18490.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT1G19180 | AT1G19180.1 | TTGACTTT | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.  |
| AT1G19180.2 | TTGACTTT | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.  |
| AT1G19270 | AT1G19270.1 | TTGACTTT | DA 1 (DA1); FUNCTIONS IN: ubiquitin binding; INVOLVED IN: seed morphogenesis, ovule morphogenesis, negative regulation of organ growth; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, LIM-type (InterPro:IPR001781), Ubiquitin interacting motif (InterPro:IPR003903); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G36860.1); Has 3015 Blast hits to 2198 proteins in 128 species: Archae - 0; Bacteria - 16; Metazoa - 2644; Fungi - 45; Plants - 90; Viruses - 0; Other Eukaryotes - 220 (source: NCBI BLink).  |
| AT1G19270.1 | TTGACTTT | DA 1 (DA1); FUNCTIONS IN: ubiquitin binding; INVOLVED IN: seed morphogenesis, ovule morphogenesis, negative regulation of organ growth; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, LIM-type (InterPro:IPR001781), Ubiquitin interacting motif (InterPro:IPR003903); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G36860.1); Has 3015 Blast hits to 2198 proteins in 128 species: Archae - 0; Bacteria - 16; Metazoa - 2644; Fungi - 45; Plants - 90; Viruses - 0; Other Eukaryotes - 220 (source: NCBI BLink).  |
| AT1G19380 | AT1G19380.1 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65650.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G19860 | AT1G19860.1 | TTGACTTT | zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT3G51180.1); Has 137 Blast hits to 123 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 6; Plants - 102; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G19890 | AT1G19890.1 | TTGACTTT | histone 3.3, male-gamete-specific expression  |
| AT1G20110 | AT1G20110.1 | TTGACTTT | zinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 25361 Blast hits to 16508 proteins in 676 species: Archae - 11; Bacteria - 1450; Metazoa - 10130; Fungi - 5149; Plants - 3412; Viruses - 575; Other Eukaryotes - 4634 (source: NCBI BLink).  |
| AT1G20410 | AT1G20410.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 431 Blast hits to 403 proteins in 151 species: Archae - 110; Bacteria - 0; Metazoa - 110; Fungi - 3; Plants - 20; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).  |
| AT1G20510 | AT1G20510.1 | AAAGTCAA | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).  |
| AT1G20510.2 | AAAGTCAA | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).  |
| AT1G20640 | AT1G20640.1 | AAAGTCAA | RWP-RK domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: nodulation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035); BEST Arabidopsis thaliana protein match is: RWP-RK domain-containing protein (TAIR:AT1G76350.1); Has 329 Blast hits to 276 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 311; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT1G20640.1 | TTGACTTT | RWP-RK domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: nodulation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035); BEST Arabidopsis thaliana protein match is: RWP-RK domain-containing protein (TAIR:AT1G76350.1); Has 329 Blast hits to 276 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 311; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT1G20640.2 | AAAGTCAA | RWP-RK domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: nodulation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035); BEST Arabidopsis thaliana protein match is: RWP-RK domain-containing protein (TAIR:AT1G76350.1); Has 329 Blast hits to 276 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 311; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT1G20640.2 | TTGACTTT | RWP-RK domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: nodulation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035); BEST Arabidopsis thaliana protein match is: RWP-RK domain-containing protein (TAIR:AT1G76350.1); Has 329 Blast hits to 276 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 311; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT1G21100 | AT1G21100.1 | TTGACTTT | O-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae - 0; Bacteria - 600; Metazoa - 84; Fungi - 432; Plants - 916; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
| AT1G21110 | AT1G21110.1 | TTGACTTT | O-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21120.1); Has 2067 Blast hits to 2064 proteins in 410 species: Archae - 0; Bacteria - 560; Metazoa - 81; Fungi - 421; Plants - 923; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).  |
| AT1G21380 | AT1G21380.1 | AAAGTCAA | VHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Target of Myb protein 1 (InterPro:IPR014645), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT1G76970.1); Has 1297 Blast hits to 1295 proteins in 140 species: Archae - 0; Bacteria - 6; Metazoa - 767; Fungi - 311; Plants - 152; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
| AT1G21390 | AT1G21390.1 | TTGACTTT | embryo defective 2170 (emb2170); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76980.2); Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
| AT1G21550 | AT1G21550.1 | TTGACTTT | calcium-binding protein, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding protein, putative (TAIR:AT4G20780.1); Has 6890 Blast hits to 6643 proteins in 978 species: Archae - 0; Bacteria - 10; Metazoa - 2533; Fungi - 1210; Plants - 1972; Viruses - 0; Other Eukaryotes - 1165 (source: NCBI BLink).  |
| AT1G21670 | AT1G21670.1 | AAAGTCAA | INVOLVED IN: proteolysis; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Peptidase S9B, dipeptidylpeptidase IV N-terminal (InterPro:IPR002469), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21680.1); Has 6126 Blast hits to 3685 proteins in 788 species: Archae - 47; Bacteria - 3362; Metazoa - 27; Fungi - 47; Plants - 58; Viruses - 0; Other Eukaryotes - 2585 (source: NCBI BLink).  |
| AT1G21700 | AT1G21700.1 | TTGACTTTAACCG | a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003).  |
| AT1G21710 | AT1G21710.1 | CGGTTAAAGTCAA | Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme.  |
| AT1G22360 | AT1G22360.1 | TTGACTTT | UDP-glucosyl transferase 85A2 (AtUGT85A2); FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 4893 Blast hits to 4835 proteins in 290 species: Archae - 0; Bacteria - 46; Metazoa - 1935; Fungi - 10; Plants - 2777; Viruses - 95; Other Eukaryotes - 30 (source: NCBI BLink).  |
| AT1G22360.2 | TTGACTTT | UDP-glucosyl transferase 85A2 (AtUGT85A2); FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 4893 Blast hits to 4835 proteins in 290 species: Archae - 0; Bacteria - 46; Metazoa - 1935; Fungi - 10; Plants - 2777; Viruses - 95; Other Eukaryotes - 30 (source: NCBI BLink).  |
| AT1G22500 | AT1G22500.1 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: stem, cotyledon, root, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G72200.1); Has 6507 Blast hits to 6490 proteins in 222 species: Archae - 0; Bacteria - 2; Metazoa - 2224; Fungi - 542; Plants - 2639; Viruses - 59; Other Eukaryotes - 1041 (source: NCBI BLink).  |
| AT1G22550 | AT1G22550.1 | TTGACTTT | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G22570.1); Has 4470 Blast hits to 4427 proteins in 803 species: Archae - 0; Bacteria - 2095; Metazoa - 435; Fungi - 295; Plants - 1111; Viruses - 0; Other Eukaryotes - 534 (source: NCBI BLink).  |
| AT1G22640 | AT1G22640.1 | AAAGTCAA | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression  |
| AT1G23310 | AT1G23310.1 | TTGACTTT | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.  |
| AT1G23310.2 | TTGACTTT | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.  |
| AT1G23480 | AT1G23480.1 | AAAGTCAA | encodes a gene similar to cellulose synthase  |
| AT1G23480.2 | AAAGTCAA | encodes a gene similar to cellulose synthase  |
| AT1G23480.3 | AAAGTCAA | encodes a gene similar to cellulose synthase  |
| AT1G25220 | AT1G25220.1 | TTGACTTT | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2).  |
| AT1G25280 | AT1G25280.1 | TTGACTTT | Member of TLP family  |
| AT1G25390 | AT1G25390.1 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase family protein (TAIR:AT1G66880.1); Has 90575 Blast hits to 89358 proteins in 3412 species: Archae - 59; Bacteria - 7976; Metazoa - 39750; Fungi - 7235; Plants - 19369; Viruses - 561; Other Eukaryotes - 15625 (source: NCBI BLink).  |
| AT1G25682 | AT1G25682.1 | TTGACTTT | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25988.1); Has 517 Blast hits to 517 proteins in 152 species: Archae - 0; Bacteria - 5; Metazoa - 212; Fungi - 149; Plants - 56; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
| AT1G26150 | AT1G26150.1 | TTGACTTT | PROLINE-RICH EXTENSIN-LIKE RECEPTOR KINASE 10 (PERK10); FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G68690.1); Has 437812 Blast hits to 190668 proteins in 4392 species: Archae - 931; Bacteria - 74625; Metazoa - 185213; Fungi - 57061; Plants - 50943; Viruses - 9960; Other Eukaryotes - 59079 (source: NCBI BLink).  |
| AT1G26380 | AT1G26380.1 | AAAGTCAA | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT1G26390.1); Has 2742 Blast hits to 2652 proteins in 436 species: Archae - 26; Bacteria - 1103; Metazoa - 18; Fungi - 1094; Plants - 339; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).  |
| AT1G26390 | AT1G26390.1 | AAAGTCAA | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT1G26420.1); Has 2605 Blast hits to 2524 proteins in 398 species: Archae - 19; Bacteria - 1005; Metazoa - 7; Fungi - 1089; Plants - 331; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT1G27350 | AT1G27350.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
| AT1G27470 | AT1G27470.1 | AAAGTCAA | transducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).  |
| AT1G27480 | AT1G27480.1 | TTGACTTT | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
| AT1G27510 | AT1G27510.1 | AAAGTCAA | INVOLVED IN: response to singlet oxygen; LOCATED IN: thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: EX1 (EXECUTER1) (TAIR:AT4G33630.2); Has 213 Blast hits to 208 proteins in 76 species: Archae - 0; Bacteria - 13; Metazoa - 63; Fungi - 31; Plants - 69; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
| AT1G27520 | AT1G27520.1 | TTGACTTT | glycoside hydrolase family 47 protein; FUNCTIONS IN: mannosyl-oligosaccharide 1,2-alpha-mannosidase activity, alpha-mannosidase activity, calcium ion binding; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 47 (InterPro:IPR001382); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 47 protein (TAIR:AT5G43710.1); Has 1556 Blast hits to 1349 proteins in 142 species: Archae - 0; Bacteria - 8; Metazoa - 690; Fungi - 626; Plants - 92; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT1G27630 | AT1G27630.1 | AAAGTCAAAGCCCATAT | CYCLIN T 1;3 (CYCT1;3); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT5G45190.1); Has 1136 Blast hits to 1136 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 700; Fungi - 230; Plants - 139; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT1G27770 | AT1G27770.1 | TTGACTTT | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor.  |
| AT1G27770.2 | TTGACTTT | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor.  |
| AT1G28250 | AT1G28250.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 10 Blast hits to 10 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G28380 | AT1G28380.1 | AAAGTCAA | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots.  |
| AT1G28710 | AT1G28710.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT1G28710.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT1G29340 | AT1G29340.1 | TTGACTTT | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato.  |
| AT1G29690 | AT1G29690.1 | AAAGTCAA | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic <i>cad1-1</i> mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity.  |
| AT1G30400 | AT1G30400.1 | TTGACTTT | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim.  |
| AT1G30400.2 | TTGACTTT | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim.  |
| AT1G30540 | AT1G30540.1 | AAAGTCAA | ATPase, BadF/BadG/BcrA/BcrD-type family; FUNCTIONS IN: ATPase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, BadF/BadG/BcrA/BcrD type (InterPro:IPR002731); Has 975 Blast hits to 975 proteins in 386 species: Archae - 31; Bacteria - 696; Metazoa - 107; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
| AT1G30550 | AT1G30550.2 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: WW domain-containing protein (TAIR:AT1G45231.2); Has 891 Blast hits to 591 proteins in 275 species: Archae - 68; Bacteria - 248; Metazoa - 211; Fungi - 176; Plants - 45; Viruses - 3; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT1G30620 | AT1G30620.1 | AAAGTCAA | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans.  |
| AT1G30620.2 | AAAGTCAA | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans.  |
| AT1G30620.3 | AAAGTCAA | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans.  |
| AT1G30680 | AT1G30680.1 | TTGACTTT | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).  |
| AT1G30700 | AT1G30700.1 | TTGACTTT | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: stem, hypocotyl, root, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT4G20830.2); Has 2759 Blast hits to 2741 proteins in 499 species: Archae - 11; Bacteria - 1200; Metazoa - 0; Fungi - 1065; Plants - 335; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
| AT1G31220 | AT1G31220.1 | TTGACTTT | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide  |
| AT1G31480 | AT1G31480.1 | TTGACTTT | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole.  |
| AT1G32130 | AT1G32130.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink).  |
| AT1G33250 | AT1G33250.1 | ACCCCTGAAAAGTCAA | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT1G33475 | AT1G33475.1 | AAAGTCAA | INVOLVED IN: transport, vesicle-mediated transport; LOCATED IN: integral to membrane; EXPRESSED IN: inflorescence meristem, male gametophyte, sepal, carpel, petiole; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Longin (InterPro:IPR010908), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synaptobrevin-related family protein (TAIR:AT4G10170.2); Has 148 Blast hits to 148 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G33610 | AT1G33610.1 | TTGACTTT | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, root, petiole, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210); BEST Arabidopsis thaliana protein match is: disease resistance protein-related / LRR protein-related (TAIR:AT1G33590.1); Has 79875 Blast hits to 20687 proteins in 757 species: Archae - 36; Bacteria - 5035; Metazoa - 29153; Fungi - 774; Plants - 39232; Viruses - 6; Other Eukaryotes - 5639 (source: NCBI BLink).  |
| AT1G34370 | AT1G34370.1 | TTAATGGGTTGACTTT | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  |
| AT1G34370.2 | TTAATGGGTTGACTTT | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  |
| AT1G34370.3 | TTAATGGGTTGACTTT | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  |
| AT1G34750 | AT1G34750.1 | AAAGTCAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G22280.1); Has 4748 Blast hits to 4743 proteins in 500 species: Archae - 5; Bacteria - 676; Metazoa - 1255; Fungi - 535; Plants - 1287; Viruses - 11; Other Eukaryotes - 979 (source: NCBI BLink).  |
| AT1G35140 | AT1G35140.1 | TTGACTTT | At1g35140 (At1g35140/T32G9_32) mRNA, complete cds  |
| AT1G35340 | AT1G35340.1 | AAAGTCAA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT1G35340.2 | AAAGTCAA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT1G35340.3 | AAAGTCAA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT1G35460 | AT1G35460.1 | AAAGTCAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT4G09180.1); Has 1117 Blast hits to 1117 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 1112; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G36060 | AT1G36060.1 | AAAGTCAA | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.  |
| AT1G36060.1 | AAAGTCAA | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.  |
| AT1G36980 | AT1G36980.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0220 (InterPro:IPR007919); Has 305 Blast hits to 305 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 189; Fungi - 71; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT1G44750 | AT1G44750.2 | AAAGTCAA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.  |
| AT1G44750.3 | AAAGTCAA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.  |
| AT1G48640 | AT1G48640.1 | TTGACTTT | lysine and histidine specific transporter, putative; FUNCTIONS IN: amino acid transmembrane transporter activity; INVOLVED IN: amino acid transport; LOCATED IN: membrane; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: LHT1; amino acid transmembrane transporter (TAIR:AT5G40780.1); Has 2563 Blast hits to 2559 proteins in 216 species: Archae - 2; Bacteria - 76; Metazoa - 856; Fungi - 386; Plants - 883; Viruses - 0; Other Eukaryotes - 360 (source: NCBI BLink).  |
| AT1G48790 | AT1G48790.1 | AAAGTCAA | mov34 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 807 Blast hits to 679 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 425; Fungi - 178; Plants - 110; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
| AT1G51610 | AT1G51610.1 | TTGACTTT | cation efflux family protein / metal tolerance protein, putative (MTPc4); FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); Has 1695 Blast hits to 1693 proteins in 577 species: Archae - 81; Bacteria - 1248; Metazoa - 115; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).  |
| AT1G52000 | AT1G52000.1 | TTGACTTT | jacalin lectin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 138776 Blast hits to 45591 proteins in 2061 species: Archae - 382; Bacteria - 44225; Metazoa - 34835; Fungi - 8746; Plants - 9137; Viruses - 1952; Other Eukaryotes - 39499 (source: NCBI BLink).  |
| AT1G52200 | AT1G52200.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: plasma membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18470.1); Has 371 Blast hits to 370 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 47; Plants - 295; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G52200.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: plasma membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18470.1); Has 371 Blast hits to 370 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 47; Plants - 295; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G52200.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: plasma membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18470.1); Has 371 Blast hits to 370 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 47; Plants - 295; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G52410 | AT1G52410.1 | TTGACTTT | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers.  |
| AT1G52410.2 | TTGACTTT | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers.  |
| AT1G53300 | AT1G53300.1 | AAAGTCAA | TETRATRICOPETIDE-REPEAT THIOREDOXIN-LIKE 1 (TTL1); FUNCTIONS IN: binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Tetratricopeptide TPR-1 (InterPro:IPR001440), Thioredoxin fold (InterPro:IPR012335), Tetratricopeptide-like helical (InterPro:IPR011990), Thioredoxin domain (InterPro:IPR013766), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: TTL2 (Tetratricopetide-repeat Thioredoxin-Like 2); binding (TAIR:AT3G14950.1); Has 27236 Blast hits to 12519 proteins in 865 species: Archae - 398; Bacteria - 4328; Metazoa - 7637; Fungi - 2832; Plants - 1650; Viruses - 126; Other Eukaryotes - 10265 (source: NCBI BLink).  |
| AT1G54115 | AT1G54115.1 | TTGACTTT | Involved in cation (Na and K) homeostasis.  |
| AT1G54200 | AT1G54200.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13980.1); Has 1298 Blast hits to 515 proteins in 102 species: Archae - 0; Bacteria - 43; Metazoa - 442; Fungi - 73; Plants - 54; Viruses - 0; Other Eukaryotes - 686 (source: NCBI BLink).  |
| AT1G54460 | AT1G54460.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: WDL1 (TAIR:AT3G04630.3); Has 393 Blast hits to 375 proteins in 76 species: Archae - 0; Bacteria - 3; Metazoa - 143; Fungi - 38; Plants - 160; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
| AT1G54740 | AT1G54740.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G22110.1); Has 479 Blast hits to 317 proteins in 60 species: Archae - 0; Bacteria - 25; Metazoa - 81; Fungi - 16; Plants - 88; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink).  |
| AT1G54880 | AT1G54880.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G54890 | AT1G54890.1 | AAAGTCAA | late embryogenesis abundant protein-related / LEA protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Root cap (InterPro:IPR009646); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein-related / LEA protein-related (TAIR:AT5G54370.1); Has 107 Blast hits to 107 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 107; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G55430 | AT1G55430.1 | TTGACTTT | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G55380.1); Has 1074 Blast hits to 455 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1070; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT1G55450 | AT1G55450.1 | AAAGTCAA | embryo-abundant protein-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: response to salt stress; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: embryo-abundant protein-related (TAIR:AT3G54150.1); Has 634 Blast hits to 630 proteins in 232 species: Archae - 4; Bacteria - 330; Metazoa - 59; Fungi - 75; Plants - 109; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |
| AT1G55475 | AT1G55475.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13480.1); Has 42 Blast hits to 42 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G55840 | AT1G55840.1 | TTGACTTT | SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / polyphosphoinositide-binding protein, putative (TAIR:AT5G47730.1); Has 1377 Blast hits to 1376 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 557; Fungi - 269; Plants - 406; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).  |
| AT1G55840.2 | TTGACTTT | SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / polyphosphoinositide-binding protein, putative (TAIR:AT5G47730.1); Has 1377 Blast hits to 1376 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 557; Fungi - 269; Plants - 406; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).  |
| AT1G56550 | AT1G56550.1 | GTGTCGTTGACTTT | UDP-xylosyltransferase; FUNCTIONS IN: UDP-xylosyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: fruit distal end, rosette leaf, cauline leaf, fruit proximal end, socket cell; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01220.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 166; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
| AT1G56580 | AT1G56580.1 | TTGACTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09310.1); Has 167 Blast hits to 165 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 167; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G57700 | AT1G57700.1 | TTGACTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G09600.1); Has 86309 Blast hits to 85244 proteins in 2596 species: Archae - 42; Bacteria - 7073; Metazoa - 37056; Fungi - 7956; Plants - 17619; Viruses - 388; Other Eukaryotes - 16175 (source: NCBI BLink).  |
| AT1G58400 | AT1G58400.1 | TTGACTTT | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT1G58410.1); Has 10560 Blast hits to 9857 proteins in 355 species: Archae - 2; Bacteria - 266; Metazoa - 774; Fungi - 37; Plants - 9354; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
| AT1G59640 | AT1G59640.1 | AAAGTCAA | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS.  |
| AT1G59640.2 | AAAGTCAA | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS.  |
| AT1G61100 | AT1G61100.1 | AAAGTCAA | disease resistance protein (TIR class), putative; INVOLVED IN: defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: CIP7 (COP1-INTERACTING PROTEIN 7); transcription activator (TAIR:AT4G27430.2); Has 1483 Blast hits to 1173 proteins in 180 species: Archae - 4; Bacteria - 96; Metazoa - 658; Fungi - 133; Plants - 105; Viruses - 8; Other Eukaryotes - 479 (source: NCBI BLink).  |
| AT1G61570 | AT1G61570.1 | AAAGTCAA | Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space.  |
| AT1G63660 | AT1G63660.1 | TTGACTTT | GMP synthase (glutamine-hydrolyzing), putative / glutamine amidotransferase, putative; FUNCTIONS IN: catalytic activity, GMP synthase (glutamine-hydrolyzing) activity, ATP binding; INVOLVED IN: in 6 processes; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine amidotransferase class-I, C-terminal (InterPro:IPR000991), Glutamine amidotransferase superfamily (InterPro:IPR011702), GMP synthase, N-terminal (InterPro:IPR004739), GMP synthase, C-terminal (InterPro:IPR001674), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Glutamine amidotransferase type 1 (InterPro:IPR017926), Anthranilate synthase component II/delta crystallin (InterPro:IPR006220), tRNA methyl transferase-like (InterPro:IPR018318); Has 14506 Blast hits to 14404 proteins in 1630 species: Archae - 471; Bacteria - 6378; Metazoa - 178; Fungi - 197; Plants - 83; Viruses - 0; Other Eukaryotes - 7199 (source: NCBI BLink).  |
| AT1G63660.2 | TTGACTTT | GMP synthase (glutamine-hydrolyzing), putative / glutamine amidotransferase, putative; FUNCTIONS IN: catalytic activity, GMP synthase (glutamine-hydrolyzing) activity, ATP binding; INVOLVED IN: in 6 processes; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine amidotransferase class-I, C-terminal (InterPro:IPR000991), Glutamine amidotransferase superfamily (InterPro:IPR011702), GMP synthase, N-terminal (InterPro:IPR004739), GMP synthase, C-terminal (InterPro:IPR001674), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Glutamine amidotransferase type 1 (InterPro:IPR017926), Anthranilate synthase component II/delta crystallin (InterPro:IPR006220), tRNA methyl transferase-like (InterPro:IPR018318); Has 14506 Blast hits to 14404 proteins in 1630 species: Archae - 471; Bacteria - 6378; Metazoa - 178; Fungi - 197; Plants - 83; Viruses - 0; Other Eukaryotes - 7199 (source: NCBI BLink).  |
| AT1G65845 | AT1G65845.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G66530 | AT1G66530.1 | TTGACTTT | arginyl-tRNA synthetase, putative / arginine--tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae - 156; Bacteria - 2983; Metazoa - 242; Fungi - 116; Plants - 35; Viruses - 3; Other Eukaryotes - 3003 (source: NCBI BLink).  |
| AT1G66930 | AT1G66930.1 | AAAGTCAA | serine/threonine protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G67000.1); Has 85221 Blast hits to 83970 proteins in 3159 species: Archae - 75; Bacteria - 7164; Metazoa - 37987; Fungi - 6777; Plants - 18536; Viruses - 358; Other Eukaryotes - 14324 (source: NCBI BLink).  |
| AT1G67856 | AT1G67856.1 | TTGACTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G24580.1); Has 3925 Blast hits to 3916 proteins in 187 species: Archae - 0; Bacteria - 0; Metazoa - 1142; Fungi - 305; Plants - 1895; Viruses - 19; Other Eukaryotes - 564 (source: NCBI BLink).  |
| AT1G69410 | AT1G69410.1 | TTGACTTT | EUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation protein SH3-like, subgroup (InterPro:IPR014722), Eukaryotic initiation factor 5A hypusine (eIF-5A) (InterPro:IPR001884); BEST Arabidopsis thaliana protein match is: ELF5A-1 (EUKARYOTIC ELONGATION FACTOR 5A-1); translation initiation factor (TAIR:AT1G13950.1); Has 986 Blast hits to 984 proteins in 296 species: Archae - 160; Bacteria - 0; Metazoa - 294; Fungi - 163; Plants - 195; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).  |
| AT1G69410.1 | TTGACTTT | EUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation protein SH3-like, subgroup (InterPro:IPR014722), Eukaryotic initiation factor 5A hypusine (eIF-5A) (InterPro:IPR001884); BEST Arabidopsis thaliana protein match is: ELF5A-1 (EUKARYOTIC ELONGATION FACTOR 5A-1); translation initiation factor (TAIR:AT1G13950.1); Has 986 Blast hits to 984 proteins in 296 species: Archae - 160; Bacteria - 0; Metazoa - 294; Fungi - 163; Plants - 195; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).  |
| AT1G69510 | AT1G69510.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G69510.2 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G69510.3 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G70520 | AT1G70520.1 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G40380.1); Has 88792 Blast hits to 87702 proteins in 3400 species: Archae - 53; Bacteria - 7706; Metazoa - 38917; Fungi - 6981; Plants - 19431; Viruses - 436; Other Eukaryotes - 15268 (source: NCBI BLink).  |
| AT1G70660 | AT1G70660.1 | AAAGTCAA | MMZ2/UEV1B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1A can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. However, a combination of MMZ2/UEV1B and UBC13A do not do a good job of rescuing an mms2 ubc13 double mutant in yeast. MMZ2/UEV1B transcripts are found in most plant organs, but not in the pollen or in seedlings 6 hours or 2 days post-germination. The transcript levels do not appear to be stress-inducible.  |
| AT1G71170 | AT1G71170.1 | TTGACTTT | 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, phosphogluconate dehydrogenase (decarboxylating) activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 10923 Blast hits to 10908 proteins in 1167 species: Archae - 86; Bacteria - 5485; Metazoa - 273; Fungi - 222; Plants - 147; Viruses - 0; Other Eukaryotes - 4710 (source: NCBI BLink).  |
| AT1G72870 | AT1G72870.1 | TTGACTTT | disease resistance protein (TIR-NBS class), putative; FUNCTIONS IN: transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: stem, sperm cell, root; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS class), putative (TAIR:AT1G72850.1); Has 5583 Blast hits to 5277 proteins in 187 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 5572; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G73150 | AT1G73150.1 | AAAGTCAA | Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1.  |
| AT1G73490 | AT1G73490.1 | AAAGTCAAGGCCCAGCC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATNUC-L1; nucleic acid binding / nucleotide binding (TAIR:AT1G48920.1); Has 51 Blast hits to 47 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G74020 | AT1G74020.1 | TTGACTTT | Encodes AtSS-2 strictosidine synthase.  |
| AT1G75780 | AT1G75780.1 | AAAGTCAA | beta tubulin gene downregulated by phytochrome A (phyA)-mediated far-red light high-irradiance and the phytochrome B (phyB)-mediated red light high-irradiance responses  |
| AT1G75870 | AT1G75870.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G76120 | AT1G76120.1 | TTGACTTT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink).  |
| AT1G76120.2 | TTGACTTT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink).  |
| AT1G76390 | AT1G76390.1 | TTGACTTT | armadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: SAUL1 (SENESCENCE-ASSOCIATED E3 UBIQUITIN LIGASE 1); ubiquitin-protein ligase (TAIR:AT1G20780.1); Has 1744 Blast hits to 1602 proteins in 148 species: Archae - 0; Bacteria - 24; Metazoa - 285; Fungi - 205; Plants - 1070; Viruses - 3; Other Eukaryotes - 157 (source: NCBI BLink).  |
| AT1G76390.2 | TTGACTTT | armadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: SAUL1 (SENESCENCE-ASSOCIATED E3 UBIQUITIN LIGASE 1); ubiquitin-protein ligase (TAIR:AT1G20780.1); Has 1744 Blast hits to 1602 proteins in 148 species: Archae - 0; Bacteria - 24; Metazoa - 285; Fungi - 205; Plants - 1070; Viruses - 3; Other Eukaryotes - 157 (source: NCBI BLink).  |
| AT1G76430 | AT1G76430.1 | AAAGTCAA | phosphate transporter family protein; FUNCTIONS IN: phosphate transmembrane transporter activity, carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: phosphate transporter family protein (TAIR:AT1G20860.1); Has 19656 Blast hits to 19588 proteins in 1299 species: Archae - 338; Bacteria - 12582; Metazoa - 1996; Fungi - 2895; Plants - 1005; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink).  |
| AT1G77122 | AT1G77122.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0090 (InterPro:IPR003728); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69210.1); Has 5575 Blast hits to 1500 proteins in 157 species: Archae - 0; Bacteria - 130; Metazoa - 4006; Fungi - 245; Plants - 178; Viruses - 112; Other Eukaryotes - 904 (source: NCBI BLink).  |
| AT1G77170 | AT1G77170.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21065.1); Has 13329 Blast hits to 4897 proteins in 128 species: Archae - 0; Bacteria - 6; Metazoa - 82; Fungi - 52; Plants - 12909; Viruses - 0; Other Eukaryotes - 280 (source: NCBI BLink).  |
| AT1G77810 | AT1G77810.1 | AAAGTCAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT1G77810.2 | AAAGTCAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT1G78830 | AT1G78830.1 | TTGACTTT | curculin-like (mannose-binding) lectin family protein; FUNCTIONS IN: sugar binding; LOCATED IN: apoplast, cell wall, plasma membrane, plant-type cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480); BEST Arabidopsis thaliana protein match is: curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein (TAIR:AT1G78820.1); Has 1508 Blast hits to 1477 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 1503; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G79110 | AT1G79110.1 | TTGACTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G12920.1); Has 877 Blast hits to 874 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 503; Fungi - 4; Plants - 253; Viruses - 24; Other Eukaryotes - 93 (source: NCBI BLink).  |
| AT1G79110.2 | TTGACTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G12920.1); Has 877 Blast hits to 874 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 503; Fungi - 4; Plants - 253; Viruses - 24; Other Eukaryotes - 93 (source: NCBI BLink).  |
| AT1G80320 | AT1G80320.1 | TTGACTTT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT1G15540.1); Has 3679 Blast hits to 3633 proteins in 489 species: Archae - 0; Bacteria - 380; Metazoa - 45; Fungi - 280; Plants - 2476; Viruses - 0; Other Eukaryotes - 498 (source: NCBI BLink).  |
| AT1G80460 | AT1G80460.1 | AAAGTCAA | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1.  |
| AT1G80460.2 | AAAGTCAA | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1.  |
| AT1G80520 | AT1G80520.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15760.1); Has 30 Blast hits to 30 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G80620 | AT1G80620.1 | TTGACTTT | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G15810.1); Has 5440 Blast hits to 5440 proteins in 1548 species: Archae - 0; Bacteria - 3063; Metazoa - 73; Fungi - 72; Plants - 237; Viruses - 0; Other Eukaryotes - 1995 (source: NCBI BLink).  |
| AT1G80670 | AT1G80670.1 | AAAGTCAACATTGGGCCATAATAAGGCCCAAATATTAGGCCC | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
| AT1G80770 | AT1G80770.1 | AAAGTCAA | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink).  |
| AT1G80920 | AT1G80920.1 | AAAGTCAA | J8 mRNA, nuclear gene encoding plastid protein, complete  |
| AT2G01150 | AT2G01150.1 | TTGACTTT | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils.  |
| AT2G01180 | AT2G01180.1 | AAAGTCAAAAGTCAA | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  |
| AT2G01180.2 | AAAGTCAAAAGTCAA | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  |
| AT2G01400 | AT2G01400.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G01600 | AT2G01600.1 | TTGACTTT | epsin N-terminal homology (ENTH) domain-containing protein; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: N-terminal protein myristoylation, clathrin coat assembly; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT1G14910.1); Has 692 Blast hits to 673 proteins in 140 species: Archae - 0; Bacteria - 10; Metazoa - 279; Fungi - 125; Plants - 239; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT2G01650 | AT2G01650.1 | AAAGTCAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.  |
| AT2G02230 | AT2G02230.1 | TTGACTTT | Phloem protein 2-B1 (AtPP2-B1); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: MEE66 (maternal effect embryo arrest 66) (TAIR:AT2G02240.1); Has 319 Blast hits to 306 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 319; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G02510 | AT2G02510.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G03620 | AT2G03620.1 | TTGACTTT | magnesium transporter CorA-like family protein (MRS2-5); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 474 Blast hits to 455 proteins in 110 species: Archae - 0; Bacteria - 4; Metazoa - 60; Fungi - 144; Plants - 205; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
| AT2G03620.2 | TTGACTTT | magnesium transporter CorA-like family protein (MRS2-5); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 474 Blast hits to 455 proteins in 110 species: Archae - 0; Bacteria - 4; Metazoa - 60; Fungi - 144; Plants - 205; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
| AT2G04570 | AT2G04570.1 | AAAGTCAATCCAACGG | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT2G42990.1); Has 1917 Blast hits to 1901 proteins in 192 species: Archae - 0; Bacteria - 317; Metazoa - 1; Fungi - 22; Plants - 1561; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT2G04680 | AT2G04680.1 | TTGACTTT | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT5G37620.1); Has 1365 Blast hits to 514 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 5; Plants - 1305; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
| AT2G05380 | AT2G05380.1 | TTGACTTT | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete  |
| AT2G05380.2 | TTGACTTT | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete  |
| AT2G05440 | AT2G05440.1 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.2 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.3 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.4 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.5 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.6 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.7 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05440.8 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800); Has 135404 Blast hits to 30795 proteins in 1653 species: Archae - 203; Bacteria - 38133; Metazoa - 52051; Fungi - 9048; Plants - 12755; Viruses - 1454; Other Eukaryotes - 21760 (source: NCBI BLink).  |
| AT2G05520 | AT2G05520.1 | TTGACTTT | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication.  |
| AT2G05520.2 | TTGACTTT | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication.  |
| AT2G05520.3 | TTGACTTT | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication.  |
| AT2G05520.4 | TTGACTTT | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication.  |
| AT2G05520.5 | TTGACTTT | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication.  |
| AT2G05520.6 | TTGACTTT | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication.  |
| AT2G05910 | AT2G05910.1 | AAAGTCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G07180 | AT2G07180.1 | AAAGTCAAGTCGTTTC | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 83377 Blast hits to 82332 proteins in 3112 species: Archae - 42; Bacteria - 7499; Metazoa - 37069; Fungi - 6338; Plants - 18225; Viruses - 294; Other Eukaryotes - 13910 (source: NCBI BLink).  |
| AT2G15830 | AT2G15830.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G33960.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G16090 | AT2G16090.1 | AAAGTCAA | zinc finger protein-related; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ARI1 (ARIADNE); protein binding / zinc ion binding (TAIR:AT4G34370.1); Has 2342 Blast hits to 2323 proteins in 162 species: Archae - 0; Bacteria - 0; Metazoa - 1168; Fungi - 383; Plants - 350; Viruses - 11; Other Eukaryotes - 430 (source: NCBI BLink).  |
| AT2G16595 | AT2G16595.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: translocon-associated protein alpha (TRAP alpha) family protein (TAIR:AT2G21160.1); Has 191 Blast hits to 191 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
| AT2G17220 | AT2G17220.1 | TTGACTTT | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT1G76360.1); Has 83008 Blast hits to 81884 proteins in 2869 species: Archae - 42; Bacteria - 7503; Metazoa - 36838; Fungi - 6259; Plants - 18395; Viruses - 323; Other Eukaryotes - 13648 (source: NCBI BLink).  |
| AT2G17220.2 | TTGACTTT | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT1G76360.1); Has 83008 Blast hits to 81884 proteins in 2869 species: Archae - 42; Bacteria - 7503; Metazoa - 36838; Fungi - 6259; Plants - 18395; Viruses - 323; Other Eukaryotes - 13648 (source: NCBI BLink).  |
| AT2G17720 | AT2G17720.1 | AAAGTCAA | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G35810.1); Has 1856 Blast hits to 1846 proteins in 220 species: Archae - 0; Bacteria - 197; Metazoa - 947; Fungi - 57; Plants - 221; Viruses - 14; Other Eukaryotes - 420 (source: NCBI BLink).  |
| AT2G18350 | AT2G18350.1 | AAAGTCAAAGTCAA | ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 24 (AtHB24); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox domain, ZF-HD class (InterPro:IPR006455), ZF-HD homeobox protein Cys/His-rich dimerisation region (InterPro:IPR006456), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: AtHB33 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 33); DNA binding / transcription factor (TAIR:AT1G75240.1); Has 258 Blast hits to 249 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 258; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G18960 | AT2G18960.1 | AAAGTCAA | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA.  |
| AT2G19060 | AT2G19060.1 | TTGACTTT | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT2G19050.1); Has 1694 Blast hits to 1679 proteins in 123 species: Archae - 0; Bacteria - 164; Metazoa - 1; Fungi - 6; Plants - 1511; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT2G19130 | AT2G19130.1 | TTGACTTT | S-locus lectin protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, sugar binding, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), Apple-like (InterPro:IPR003609), N/apple PAN (InterPro:IPR003014), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858), EGF (InterPro:IPR006210); BEST Arabidopsis thaliana protein match is: RLK4 (RECEPTOR-LIKE PROTEIN KINASE 4); protein kinase/ sugar binding (TAIR:AT4G00340.1); Has 83755 Blast hits to 82736 proteins in 3084 species: Archae - 44; Bacteria - 7135; Metazoa - 36745; Fungi - 6296; Plants - 19296; Viruses - 372; Other Eukaryotes - 13867 (source: NCBI BLink).  |
| AT2G19980 | AT2G19980.1 | TTGACTTT | allergen V5/Tpx-1-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: male gametophyte, sepal, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: pathogenesis-related protein, putative (TAIR:AT2G19970.1); Has 1405 Blast hits to 1361 proteins in 204 species: Archae - 0; Bacteria - 27; Metazoa - 666; Fungi - 133; Plants - 566; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT2G20130 | AT2G20130.1 | AAAGTCAA | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink).  |
| AT2G20140 | AT2G20140.1 | TTGACTTT | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink).  |
| AT2G20142 | AT2G20142.1 | AAAGTCAA | transmembrane receptor; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT5G46510.1); Has 991 Blast hits to 928 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 991; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G20830 | AT2G20830.2 | AAAGTCAA | folic acid binding / transferase; FUNCTIONS IN: folic acid binding, transferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Formiminotransferase, N-terminal (InterPro:IPR012886), Protein of unknown function DUF1715, eukaryotic (InterPro:IPR013179), Formiminotransferase (InterPro:IPR004227); Has 518 Blast hits to 515 proteins in 123 species: Archae - 8; Bacteria - 128; Metazoa - 139; Fungi - 30; Plants - 55; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
| AT2G20830.2 | AAAGTCAA | folic acid binding / transferase; FUNCTIONS IN: folic acid binding, transferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Formiminotransferase, N-terminal (InterPro:IPR012886), Protein of unknown function DUF1715, eukaryotic (InterPro:IPR013179), Formiminotransferase (InterPro:IPR004227); Has 518 Blast hits to 515 proteins in 123 species: Archae - 8; Bacteria - 128; Metazoa - 139; Fungi - 30; Plants - 55; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
| AT2G20835 | AT2G20835.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15534.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G20835.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15534.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G21060 | AT2G21060.1 | AAAGTCAA | glycine-rich protein (AtGRP2b)  |
| AT2G22125 | AT2G22125.1 | AAAGTCAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Armadillo (InterPro:IPR000225), C2 membrane targeting protein (InterPro:IPR018029), Armadillo-type fold (InterPro:IPR016024), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77460.1); Has 4878 Blast hits to 2097 proteins in 211 species: Archae - 4; Bacteria - 40; Metazoa - 1542; Fungi - 619; Plants - 2223; Viruses - 0; Other Eukaryotes - 450 (source: NCBI BLink).  |
| AT2G22310 | AT2G22310.1 | TTGACTTT | Encodes a ubiquitin-specific protease.  |
| AT2G22490 | AT2G22490.1 | TTGACTTT | encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A.  |
| AT2G23200 | AT2G23200.1 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G24010.1); Has 84557 Blast hits to 83574 proteins in 3217 species: Archae - 42; Bacteria - 7514; Metazoa - 37328; Fungi - 6606; Plants - 18341; Viruses - 374; Other Eukaryotes - 14352 (source: NCBI BLink).  |
| AT2G23320 | AT2G23320.1 | TTGACTTT | Encodes WRKY DNA-binding protein 15 (WRKY15).  |
| AT2G23320.2 | TTGACTTT | Encodes WRKY DNA-binding protein 15 (WRKY15).  |
| AT2G23520 | AT2G23520.1 | AAAGTCAA | catalytic/ pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: catalytic/ pyridoxal phosphate binding (TAIR:AT4G37100.1); Has 361 Blast hits to 314 proteins in 102 species: Archae - 6; Bacteria - 16; Metazoa - 93; Fungi - 74; Plants - 125; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT2G23770 | AT2G23770.1 | TTGACTTT | protein kinase family protein / peptidoglycan-binding LysM domain-containing protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation, cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: stem, leaf whorl, root, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Immunoglobulin-like (InterPro:IPR007110), Peptidoglycan-binding Lysin subgroup (InterPro:IPR002482), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein / peptidoglycan-binding LysM domain-containing protein (TAIR:AT2G33580.1); Has 67037 Blast hits to 66413 proteins in 1968 species: Archae - 40; Bacteria - 5289; Metazoa - 29959; Fungi - 4517; Plants - 16011; Viruses - 309; Other Eukaryotes - 10912 (source: NCBI BLink).  |
| AT2G24170 | AT2G24170.1 | TTGACTTT | endomembrane protein 70, putative; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G10840.1); Has 1023 Blast hits to 1007 proteins in 164 species: Archae - 0; Bacteria - 2; Metazoa - 447; Fungi - 144; Plants - 237; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
| AT2G27590 | AT2G27590.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT2G27610 | AT2G27610.1 | TTGACTTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G13650.1); Has 19079 Blast hits to 5518 proteins in 198 species: Archae - 2; Bacteria - 20; Metazoa - 154; Fungi - 169; Plants - 18325; Viruses - 0; Other Eukaryotes - 409 (source: NCBI BLink).  |
| AT2G28060 | AT2G28060.1 | TTGACTTT | protein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 5-AMP-activated protein kinase, beta subunit, complex-interacting region (InterPro:IPR006828); BEST Arabidopsis thaliana protein match is: 5'-AMP-activated protein kinase beta-2 subunit, putative (TAIR:AT5G21170.2); Has 275 Blast hits to 275 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 16; Plants - 80; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT2G29450 | AT2G29450.1 | AAAGTCAA | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002)  |
| AT2G29700 | AT2G29700.1 | TTGACTTT | Encodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension  |
| AT2G30020 | AT2G30020.1 | AAAGTCAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: defense response to fungus, response to fungus, response to wounding; LOCATED IN: chloroplast, protein serine/threonine phosphatase complex; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G07160.1); Has 4574 Blast hits to 4418 proteins in 318 species: Archae - 2; Bacteria - 193; Metazoa - 1512; Fungi - 545; Plants - 1316; Viruses - 9; Other Eukaryotes - 997 (source: NCBI BLink).  |
| AT2G30410 | AT2G30410.1 | TTGACTTT | mutant has embryo defect; enlarged embryo cells and endosperm nuclei; Tubulin Folding Cofactor A  |
| AT2G30440 | AT2G30440.1 | TTGACTTT | chloroplast thylakoidal processing peptidase; FUNCTIONS IN: serine-type peptidase activity, peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927), Peptidase S26A, signal peptidase I (InterPro:IPR000223), Peptidase S26A (InterPro:IPR014037); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT1G06870.1); Has 5856 Blast hits to 5751 proteins in 1301 species: Archae - 0; Bacteria - 3613; Metazoa - 183; Fungi - 69; Plants - 112; Viruses - 0; Other Eukaryotes - 1879 (source: NCBI BLink).  |
| AT2G30470 | AT2G30470.1 | AAAGTCAA | HSI2 is a member of a novel family of B3 domain proteins with a sequence similar to the ERF-associated amphiphilic repression (EAR) motif. It functions as an active repressor of the Spo minimal promoter (derived from a gene for sweet potato sporamin A1) through the EAR motif. It contains a plant-specific B3 DNA-binding domain. The Arabidopsis genome contains 42 genes with B3 domains which could be classified into three families that are represented by ABI3, ARF1 and RAV1. HSI2 belongs to the ABI3 family. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50µM ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain.  |
| AT2G30840 | AT2G30840.1 | AAAGTCAA | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  |
| AT2G30840.1 | TTGACTTT | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  |
| AT2G30870 | AT2G30870.1 | AAAGTCAA | early dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002)  |
| AT2G30930 | AT2G30930.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G06540.1); Has 160 Blast hits to 144 proteins in 62 species: Archae - 0; Bacteria - 81; Metazoa - 13; Fungi - 20; Plants - 8; Viruses - 3; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT2G31083 | AT2G31083.1 | AAAGTCAA | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.  |
| AT2G31260 | AT2G31260.1 | TTGACTTT | Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence.  |
| AT2G31710 | AT2G31710.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05780.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G31800 | AT2G31800.1 | AAAGTCAA | ankyrin protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: regulation of signal transduction, protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Integrin-linked protein kinase (InterPro:IPR016253), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin protein kinase, putative (APK1) (TAIR:AT2G43850.1); Has 124713 Blast hits to 96962 proteins in 3024 species: Archae - 103; Bacteria - 9310; Metazoa - 61180; Fungi - 9043; Plants - 18707; Viruses - 698; Other Eukaryotes - 25672 (source: NCBI BLink).  |
| AT2G31800.1 | AAAGTCAA | ankyrin protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: regulation of signal transduction, protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Integrin-linked protein kinase (InterPro:IPR016253), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin protein kinase, putative (APK1) (TAIR:AT2G43850.1); Has 124713 Blast hits to 96962 proteins in 3024 species: Archae - 103; Bacteria - 9310; Metazoa - 61180; Fungi - 9043; Plants - 18707; Viruses - 698; Other Eukaryotes - 25672 (source: NCBI BLink).  |
| AT2G31970 | AT2G31970.1 | TTGACTTT | RAD50; FUNCTIONS IN: zinc ion binding, ATP binding, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chromosome, Mre11 complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc hook, Rad50 (InterPro:IPR013134), Rad50 zinc hook (InterPro:IPR007517), RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395), Recombination/repair protein Rad50 (InterPro:IPR004584); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 83241 Blast hits to 43267 proteins in 1813 species: Archae - 1109; Bacteria - 10221; Metazoa - 39962; Fungi - 5795; Plants - 2652; Viruses - 436; Other Eukaryotes - 23066 (source: NCBI BLink).  |
| AT2G32170 | AT2G32170.1 | TTGACTTT | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: N2227-like (InterPro:IPR012901); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32160.3).  |
| AT2G32170.2 | TTGACTTT | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: N2227-like (InterPro:IPR012901); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32160.3).  |
| AT2G32760 | AT2G32760.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 147 Blast hits to 147 proteins in 66 species: Archae - 0; Bacteria - 2; Metazoa - 63; Fungi - 55; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT2G33580 | AT2G33580.1 | AAAGTCAA | protein kinase family protein / peptidoglycan-binding LysM domain-containing protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation, cell wall macromolecule catabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein / peptidoglycan-binding LysM domain-containing protein (TAIR:AT2G23770.1); Has 73583 Blast hits to 72807 proteins in 2831 species: Archae - 40; Bacteria - 6039; Metazoa - 33365; Fungi - 5168; Plants - 16933; Viruses - 330; Other Eukaryotes - 11708 (source: NCBI BLink).  |
| AT2G34180 | AT2G34180.1 | AAAGTCAA | Encodes CBL-interacting protein kinase 13 (CIPK13).  |
| AT2G34400 | AT2G34400.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G22410.1); Has 14623 Blast hits to 5296 proteins in 169 species: Archae - 0; Bacteria - 4; Metazoa - 195; Fungi - 114; Plants - 13938; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).  |
| AT2G34860 | AT2G34860.1 | AAAGTCAA | embryo sac development arrest 3 (EDA3); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: megagametogenesis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 481 Blast hits to 481 proteins in 149 species: Archae - 26; Bacteria - 225; Metazoa - 10; Fungi - 2; Plants - 96; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).  |
| AT2G34860.2 | AAAGTCAA | embryo sac development arrest 3 (EDA3); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: megagametogenesis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 481 Blast hits to 481 proteins in 149 species: Archae - 26; Bacteria - 225; Metazoa - 10; Fungi - 2; Plants - 96; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).  |
| AT2G35000 | AT2G35000.1 | AAAGTCAA | E3 ligase-like protein induced by chitin oligomers.  |
| AT2G35190 | AT2G35190.1 | AAAGTCAA | plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate.  |
| AT2G35780 | AT2G35780.1 | AAAGTCAA | serine carboxypeptidase-like 26 (scpl26); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL27 (serine carboxypeptidase-like 27); serine-type carboxypeptidase (TAIR:AT3G07990.1); Has 2609 Blast hits to 2552 proteins in 299 species: Archae - 0; Bacteria - 182; Metazoa - 580; Fungi - 562; Plants - 967; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  |
| AT2G35930 | AT2G35930.1 | TTGACTTT | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.  |
| AT2G36580 | AT2G36580.1 | TTGACTTT | pyruvate kinase, putative; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: plasma membrane; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: pyruvate kinase, putative (TAIR:AT3G52990.1); Has 6484 Blast hits to 6462 proteins in 1513 species: Archae - 99; Bacteria - 3169; Metazoa - 478; Fungi - 168; Plants - 284; Viruses - 0; Other Eukaryotes - 2286 (source: NCBI BLink).  |
| AT2G37920 | AT2G37920.1 | AAAGTCAA | embryo defective 1513 (emb1513); FUNCTIONS IN: copper ion transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G07750.1); Has 26 Blast hits to 26 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G38550 | AT2G38550.1 | AAAGTCAACCGGAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57280.1); Has 94 Blast hits to 92 proteins in 26 species: Archae - 0; Bacteria - 4; Metazoa - 3; Fungi - 4; Plants - 69; Viruses - 7; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT2G38870 | AT2G38870.1 | TTGACTTT | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.  |
| AT2G39550 | AT2G39550.1 | TTGACTTT | encodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways.  |
| AT2G39770 | AT2G39770.1 | AAAGTCAA | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+.  |
| AT2G40113 | AT2G40113.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47635.1); Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G40140 | AT2G40140.1 | TTGACTTT | CZF1; FUNCTIONS IN: transcription factor activity; INVOLVED IN: defense response to fungus, response to cold, response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: SZF1 (SALT-INDUCIBLE ZINC FINGER 1); transcription factor (TAIR:AT3G55980.1); Has 847 Blast hits to 803 proteins in 134 species: Archae - 2; Bacteria - 35; Metazoa - 340; Fungi - 36; Plants - 230; Viruses - 2; Other Eukaryotes - 202 (source: NCBI BLink).  |
| AT2G40140.2 | TTGACTTT | CZF1; FUNCTIONS IN: transcription factor activity; INVOLVED IN: defense response to fungus, response to cold, response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: SZF1 (SALT-INDUCIBLE ZINC FINGER 1); transcription factor (TAIR:AT3G55980.1); Has 847 Blast hits to 803 proteins in 134 species: Archae - 2; Bacteria - 35; Metazoa - 340; Fungi - 36; Plants - 230; Viruses - 2; Other Eukaryotes - 202 (source: NCBI BLink).  |
| AT2G40270 | AT2G40270.1 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G56050.2); Has 26726 Blast hits to 26497 proteins in 928 species: Archae - 2; Bacteria - 1013; Metazoa - 9654; Fungi - 683; Plants - 12592; Viruses - 117; Other Eukaryotes - 2665 (source: NCBI BLink).  |
| AT2G40270.2 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G56050.2); Has 26726 Blast hits to 26497 proteins in 928 species: Archae - 2; Bacteria - 1013; Metazoa - 9654; Fungi - 683; Plants - 12592; Viruses - 117; Other Eukaryotes - 2665 (source: NCBI BLink).  |
| AT2G41110 | AT2G41110.1 | AAAGTCAA | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.  |
| AT2G41430 | AT2G41430.1 | AAAGTCAATAAAAGCC | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.  |
| AT2G41430.2 | AAAGTCAATAAAAGCC | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.  |
| AT2G41430.3 | AAAGTCAATAAAAGCC | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.  |
| AT2G41430.4 | AAAGTCAATAAAAGCC | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.  |
| AT2G41440 | AT2G41440.2 | TTGACTTT | unknown protein; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41470.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT2G41640 | AT2G41640.1 | TTGACTTT | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyltransferase AER61, uncharacterized (InterPro:IPR007657); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT3G57380.1); Has 480 Blast hits to 479 proteins in 83 species: Archae - 0; Bacteria - 34; Metazoa - 143; Fungi - 6; Plants - 243; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
| AT2G41835 | AT2G41835.1 | TTGACTTT | zinc finger (C2H2 type, AN1-like) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT3G57480.1); Has 560 Blast hits to 547 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 383; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
| AT2G41880 | AT2G41880.1 | AAAGTCAA | Guanylate kinase. Involved in nucleotide metabolism.  |
| AT2G42580 | AT2G42580.1 | AAAGTCAA | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling.  |
| AT2G43590 | AT2G43590.1 | AAAGTCAA | chitinase, putative; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, C globular stage, LP.02 two leaves visible; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT2G43580.1); Has 1881 Blast hits to 1685 proteins in 380 species: Archae - 0; Bacteria - 391; Metazoa - 33; Fungi - 138; Plants - 1211; Viruses - 18; Other Eukaryotes - 90 (source: NCBI BLink).  |
| AT2G43620 | AT2G43620.1 | TTGACTTT | chitinase, putative; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 19 protein (TAIR:AT2G43610.1); Has 2130 Blast hits to 1900 proteins in 431 species: Archae - 0; Bacteria - 469; Metazoa - 33; Fungi - 213; Plants - 1231; Viruses - 34; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT2G43620.1 | TTGACTTT | chitinase, putative; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 19 protein (TAIR:AT2G43610.1); Has 2130 Blast hits to 1900 proteins in 431 species: Archae - 0; Bacteria - 469; Metazoa - 33; Fungi - 213; Plants - 1231; Viruses - 34; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT2G44270 | AT2G44270.1 | AAAGTCAA | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink).  |
| AT2G44360 | AT2G44360.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G44360.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G44370 | AT2G44370.1 | TTGACTTT | DC1 domain-containing protein; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT2G17740.1); Has 1603 Blast hits to 573 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 5; Plants - 1571; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT2G44578 | AT2G44578.1 | AAAGTCAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G44581.1); Has 6429 Blast hits to 6413 proteins in 213 species: Archae - 0; Bacteria - 6; Metazoa - 2026; Fungi - 558; Plants - 2747; Viruses - 34; Other Eukaryotes - 1058 (source: NCBI BLink).  |
| AT2G45720 | AT2G45720.1 | TTGACTTT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT1G01830.3); Has 1636 Blast hits to 1049 proteins in 150 species: Archae - 2; Bacteria - 16; Metazoa - 365; Fungi - 196; Plants - 864; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
| AT2G45720.2 | TTGACTTT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT1G01830.3); Has 1636 Blast hits to 1049 proteins in 150 species: Archae - 2; Bacteria - 16; Metazoa - 365; Fungi - 196; Plants - 864; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
| AT2G46090 | AT2G46090.1 | TTGACTTT | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs.  |
| AT2G46535 | AT2G46535.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61840.1); Has 22 Blast hits to 22 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G46915 | AT2G46915.1 | AAAGTCAACGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19340.1); Has 101 Blast hits to 96 proteins in 30 species: Archae - 0; Bacteria - 24; Metazoa - 10; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT2G47120 | AT2G47120.1 | AAAGTCAA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G47130.1); Has 80311 Blast hits to 80158 proteins in 2201 species: Archae - 468; Bacteria - 43770; Metazoa - 4463; Fungi - 4181; Plants - 1494; Viruses - 4; Other Eukaryotes - 25931 (source: NCBI BLink).  |
| AT2G47630 | AT2G47630.1 | TTGACTTT | esterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT3G62860.1); Has 1686 Blast hits to 1682 proteins in 561 species: Archae - 17; Bacteria - 974; Metazoa - 101; Fungi - 71; Plants - 243; Viruses - 48; Other Eukaryotes - 232 (source: NCBI BLink).  |
| AT2G47750 | AT2G47750.1 | AAAGTCAA | PUTATIVE INDOLE-3-ACETIC ACID-AMIDO SYNTHETASE GH3.9 (GH3.9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: chloroplast envelope; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: GH3.17; indole-3-acetic acid amido synthetase (TAIR:AT1G28130.1); Has 681 Blast hits to 621 proteins in 106 species: Archae - 0; Bacteria - 203; Metazoa - 49; Fungi - 2; Plants - 219; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink).  |
| AT3G01290 | AT3G01290.1 | TTGACTTT | band 7 family protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: mitochondrion, plasma membrane, vacuole, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT5G62740.1); Has 5287 Blast hits to 5286 proteins in 1196 species: Archae - 142; Bacteria - 3001; Metazoa - 507; Fungi - 175; Plants - 165; Viruses - 3; Other Eukaryotes - 1294 (source: NCBI BLink).  |
| AT3G01570 | AT3G01570.1 | TTGACTTT | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G02520 | AT3G02520.1 | AAAGTCAA | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν).  |
| AT3G02700 | AT3G02700.1 | AAAGTCAA | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT5G16330.1); Has 105 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 23; Metazoa - 12; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G02710 | AT3G02710.1 | TTGACTTT | Encodes a protein with a putative role in mRNA splicing.  |
| AT3G02940 | AT3G02940.1 | AAAGTCAA | Encodes a putative transcription factor (MYB107).  |
| AT3G03570 | AT3G03570.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP013022 (InterPro:IPR016607); BEST Arabidopsis thaliana protein match is: signal transducer (TAIR:AT4G40050.1); Has 153 Blast hits to 150 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT3G03810 | AT3G03810.1 | TTGAACCGGAAAGTCAATTGGG | embryo sac development arrest 30 (EDA30); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, polar nucleus fusion, pollen tube development; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30300.1); Has 433 Blast hits to 418 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 433; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G04110 | AT3G04110.1 | TTGACTTT | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis.  |
| AT3G04480 | AT3G04480.1 | TTGACTTT | endoribonuclease; FUNCTIONS IN: endoribonuclease activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Protein of unknown function DUF71, ATP-binding region (InterPro:IPR002761), Endoribonuclease L-PSP (InterPro:IPR006175), Endoribonuclease L-PSP/chorismate mutase-like (InterPro:IPR013813); Has 1671 Blast hits to 1617 proteins in 527 species: Archae - 181; Bacteria - 784; Metazoa - 221; Fungi - 114; Plants - 14; Viruses - 0; Other Eukaryotes - 357 (source: NCBI BLink).  |
| AT3G04550 | AT3G04550.1 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28500.1); Has 79 Blast hits to 79 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G04780 | AT3G04780.1 | TTGACTTT | Encodes a protein with little sequence identity with any other protein of known structure or function. Part of this protein shows a 42% sequence identity with the C-terminal domain of the 32-kD human thioredoxin-like protein.  |
| AT3G04940 | AT3G04940.1 | TTGACTTT | Encodes cysteine synthase CysD1.  |
| AT3G05330 | AT3G05330.1 | TTGACTTT | Encodes a protein with moderate sequence similarity to the maize microtubule-binding protein TANGLED1. A single base-pair deletion (-A) at position Chr3:1519176 in Columbia relative to the Landsberg erecta and Achkarren-2 ecotype (see ESTs DR378436 and CB26450) introduces a frame-shift and premature termination codon. The protein encoded from the Columbia gene is truncated by 29 amino acids relative to the Landsberg erecta and Achkarren-2 encoded proteins. Involved in the identification of the division plane during mitosis amd cytokinesis  |
| AT3G05727 | AT3G05727.1 | AAAGTCAA | Encodes a defensin-like (DEFL) family protein.  |
| AT3G06140 | AT3G06140.1 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink).  |
| AT3G06140.1 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink).  |
| AT3G06350 | AT3G06350.1 | TTGACTTT | MATERNAL EFFECT EMBRYO ARREST 32 (MEE32); FUNCTIONS IN: NADP or NADPH binding, 3-dehydroquinate dehydratase activity, shikimate 5-dehydrogenase activity, binding, catalytic activity; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Quinate/shikimate 5-dehydrogenase/glutamyl-tRNA reductase (InterPro:IPR006151), Aldolase-type TIM barrel (InterPro:IPR013785), 3-dehydroquinate dehydratase, active site (InterPro:IPR018508), Quinate/shikimate 5-dehydrogenase (InterPro:IPR011342), NAD(P)-binding (InterPro:IPR016040), Dehydroquinase class I (InterPro:IPR001381), Shikimate dehydrogenase substrate binding, N-terminal (InterPro:IPR013708); Has 9368 Blast hits to 9366 proteins in 1469 species: Archae - 354; Bacteria - 5836; Metazoa - 0; Fungi - 292; Plants - 60; Viruses - 0; Other Eukaryotes - 2826 (source: NCBI BLink).  |
| AT3G06730 | AT3G06730.1 | TTGACTTT | thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: thylakoid, chloroplast, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: Aty2 (Arabidopsis thioredoxin y2); electron carrier/ protein disulfide oxidoreductase (TAIR:AT1G43560.1); Has 10054 Blast hits to 9725 proteins in 1657 species: Archae - 115; Bacteria - 4627; Metazoa - 1415; Fungi - 518; Plants - 866; Viruses - 0; Other Eukaryotes - 2513 (source: NCBI BLink).  |
| AT3G07510 | AT3G07510.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01580.1); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G07510.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01580.1); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G07540 | AT3G07540.1 | AAAGTCAA | formin homology 2 domain-containing protein / FH2 domain-containing protein; FUNCTIONS IN: actin binding; INVOLVED IN: cellular component organization, actin cytoskeleton organization; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 and DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: formin homology 2 domain-containing protein / FH2 domain-containing protein (TAIR:AT5G48360.1); Has 3523 Blast hits to 2955 proteins in 263 species: Archae - 0; Bacteria - 116; Metazoa - 1604; Fungi - 302; Plants - 670; Viruses - 102; Other Eukaryotes - 729 (source: NCBI BLink).  |
| AT3G07780 | AT3G07780.1 | AAAGTCAA | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems.  |
| AT3G08610 | AT3G08610.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G08680 | AT3G08680.1 | TTGACTTT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink).  |
| AT3G08680.2 | TTGACTTT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink).  |
| AT3G08710 | AT3G08710.1 | AAAGTCAA | thioredoxin H-type 9 (ATH9); INVOLVED IN: N-terminal protein myristoylation, cell redox homeostasis; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56420.1); Has 10582 Blast hits to 10520 proteins in 1668 species: Archae - 137; Bacteria - 4892; Metazoa - 1333; Fungi - 474; Plants - 859; Viruses - 3; Other Eukaryotes - 2884 (source: NCBI BLink).  |
| AT3G08710.2 | AAAGTCAA | thioredoxin H-type 9 (ATH9); INVOLVED IN: N-terminal protein myristoylation, cell redox homeostasis; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56420.1); Has 10582 Blast hits to 10520 proteins in 1668 species: Archae - 137; Bacteria - 4892; Metazoa - 1333; Fungi - 474; Plants - 859; Viruses - 3; Other Eukaryotes - 2884 (source: NCBI BLink).  |
| AT3G08720 | AT3G08720.1 | TTGACTTT | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins.  |
| AT3G08720.2 | TTGACTTT | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins.  |
| AT3G08800 | AT3G08800.1 | TTGACTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 119 Blast hits to 117 proteins in 53 species: Archae - 0; Bacteria - 6; Metazoa - 93; Fungi - 2; Plants - 11; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT3G08920 | AT3G08920.1 | AAAGTCAA | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G42220.1); Has 151 Blast hits to 151 proteins in 36 species: Archae - 0; Bacteria - 36; Metazoa - 1; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT3G09270 | AT3G09270.1 | AAAGTCAA | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).  |
| AT3G09350 | AT3G09350.1 | AAAGTCAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT3G09350.2 | AAAGTCAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT3G09350.3 | AAAGTCAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT3G09960 | AT3G09960.1 | TTGACTTT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843), Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase (InterPro:IPR006186); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT3G09970.1); Has 950 Blast hits to 950 proteins in 282 species: Archae - 18; Bacteria - 434; Metazoa - 29; Fungi - 19; Plants - 75; Viruses - 11; Other Eukaryotes - 364 (source: NCBI BLink).  |
| AT3G10985 | AT3G10985.1 | AAAGTCAA | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis.  |
| AT3G11210 | AT3G11210.1 | TTGACTTT | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Esterase, SGNH hydrolase-type, subgroup (InterPro:IPR013831), Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT2G38180.1); Has 410 Blast hits to 409 proteins in 144 species: Archae - 0; Bacteria - 124; Metazoa - 65; Fungi - 98; Plants - 78; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
| AT3G11480 | AT3G11480.1 | AAAGTCAA | The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. It is highly expressed in flowers, induced by biotic and abiotic stress and thought to be involved in direct defense mechanism.  |
| AT3G12020 | AT3G12020.1 | AAAGTCAA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G06670.1); Has 33114 Blast hits to 22100 proteins in 976 species: Archae - 220; Bacteria - 1972; Metazoa - 17477; Fungi - 2773; Plants - 1578; Viruses - 63; Other Eukaryotes - 9031 (source: NCBI BLink).  |
| AT3G12140 | AT3G12140.1 | AAAGTCAA | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G12140.2 | AAAGTCAA | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G12140.3 | AAAGTCAA | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G12550 | AT3G12550.1 | TTGACTTT | XH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G48670.2); Has 23408 Blast hits to 15451 proteins in 943 species: Archae - 218; Bacteria - 2032; Metazoa - 11697; Fungi - 1231; Plants - 587; Viruses - 80; Other Eukaryotes - 7563 (source: NCBI BLink).  |
| AT3G13030 | AT3G13030.1 | AAAGTCAA | hAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G13030.2 | AAAGTCAA | hAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G13030.3 | AAAGTCAA | hAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G13235 | AT3G13235.1 | AAAGTCAA | ubiquitin family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Peptidase A2A, retrovirus, catalytic (InterPro:IPR001995), Peptidase aspartic, catalytic (InterPro:IPR009007), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); Has 6366 Blast hits to 3177 proteins in 509 species: Archae - 0; Bacteria - 2; Metazoa - 2716; Fungi - 819; Plants - 1543; Viruses - 81; Other Eukaryotes - 1205 (source: NCBI BLink).  |
| AT3G13330 | AT3G13330.1 | AAAGTCAA | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); Has 345 Blast hits to 234 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 178; Plants - 15; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
| AT3G13800 | AT3G13800.1 | TTGACTTT | metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30300.1); Has 2111 Blast hits to 2093 proteins in 437 species: Archae - 41; Bacteria - 761; Metazoa - 7; Fungi - 19; Plants - 53; Viruses - 0; Other Eukaryotes - 1230 (source: NCBI BLink).  |
| AT3G15990 | AT3G15990.1 | AAAGTCAA | Encodes sulfate transporter Sultr3;4.  |
| AT3G16460 | AT3G16460.1 | AAAGTCAA | jacalin lectin family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cold; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 131260 Blast hits to 34126 proteins in 1746 species: Archae - 331; Bacteria - 48540; Metazoa - 26646; Fungi - 8505; Plants - 10521; Viruses - 2266; Other Eukaryotes - 34451 (source: NCBI BLink).  |
| AT3G16460.1 | TTGACTTT | jacalin lectin family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cold; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 131260 Blast hits to 34126 proteins in 1746 species: Archae - 331; Bacteria - 48540; Metazoa - 26646; Fungi - 8505; Plants - 10521; Viruses - 2266; Other Eukaryotes - 34451 (source: NCBI BLink).  |
| AT3G16460.2 | AAAGTCAA | jacalin lectin family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cold; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 131260 Blast hits to 34126 proteins in 1746 species: Archae - 331; Bacteria - 48540; Metazoa - 26646; Fungi - 8505; Plants - 10521; Viruses - 2266; Other Eukaryotes - 34451 (source: NCBI BLink).  |
| AT3G16460.2 | TTGACTTT | jacalin lectin family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cold; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 131260 Blast hits to 34126 proteins in 1746 species: Archae - 331; Bacteria - 48540; Metazoa - 26646; Fungi - 8505; Plants - 10521; Viruses - 2266; Other Eukaryotes - 34451 (source: NCBI BLink).  |
| AT3G17070 | AT3G17070.1 | TTGACTTT | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G40150.1); Has 3116 Blast hits to 3101 proteins in 241 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 305; Plants - 2754; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
| AT3G17850 | AT3G17850.1 | AAAGTCAA | protein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: kinase (TAIR:AT1G48490.3); Has 93654 Blast hits to 91012 proteins in 3322 species: Archae - 87; Bacteria - 8430; Metazoa - 40487; Fungi - 8683; Plants - 16447; Viruses - 470; Other Eukaryotes - 19050 (source: NCBI BLink).  |
| AT3G18690 | AT3G18690.1 | AAAGTCAA | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators.  |
| AT3G18690.1 | AAAGTCAA | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators.  |
| AT3G18790 | AT3G18790.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isy1-like splicing (InterPro:IPR009360); Has 1075 Blast hits to 879 proteins in 176 species: Archae - 8; Bacteria - 11; Metazoa - 379; Fungi - 177; Plants - 27; Viruses - 9; Other Eukaryotes - 464 (source: NCBI BLink).  |
| AT3G19660 | AT3G19660.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G19790 | AT3G19790.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G19790.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G20380 | AT3G20380.1 | AAAGTCAA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G20370.1); Has 275 Blast hits to 253 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 0; Plants - 241; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT3G20530 | AT3G20530.1 | TTGACTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G18610.1); Has 82581 Blast hits to 81572 proteins in 2916 species: Archae - 50; Bacteria - 7463; Metazoa - 36172; Fungi - 6378; Plants - 18448; Viruses - 324; Other Eukaryotes - 13746 (source: NCBI BLink).  |
| AT3G20660 | AT3G20660.1 | TTGACTTT | Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4 (AtOCT4); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: chloroplast thylakoid membrane, membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT1 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER1); carbohydrate transmembrane transporter/ carnitine transporter/ transporter (TAIR:AT1G73220.1); Has 17732 Blast hits to 17562 proteins in 1146 species: Archae - 294; Bacteria - 8210; Metazoa - 4427; Fungi - 3016; Plants - 991; Viruses - 0; Other Eukaryotes - 794 (source: NCBI BLink).  |
| AT3G21580 | AT3G21580.1 | TTGACTTT | cobalt ion transmembrane transporter; FUNCTIONS IN: cobalt ion transmembrane transporter activity; INVOLVED IN: cobalt ion transport, cobalamin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalt transport protein (InterPro:IPR003339); Has 867 Blast hits to 867 proteins in 369 species: Archae - 6; Bacteria - 721; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).  |
| AT3G21865 | AT3G21865.1 | TTGACTTT | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes.  |
| AT3G22460 | AT3G22460.1 | TTGACTTT | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity.  |
| AT3G22510 | AT3G22510.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27990.1); Has 130 Blast hits to 130 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 45; Fungi - 42; Plants - 23; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
| AT3G22530 | AT3G22530.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14830.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G22630 | AT3G22630.1 | AAAGTCAA | Encodes 20S proteasome beta subunit PBD1 (PBD1).  |
| AT3G22850 | AT3G22850.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 828 Blast hits to 828 proteins in 285 species: Archae - 0; Bacteria - 440; Metazoa - 46; Fungi - 0; Plants - 196; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
| AT3G23325 | AT3G23325.1 | AAAGTCAA | splicing factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor 3B subunit 5/RDS3 complex subunit 10 (InterPro:IPR009846), Splicing factor 3B, subunit 5 (InterPro:IPR017089); BEST Arabidopsis thaliana protein match is: pre-mRNA splicing factor 10 kDa subunit, putative (TAIR:AT4G14342.1); Has 220 Blast hits to 220 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 61; Plants - 31; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
| AT3G23560 | AT3G23560.1 | TTGACTTT | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds.  |
| AT3G23810 | AT3G23810.1 | AAAGTCAA | S-ADENOSYL-L-HOMOCYSTEINE (SAH) HYDROLASE 2 (SAHH2); FUNCTIONS IN: adenosylhomocysteinase activity, binding, catalytic activity; INVOLVED IN: one-carbon compound metabolic process, metabolic process; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 32 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosyl-L-homocysteine hydrolase (InterPro:IPR000043), NAD(P)-binding (InterPro:IPR016040), S-adenosyl-L-homocysteine hydrolase, NAD binding (InterPro:IPR015878); BEST Arabidopsis thaliana protein match is: MEE58 (MATERNAL EFFECT EMBRYO ARREST 58); adenosylhomocysteinase/ copper ion binding (TAIR:AT4G13940.1); Has 6533 Blast hits to 6529 proteins in 950 species: Archae - 144; Bacteria - 1368; Metazoa - 431; Fungi - 95; Plants - 164; Viruses - 0; Other Eukaryotes - 4331 (source: NCBI BLink).  |
| AT3G24070 | AT3G24070.1 | CCCATTAAAAGTCAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G24190 | AT3G24190.1 | AAAGTCAA | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Aminoglycoside phosphotransferase (InterPro:IPR002575), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7527 Blast hits to 7489 proteins in 1103 species: Archae - 67; Bacteria - 2650; Metazoa - 374; Fungi - 312; Plants - 357; Viruses - 14; Other Eukaryotes - 3753 (source: NCBI BLink).  |
| AT3G25140 | AT3G25140.1 | AAAGTCAA | Quasimodo1, encodes a glycosyltransferase, involved in homogalacturonan biosynthesis; mutant shows cell adhesion defect and lower wall uronic acid content.  |
| AT3G25610 | AT3G25610.1 | AAAGTCAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, phospholipid-translocating, flippase (InterPro:IPR006539), ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200); BEST Arabidopsis thaliana protein match is: ACA.l (autoinhibited Ca2+/ATPase II); ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism / calmodulin binding (TAIR:AT1G13210.1); Has 8438 Blast hits to 7431 proteins in 929 species: Archae - 91; Bacteria - 2011; Metazoa - 2748; Fungi - 1347; Plants - 683; Viruses - 3; Other Eukaryotes - 1555 (source: NCBI BLink).  |
| AT3G26300 | AT3G26300.1 | TTGACTTT | putative cytochrome P450  |
| AT3G26360 | AT3G26360.1 | AAAGTCAA | unknown protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G26400 | AT3G26400.1 | AAAGTCAACACGTGTT | member of eIF4B - eukaryotic initiation factor 4B  |
| AT3G26430 | AT3G26430.1 | TTGACTTT | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: ATFXG1 (alpha-fucosidase 1); alpha-L-fucosidase/ carboxylesterase (TAIR:AT1G67830.1); Has 1641 Blast hits to 1611 proteins in 79 species: Archae - 0; Bacteria - 59; Metazoa - 1; Fungi - 6; Plants - 1573; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT3G27300 | AT3G27300.1 | TTGACTTT | glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  |
| AT3G27300.2 | TTGACTTT | glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  |
| AT3G27300.3 | TTGACTTT | glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  |
| AT3G27630 | AT3G27630.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G27740 | AT3G27740.1 | AAAGTCAA | carbamoyl phosphate synthetase small subunit mRNA (carA),  |
| AT3G27740.1 | AAAGTCAA | carbamoyl phosphate synthetase small subunit mRNA (carA),  |
| AT3G27740.2 | AAAGTCAA | carbamoyl phosphate synthetase small subunit mRNA (carA),  |
| AT3G27740.2 | AAAGTCAA | carbamoyl phosphate synthetase small subunit mRNA (carA),  |
| AT3G28100 | AT3G28100.1 | AAAGTCAA | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28070.1); Has 1662 Blast hits to 1653 proteins in 290 species: Archae - 24; Bacteria - 733; Metazoa - 11; Fungi - 3; Plants - 622; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink).  |
| AT3G28940 | AT3G28940.1 | TTGACTTT | avirulence-responsive protein, putative / avirulence induced gene (AIG) protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to bacterium; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: AIG2-like (InterPro:IPR009288); BEST Arabidopsis thaliana protein match is: AIG2 (AVRRPT2-INDUCED GENE 2) (TAIR:AT3G28930.1); Has 163 Blast hits to 163 proteins in 50 species: Archae - 2; Bacteria - 27; Metazoa - 0; Fungi - 42; Plants - 61; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
| AT3G29034 | AT3G29034.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G29075 | AT3G29075.1 | TTGACTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11440.1); Has 101257 Blast hits to 35557 proteins in 1171 species: Archae - 141; Bacteria - 8540; Metazoa - 34827; Fungi - 8697; Plants - 4163; Viruses - 767; Other Eukaryotes - 44122 (source: NCBI BLink).  |
| AT3G47670 | AT3G47670.1 | AAAGTCAA | enzyme inhibitor/ pectinesterase/ pectinesterase inhibitor; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: ATPME1; pectinesterase (TAIR:AT1G53840.1); Has 480 Blast hits to 475 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 480; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G47960 | AT3G47960.1 | TTGACTTT | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2355 Blast hits to 2218 proteins in 361 species: Archae - 0; Bacteria - 385; Metazoa - 535; Fungi - 246; Plants - 1124; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT3G48670 | AT3G48670.1 | TTGACTTT | XH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G12550.1); Has 63472 Blast hits to 34880 proteins in 1446 species: Archae - 654; Bacteria - 5742; Metazoa - 32286; Fungi - 3507; Plants - 1699; Viruses - 217; Other Eukaryotes - 19367 (source: NCBI BLink).  |
| AT3G48670.2 | TTGACTTT | XH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G12550.1); Has 63472 Blast hits to 34880 proteins in 1446 species: Archae - 654; Bacteria - 5742; Metazoa - 32286; Fungi - 3507; Plants - 1699; Viruses - 217; Other Eukaryotes - 19367 (source: NCBI BLink).  |
| AT3G48730 | AT3G48730.1 | AAAGTCAA | glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink).  |
| AT3G49260 | AT3G49260.1 | AAAGTCAA | IQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT3G49260.2 | AAAGTCAA | IQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT3G49530 | AT3G49530.1 | AAAGTCAA | Arabidopsis NAC domain containing protein 62 (anac062); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: TIP (TCV-INTERACTING PROTEIN); transcription coactivator/ transcription factor (TAIR:AT5G24590.2); Has 1568 Blast hits to 1566 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G50480 | AT3G50480.1 | AAAGTCAA | Homolog of RPW8  |
| AT3G50900 | AT3G50900.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66490.1); Has 21 Blast hits to 21 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G51280 | AT3G51280.1 | AAAGTCAA | male sterility MS5, putative; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATSDI1 (SULPHUR DEFICIENCY-INDUCED 1); binding (TAIR:AT5G48850.1); Has 753 Blast hits to 582 proteins in 92 species: Archae - 6; Bacteria - 185; Metazoa - 0; Fungi - 1; Plants - 101; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink).  |
| AT3G51310 | AT3G51310.1 | AAAGTCAA | Homolog of yeast retromer subunit VPS35. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.  |
| AT3G51370 | AT3G51370.1 | AAAGTCAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT5G66080.1); Has 3627 Blast hits to 3625 proteins in 218 species: Archae - 0; Bacteria - 13; Metazoa - 1230; Fungi - 371; Plants - 1273; Viruses - 3; Other Eukaryotes - 737 (source: NCBI BLink).  |
| AT3G52060 | AT3G52060.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22070.1); Has 327 Blast hits to 327 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT3G52060.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22070.1); Has 327 Blast hits to 327 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT3G52300 | AT3G52300.1 | TTGACTTT | ATP SYNTHASE D CHAIN, MITOCHONDRIAL (ATPQ); FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: response to salt stress; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit D, mitochondrial (InterPro:IPR008689); Has 220 Blast hits to 220 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 31; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT3G52300.2 | TTGACTTT | ATP SYNTHASE D CHAIN, MITOCHONDRIAL (ATPQ); FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: response to salt stress; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit D, mitochondrial (InterPro:IPR008689); Has 220 Blast hits to 220 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 31; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT3G52450 | AT3G52450.1 | AAAGTCAA | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.  |
| AT3G52450.1 | TTGACTTT | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.  |
| AT3G52520 | AT3G52520.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06280.3); Has 12 Blast hits to 12 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G53180 | AT3G53180.1 | AAAGTCAA | catalytic/ glutamate-ammonia ligase; FUNCTIONS IN: glutamate-ammonia ligase activity, catalytic activity; INVOLVED IN: nitrogen compound metabolic process, N-terminal protein myristoylation, nitrogen fixation, metabolic process, glutamine biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic region (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic region (InterPro:IPR014746), Amidohydrolase 2 (InterPro:IPR006992); Has 10584 Blast hits to 10580 proteins in 1411 species: Archae - 190; Bacteria - 5115; Metazoa - 86; Fungi - 146; Plants - 34; Viruses - 0; Other Eukaryotes - 5013 (source: NCBI BLink).  |
| AT3G53270 | AT3G53270.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.3 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.3 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.4 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.4 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.5 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G53270.5 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G54420 | AT3G54420.1 | AAAGTCAA | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs.  |
| AT3G54500 | AT3G54500.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT3G54500.2 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT3G54680 | AT3G54680.1 | TTGACTTT | proteophosphoglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 4087 Blast hits to 405 proteins in 103 species: Archae - 2; Bacteria - 51; Metazoa - 124; Fungi - 85; Plants - 81; Viruses - 11; Other Eukaryotes - 3733 (source: NCBI BLink).  |
| AT3G54780 | AT3G54780.1 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 3231 Blast hits to 3212 proteins in 474 species: Archae - 51; Bacteria - 1057; Metazoa - 1015; Fungi - 120; Plants - 311; Viruses - 4; Other Eukaryotes - 673 (source: NCBI BLink).  |
| AT3G54780.1 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 3231 Blast hits to 3212 proteins in 474 species: Archae - 51; Bacteria - 1057; Metazoa - 1015; Fungi - 120; Plants - 311; Viruses - 4; Other Eukaryotes - 673 (source: NCBI BLink).  |
| AT3G54780.2 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 3231 Blast hits to 3212 proteins in 474 species: Archae - 51; Bacteria - 1057; Metazoa - 1015; Fungi - 120; Plants - 311; Viruses - 4; Other Eukaryotes - 673 (source: NCBI BLink).  |
| AT3G54780.2 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 3231 Blast hits to 3212 proteins in 474 species: Archae - 51; Bacteria - 1057; Metazoa - 1015; Fungi - 120; Plants - 311; Viruses - 4; Other Eukaryotes - 673 (source: NCBI BLink).  |
| AT3G54780.3 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 3231 Blast hits to 3212 proteins in 474 species: Archae - 51; Bacteria - 1057; Metazoa - 1015; Fungi - 120; Plants - 311; Viruses - 4; Other Eukaryotes - 673 (source: NCBI BLink).  |
| AT3G54780.3 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 3231 Blast hits to 3212 proteins in 474 species: Archae - 51; Bacteria - 1057; Metazoa - 1015; Fungi - 120; Plants - 311; Viruses - 4; Other Eukaryotes - 673 (source: NCBI BLink).  |
| AT3G54850 | AT3G54850.1 | TTGACTTT | Encodes a protein with ubiquitin ligase activity.  |
| AT3G55050 | AT3G55050.1 | AAAGTCAA | serine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).  |
| AT3G55050.1 | CCGTTAAAGTCAA | serine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).  |
| AT3G55050.2 | AAAGTCAA | serine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).  |
| AT3G55050.2 | CCGTTAAAGTCAA | serine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).  |
| AT3G55620 | AT3G55620.1 | TTGACTTT | embryo defective 1624 (emb1624); FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational initiation; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 6, putative / eIF-6, putative (TAIR:AT2G39820.1); Has 595 Blast hits to 595 proteins in 239 species: Archae - 161; Bacteria - 0; Metazoa - 147; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT3G55980 | AT3G55980.1 | TTGACTTT | SALT-INDUCIBLE ZINC FINGER 1 (SZF1); FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: CZF1; transcription factor (TAIR:AT2G40140.2); Has 1281 Blast hits to 1076 proteins in 129 species: Archae - 2; Bacteria - 37; Metazoa - 725; Fungi - 18; Plants - 246; Viruses - 2; Other Eukaryotes - 251 (source: NCBI BLink).  |
| AT3G56410 | AT3G56410.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05190.1); Has 4436 Blast hits to 3147 proteins in 369 species: Archae - 15; Bacteria - 401; Metazoa - 1486; Fungi - 320; Plants - 239; Viruses - 48; Other Eukaryotes - 1927 (source: NCBI BLink).  |
| AT3G56410.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05190.1); Has 4436 Blast hits to 3147 proteins in 369 species: Archae - 15; Bacteria - 401; Metazoa - 1486; Fungi - 320; Plants - 239; Viruses - 48; Other Eukaryotes - 1927 (source: NCBI BLink).  |
| AT3G57280 | AT3G57280.1 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G57470 | AT3G57470.1 | TTGACTTT | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink).  |
| AT3G57470.2 | TTGACTTT | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink).  |
| AT3G57480 | AT3G57480.1 | TTGACTTT | zinc finger (C2H2 type, AN1-like) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT2G41835.1); Has 368 Blast hits to 368 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
| AT3G57870 | AT3G57870.1 | TTGACTTT | Encodes a SUMO liagse that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name.  |
| AT3G58600 | AT3G58600.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
| AT3G58610 | AT3G58610.1 | TTGACTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  |
| AT3G58610.2 | TTGACTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  |
| AT3G59770 | AT3G59770.2 | TTGACTTT | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses.  |
| AT3G60850 | AT3G60850.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G61770 | AT3G61770.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 613 Blast hits to 613 proteins in 199 species: Archae - 0; Bacteria - 356; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).  |
| AT3G61820 | AT3G61820.1 | AAAGTCAA | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G01300.1); Has 2621 Blast hits to 2600 proteins in 273 species: Archae - 0; Bacteria - 0; Metazoa - 816; Fungi - 529; Plants - 1157; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).  |
| AT3G62080 | AT3G62080.1 | AAAGTCAA | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT3G62220 | AT3G62220.1 | TTGACTTT | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink).  |
| AT3G62410 | AT3G62410.1 | TTGACTTT | CP12-2 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. CP12-2 is coordinately regulated by light with the photosynthetic GAPDH and PRK. The annotation of this gene is based on article 32494.  |
| AT3G62830 | AT3G62830.1 | TTGACTTT | encodes an isoform of UDP-glucuronic acid decarboxylase, which is predicted to be membrane-bound by PSORT. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.  |
| AT3G62830.2 | TTGACTTT | encodes an isoform of UDP-glucuronic acid decarboxylase, which is predicted to be membrane-bound by PSORT. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.  |
| AT3G62840 | AT3G62840.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
| AT3G62840.2 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
| AT4G00570 | AT4G00570.1 | TTGACTTT | malate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: oxidation reduction, malate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT2G13560.1); Has 5867 Blast hits to 5857 proteins in 1333 species: Archae - 86; Bacteria - 3255; Metazoa - 553; Fungi - 155; Plants - 271; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink).  |
| AT4G00900 | AT4G00900.1 | AAAGTCAA | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm.  |
| AT4G00900.1 | TTGACTTT | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm.  |
| AT4G01026 | AT4G01026.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 184 Blast hits to 184 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G01700 | AT4G01700.1 | AAAGTCAAAACG | chitinase, putative; FUNCTIONS IN: chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: cell wall; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 19 (InterPro:IPR016283), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT1G02360.1); Has 1469 Blast hits to 1463 proteins in 349 species: Archae - 0; Bacteria - 354; Metazoa - 35; Fungi - 2; Plants - 989; Viruses - 19; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT4G01940 | AT4G01940.1 | AAAGTCAA | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast.  |
| AT4G02090 | AT4G02090.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; Has 71 Blast hits to 71 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G02195 | AT4G02195.1 | TTGACTTT | member of SYP4 Gene Family  |
| AT4G02200 | AT4G02200.1 | AAAGTCAA | drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).  |
| AT4G02200.2 | AAAGTCAA | drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).  |
| AT4G02200.3 | AAAGTCAA | drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).  |
| AT4G02260 | AT4G02260.1 | TTGACTTT | RELA-SPOT HOMOLOG 1 (RSH1); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGS-like (InterPro:IPR012676), Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), TGS (InterPro:IPR004095), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8102 Blast hits to 8095 proteins in 1310 species: Archae - 6; Bacteria - 4034; Metazoa - 88; Fungi - 4; Plants - 126; Viruses - 2; Other Eukaryotes - 3842 (source: NCBI BLink).  |
| AT4G02260.2 | TTGACTTT | RELA-SPOT HOMOLOG 1 (RSH1); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGS-like (InterPro:IPR012676), Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), TGS (InterPro:IPR004095), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8102 Blast hits to 8095 proteins in 1310 species: Archae - 6; Bacteria - 4034; Metazoa - 88; Fungi - 4; Plants - 126; Viruses - 2; Other Eukaryotes - 3842 (source: NCBI BLink).  |
| AT4G02260.3 | TTGACTTT | RELA-SPOT HOMOLOG 1 (RSH1); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGS-like (InterPro:IPR012676), Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), TGS (InterPro:IPR004095), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8102 Blast hits to 8095 proteins in 1310 species: Archae - 6; Bacteria - 4034; Metazoa - 88; Fungi - 4; Plants - 126; Viruses - 2; Other Eukaryotes - 3842 (source: NCBI BLink).  |
| AT4G02380 | AT4G02380.1 | TTGACTTT | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses.  |
| AT4G02380.2 | TTGACTTT | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses.  |
| AT4G02460 | AT4G02460.1 | TTGACTTT | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.  |
| AT4G02480 | AT4G02480.1 | AAAGTCAA | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), SMAD/FHA domain (InterPro:IPR008984), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT1G02890.1); Has 26189 Blast hits to 22283 proteins in 1802 species: Archae - 938; Bacteria - 7842; Metazoa - 4073; Fungi - 2409; Plants - 1486; Viruses - 27; Other Eukaryotes - 9414 (source: NCBI BLink).  |
| AT4G02500 | AT4G02500.1 | TTGACTTT | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides.  |
| AT4G02540 | AT4G02540.1 | AAAGTCAA | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G62030.1); Has 1223 Blast hits to 477 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 1; Plants - 1216; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G02540.1 | TTGACTTT | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G62030.1); Has 1223 Blast hits to 477 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 1; Plants - 1216; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G03020 | AT4G03020.1 | AAAGTCAAACGTGGCAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 23 (InterPro:IPR017399); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 27310 Blast hits to 15280 proteins in 497 species: Archae - 34; Bacteria - 3736; Metazoa - 12063; Fungi - 5373; Plants - 2263; Viruses - 0; Other Eukaryotes - 3841 (source: NCBI BLink).  |
| AT4G04885 | AT4G04885.1 | AAAGTCAA | Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time.  |
| AT4G06746 | AT4G06746.1 | AAAGTCAA | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.9). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1 and RAP2.10.  |
| AT4G08810 | AT4G08810.1 | AAAGTCAA | Calcium binding protein involved in cryptochrome and phytochrome coaction  |
| AT4G09420 | AT4G09420.1 | AAAGTCAA | disease resistance protein (TIR-NBS class), putative; FUNCTIONS IN: transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: shoot apex, leaf whorl, cotyledon, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS class), putative (TAIR:AT1G72850.1); Has 5786 Blast hits to 5719 proteins in 204 species: Archae - 0; Bacteria - 43; Metazoa - 6; Fungi - 0; Plants - 5734; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT4G09770 | AT4G09770.1 | AAAGTCAA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT4G09780.1); Has 443 Blast hits to 362 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 379; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
| AT4G10380 | AT4G10380.1 | TTGACTTT | Essential for efficient Boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance.  |
| AT4G11680 | AT4G11680.1 | AAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6313 Blast hits to 6295 proteins in 208 species: Archae - 0; Bacteria - 6; Metazoa - 2195; Fungi - 451; Plants - 2639; Viruses - 29; Other Eukaryotes - 993 (source: NCBI BLink).  |
| AT4G12010 | AT4G12010.1 | TTGACTTT | disease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: protein binding, transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157), Leucine-rich repeat 3 (InterPro:IPR011713); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT4G19510.1); Has 22360 Blast hits to 15112 proteins in 670 species: Archae - 19; Bacteria - 1728; Metazoa - 4451; Fungi - 229; Plants - 14971; Viruses - 4; Other Eukaryotes - 958 (source: NCBI BLink).  |
| AT4G12020 | AT4G12020.1 | AAAGTCAA | member of MEKK subfamily  |
| AT4G12020.2 | AAAGTCAA | member of MEKK subfamily  |
| AT4G12020.3 | AAAGTCAA | member of MEKK subfamily  |
| AT4G13310 | AT4G13310.1 | TTGACTTT | putative cytochrome P450  |
| AT4G13310.2 | TTGACTTT | putative cytochrome P450  |
| AT4G13500 | AT4G13500.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G05310.1); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G13510 | AT4G13510.1 | AAAGTCAA | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake.  |
| AT4G13580 | AT4G13580.1 | TTGACTTT | disease resistance-responsive family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT3G24020.1); Has 388 Blast hits to 387 proteins in 32 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G13860 | AT4G13860.1 | AAAGTCAA | glycine-rich RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP2 (GLYCINE-RICH RNA-BINDING PROTEIN 2); ATP binding / RNA binding / double-stranded DNA binding / single-stranded DNA binding (TAIR:AT4G13850.4); Has 20625 Blast hits to 15554 proteins in 614 species: Archae - 10; Bacteria - 1109; Metazoa - 12326; Fungi - 2038; Plants - 3107; Viruses - 0; Other Eukaryotes - 2035 (source: NCBI BLink).  |
| AT4G14190 | AT4G14190.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G42630.1); Has 7409 Blast hits to 2639 proteins in 94 species: Archae - 1; Bacteria - 0; Metazoa - 60; Fungi - 16; Plants - 7130; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink).  |
| AT4G14220 | AT4G14220.1 | TTGACTTT | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond.  |
| AT4G14305 | AT4G14305.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: PMP22 (TAIR:AT4G04470.1); Has 957 Blast hits to 957 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 456; Fungi - 286; Plants - 164; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
| AT4G14305.2 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: PMP22 (TAIR:AT4G04470.1); Has 957 Blast hits to 957 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 456; Fungi - 286; Plants - 164; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
| AT4G14370 | AT4G14370.1 | AAAGTCAAAAGTCAA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, defense response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat 3 (InterPro:IPR011713), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT2G16870.1); Has 29829 Blast hits to 16420 proteins in 692 species: Archae - 56; Bacteria - 2443; Metazoa - 8792; Fungi - 770; Plants - 11893; Viruses - 63; Other Eukaryotes - 5812 (source: NCBI BLink).  |
| AT4G14615 | AT4G14615.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52825.1); Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G15780 | AT4G15780.1 | TTGACTTT | member of VAMP72 Gene Family  |
| AT4G15790 | AT4G15790.1 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 379 Blast hits to 339 proteins in 97 species: Archae - 2; Bacteria - 84; Metazoa - 93; Fungi - 24; Plants - 32; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink).  |
| AT4G16260 | AT4G16260.1 | TTGACTTT | catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: cell wall, plasma membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BG1 (BETA-1,3-GLUCANASE 1); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G57270.1); Has 1374 Blast hits to 1365 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1371; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT4G16440 | AT4G16440.1 | TTGACTTT | Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inflUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing.  |
| AT4G16470 | AT4G16470.1 | TTGACTTT | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: CRR22 (CHLORORESPIRATORY REDUCTION22); endonuclease (TAIR:AT1G11290.1); Has 12729 Blast hits to 4676 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 31; Fungi - 25; Plants - 12474; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink).  |
| AT4G16780 | AT4G16780.1 | TTGACTTT | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin.  |
| AT4G17215 | AT4G17215.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47635.1); Has 24 Blast hits to 24 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G17230 | AT4G17230.1 | AAAGTCAA | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family.  |
| AT4G17486 | AT4G17486.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47310.1); Has 571 Blast hits to 571 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 55; Plants - 185; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  |
| AT4G17486.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47310.1); Has 571 Blast hits to 571 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 55; Plants - 185; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  |
| AT4G17600 | AT4G17600.1 | TTGACTTT | Encodes Lil3:1 (light-harvesting-like) protein. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. A generic LHC motif is present in Lil3:1.  |
| AT4G17940 | AT4G17940.1 | AAAGTCAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G20190.1); Has 378 Blast hits to 251 proteins in 46 species: Archae - 2; Bacteria - 99; Metazoa - 16; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
| AT4G19112 | AT4G19112.1 | AAAGTCAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF25 represents a conserved upstream opening reading frame relative to major ORF AT4G19110.1  |
| AT4G19680 | AT4G19680.1 | TTGACTTT | encodes an iron transporter whose expression is induced by iron and zinc deficiency. Gene is specifically expressed in the external cell layers of the root subapical zone.  |
| AT4G19680.2 | TTGACTTT | encodes an iron transporter whose expression is induced by iron and zinc deficiency. Gene is specifically expressed in the external cell layers of the root subapical zone.  |
| AT4G20530 | AT4G20530.1 | TTGACTTT | receptor-like protein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902), Protein of unknown function DUF1204 (InterPro:IPR009596); BEST Arabidopsis thaliana protein match is: receptor-like protein kinase-related (TAIR:AT4G20640.1); Has 842 Blast hits to 828 proteins in 29 species: Archae - 0; Bacteria - 8; Metazoa - 19; Fungi - 0; Plants - 809; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT4G20770 | AT4G20770.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G02330.1); Has 19914 Blast hits to 4972 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 141; Fungi - 107; Plants - 19318; Viruses - 0; Other Eukaryotes - 346 (source: NCBI BLink).  |
| AT4G20780 | AT4G20780.1 | AAAGTCAA | calcium-binding protein, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding protein, putative (TAIR:AT5G44460.1); Has 12187 Blast hits to 8815 proteins in 1091 species: Archae - 0; Bacteria - 23; Metazoa - 5095; Fungi - 2584; Plants - 2687; Viruses - 2; Other Eukaryotes - 1796 (source: NCBI BLink).  |
| AT4G22010 | AT4G22010.1 | AAATGACGTTGACTTT | SKU5 Similar 4 (sks4); FUNCTIONS IN: oxidoreductase activity, copper ion binding; LOCATED IN: membrane, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: sks5 (SKU5 Similar 5); copper ion binding / oxidoreductase (TAIR:AT1G76160.1); Has 3691 Blast hits to 3663 proteins in 668 species: Archae - 2; Bacteria - 955; Metazoa - 261; Fungi - 1515; Plants - 831; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
| AT4G22220 | AT4G22220.1 | AAAGTCAA | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.  |
| AT4G22330 | AT4G22330.1 | AAAGTCAA | Encodes AtCES1 for Acyl-CoA independent ceramide synthase.  |
| AT4G23170 | AT4G23170.1 | TTGACTTT | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression.  |
| AT4G23170.1 | TTGACTTT | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression.  |
| AT4G23180 | AT4G23180.1 | TTGACTTT | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)  |
| AT4G23190 | AT4G23190.1 | TTGACTTT | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307)  |
| AT4G23190.1 | TTGACTTTGACTTT | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307)  |
| AT4G23250 | AT4G23250.1 | TTGACTTT | EMBRYO DEFECTIVE 1290 (EMB1290); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: embryonic development ending in seed dormancy, protein amino acid autophosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Protein of unknown function DUF26 (InterPro:IPR002902), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G23260.1); Has 87813 Blast hits to 85985 proteins in 3092 species: Archae - 45; Bacteria - 7629; Metazoa - 37890; Fungi - 6855; Plants - 20068; Viruses - 386; Other Eukaryotes - 14940 (source: NCBI BLink).  |
| AT4G23420 | AT4G23420.1 | TTGACTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23430.2); Has 36520 Blast hits to 36480 proteins in 1771 species: Archae - 235; Bacteria - 21258; Metazoa - 3640; Fungi - 2170; Plants - 961; Viruses - 0; Other Eukaryotes - 8256 (source: NCBI BLink).  |
| AT4G23420.2 | TTGACTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23430.2); Has 36520 Blast hits to 36480 proteins in 1771 species: Archae - 235; Bacteria - 21258; Metazoa - 3640; Fungi - 2170; Plants - 961; Viruses - 0; Other Eukaryotes - 8256 (source: NCBI BLink).  |
| AT4G23430 | AT4G23430.1 | TTGACTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23420.2); Has 37226 Blast hits to 37180 proteins in 1745 species: Archae - 231; Bacteria - 21300; Metazoa - 3770; Fungi - 2218; Plants - 861; Viruses - 0; Other Eukaryotes - 8846 (source: NCBI BLink).  |
| AT4G23430.2 | TTGACTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23420.2); Has 37226 Blast hits to 37180 proteins in 1745 species: Archae - 231; Bacteria - 21300; Metazoa - 3770; Fungi - 2218; Plants - 861; Viruses - 0; Other Eukaryotes - 8846 (source: NCBI BLink).  |
| AT4G23430.3 | TTGACTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23420.2); Has 37226 Blast hits to 37180 proteins in 1745 species: Archae - 231; Bacteria - 21300; Metazoa - 3770; Fungi - 2218; Plants - 861; Viruses - 0; Other Eukaryotes - 8846 (source: NCBI BLink).  |
| AT4G23550 | AT4G23550.1 | AAAGTCAA | Encodes WRKY DNA-binding protein 29 (WRKY29).  |
| AT4G23550.1 | TTGACTTT | Encodes WRKY DNA-binding protein 29 (WRKY29).  |
| AT4G23850 | AT4G23850.1 | TTGACTTT | long-chain-fatty-acid--CoA ligase / long-chain acyl-CoA synthetase; FUNCTIONS IN: catalytic activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: long-chain-fatty-acid--CoA ligase, putative / long-chain acyl-CoA synthetase, putative (TAIR:AT4G11030.1); Has 34929 Blast hits to 33173 proteins in 1967 species: Archae - 465; Bacteria - 18245; Metazoa - 1999; Fungi - 1232; Plants - 1153; Viruses - 1; Other Eukaryotes - 11834 (source: NCBI BLink).  |
| AT4G24290 | AT4G24290.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G24290.2 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G24440 | AT4G24440.1 | TTGACTTT | transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT4G24440.2 | TTGACTTT | transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT4G24520 | AT4G24520.1 | AAAGTCAA | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism.  |
| AT4G24690 | AT4G24690.1 | AAAGTCAA | ubiquitin-associated (UBA)/TS-N domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Zinc finger, ZZ-type (InterPro:IPR000433); Has 492 Blast hits to 472 proteins in 101 species: Archae - 0; Bacteria - 6; Metazoa - 329; Fungi - 68; Plants - 57; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
| AT4G24840 | AT4G24840.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
| AT4G24840.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
| AT4G24920 | AT4G24920.1 | TTGACTTT | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT4G25110 | AT4G25110.1 | AAAGTCAA | metacaspase 2 (AtMC2); FUNCTIONS IN: cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600), Zinc finger, LSD1-type (InterPro:IPR005735); BEST Arabidopsis thaliana protein match is: AMC1 (METACASPASE 1); cysteine-type endopeptidase (TAIR:AT1G02170.1); Has 7004 Blast hits to 3377 proteins in 428 species: Archae - 6; Bacteria - 590; Metazoa - 997; Fungi - 825; Plants - 2862; Viruses - 584; Other Eukaryotes - 1140 (source: NCBI BLink).  |
| AT4G25110.1 | AAAGTCAA | metacaspase 2 (AtMC2); FUNCTIONS IN: cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600), Zinc finger, LSD1-type (InterPro:IPR005735); BEST Arabidopsis thaliana protein match is: AMC1 (METACASPASE 1); cysteine-type endopeptidase (TAIR:AT1G02170.1); Has 7004 Blast hits to 3377 proteins in 428 species: Archae - 6; Bacteria - 590; Metazoa - 997; Fungi - 825; Plants - 2862; Viruses - 584; Other Eukaryotes - 1140 (source: NCBI BLink).  |
| AT4G25110.2 | AAAGTCAA | metacaspase 2 (AtMC2); FUNCTIONS IN: cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600), Zinc finger, LSD1-type (InterPro:IPR005735); BEST Arabidopsis thaliana protein match is: AMC1 (METACASPASE 1); cysteine-type endopeptidase (TAIR:AT1G02170.1); Has 7004 Blast hits to 3377 proteins in 428 species: Archae - 6; Bacteria - 590; Metazoa - 997; Fungi - 825; Plants - 2862; Viruses - 584; Other Eukaryotes - 1140 (source: NCBI BLink).  |
| AT4G25110.2 | AAAGTCAA | metacaspase 2 (AtMC2); FUNCTIONS IN: cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600), Zinc finger, LSD1-type (InterPro:IPR005735); BEST Arabidopsis thaliana protein match is: AMC1 (METACASPASE 1); cysteine-type endopeptidase (TAIR:AT1G02170.1); Has 7004 Blast hits to 3377 proteins in 428 species: Archae - 6; Bacteria - 590; Metazoa - 997; Fungi - 825; Plants - 2862; Viruses - 584; Other Eukaryotes - 1140 (source: NCBI BLink).  |
| AT4G25370 | AT4G25370.1 | AAAGTCAA | Clp amino terminal domain-containing protein; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein metabolic process; LOCATED IN: thylakoid, plastid stroma, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clp, N-terminal (InterPro:IPR004176); BEST Arabidopsis thaliana protein match is: Clp amino terminal domain-containing protein (TAIR:AT4G12060.1); Has 1552 Blast hits to 1379 proteins in 369 species: Archae - 0; Bacteria - 1010; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 2; Other Eukaryotes - 457 (source: NCBI BLink).  |
| AT4G25500 | AT4G25500.1 | AAAGTCAA | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.  |
| AT4G25660 | AT4G25660.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25680.1); Has 499 Blast hits to 499 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 37; Plants - 181; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
| AT4G25835 | AT4G25835.1 | AAAGTCAA | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT5G57480.1); Has 13162 Blast hits to 12230 proteins in 1599 species: Archae - 679; Bacteria - 3954; Metazoa - 2290; Fungi - 1664; Plants - 1151; Viruses - 24; Other Eukaryotes - 3400 (source: NCBI BLink).  |
| AT4G25880 | AT4G25880.1 | AAAGTCAA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink).  |
| AT4G25880.2 | AAAGTCAA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink).  |
| AT4G25880.3 | AAAGTCAA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink).  |
| AT4G26090 | AT4G26090.1 | TTGACTTT | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2.  |
| AT4G26710 | AT4G26710.1 | AAAGTCAA | ATP synthase subunit H family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: ATP hydrolysis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V0 complex, subunit E (InterPro:IPR008389); BEST Arabidopsis thaliana protein match is: ATP synthase subunit H family protein (TAIR:AT5G55290.2); Has 250 Blast hits to 250 proteins in 81 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 12; Plants - 36; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT4G26710.2 | AAAGTCAA | ATP synthase subunit H family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: ATP hydrolysis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V0 complex, subunit E (InterPro:IPR008389); BEST Arabidopsis thaliana protein match is: ATP synthase subunit H family protein (TAIR:AT5G55290.2); Has 250 Blast hits to 250 proteins in 81 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 12; Plants - 36; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT4G26750 | AT4G26750.1 | AAAGTCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF605 (InterPro:IPR006745); BEST Arabidopsis thaliana protein match is: ATGSL11 (glucan synthase-like 11); 1,3-beta-glucan synthase/ transferase, transferring glycosyl groups (TAIR:AT3G59100.1); Has 27093 Blast hits to 16071 proteins in 790 species: Archae - 16; Bacteria - 1458; Metazoa - 10297; Fungi - 5609; Plants - 4452; Viruses - 743; Other Eukaryotes - 4518 (source: NCBI BLink).  |
| AT4G27120 | AT4G27120.1 | AAAGTCAA | unknown protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 15262 Blast hits to 8289 proteins in 585 species: Archae - 27; Bacteria - 1387; Metazoa - 6452; Fungi - 1437; Plants - 513; Viruses - 165; Other Eukaryotes - 5281 (source: NCBI BLink).  |
| AT4G27120.2 | AAAGTCAA | unknown protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 15262 Blast hits to 8289 proteins in 585 species: Archae - 27; Bacteria - 1387; Metazoa - 6452; Fungi - 1437; Plants - 513; Viruses - 165; Other Eukaryotes - 5281 (source: NCBI BLink).  |
| AT4G27640 | AT4G27640.1 | AAAGTCAA | importin beta-2 subunit family protein; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: emb2734 (embryo defective 2734); binding / lyase (TAIR:AT5G19820.1); Has 1675 Blast hits to 1570 proteins in 167 species: Archae - 0; Bacteria - 4; Metazoa - 755; Fungi - 480; Plants - 159; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).  |
| AT4G27640.1 | AAAGTCAA | importin beta-2 subunit family protein; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: emb2734 (embryo defective 2734); binding / lyase (TAIR:AT5G19820.1); Has 1675 Blast hits to 1570 proteins in 167 species: Archae - 0; Bacteria - 4; Metazoa - 755; Fungi - 480; Plants - 159; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).  |
| AT4G27650 | AT4G27650.1 | TTGACTTT | Encodes Arabidopsis homolog of Drosophila pelota protein.  |
| AT4G27860 | AT4G27860.1 | AAAGTCAA | integral membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: embryo, hypocotyl, pedicel, root, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, C globular stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF125, transmembrane (InterPro:IPR008217), Cytokine, IL-1-like (InterPro:IPR008996); BEST Arabidopsis thaliana protein match is: integral membrane family protein (TAIR:AT4G27870.1); Has 126 Blast hits to 115 proteins in 34 species: Archae - 0; Bacteria - 9; Metazoa - 10; Fungi - 7; Plants - 56; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).  |
| AT4G28860 | AT4G28860.1 | TTGACTTT | Casein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink).  |
| AT4G28860.2 | TTGACTTT | Casein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink).  |
| AT4G29780 | AT4G29780.1 | AAAGTCAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12010.1); Has 674 Blast hits to 672 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 420; Fungi - 37; Plants - 217; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G30280 | AT4G30280.1 | AAAGTCAA | putative xyloglucan endotransglycosylase/hydrolase, expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs.  |
| AT4G30360 | AT4G30360.1 | TTGACTTT | member of Cyclic nucleotide gated channel family  |
| AT4G30400 | AT4G30400.1 | TTGACTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: MEE16 (maternal effect embryo arrest 16); protein binding / zinc ion binding (TAIR:AT2G18650.1); Has 6257 Blast hits to 6242 proteins in 227 species: Archae - 0; Bacteria - 0; Metazoa - 1925; Fungi - 543; Plants - 2685; Viruses - 49; Other Eukaryotes - 1055 (source: NCBI BLink).  |
| AT4G30660 | AT4G30660.1 | TTGACTTT | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT4G30660.2 | TTGACTTT | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT4G30980 | AT4G30980.1 | AAAGTCAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G24260.1); Has 1879 Blast hits to 1879 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 24; Plants - 1766; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT4G31350 | AT4G31350.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19160.1); Has 319 Blast hits to 319 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 303; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT4G31350.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19160.1); Has 319 Blast hits to 319 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 303; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT4G31460 | AT4G31460.1 | TTGACTTT | ribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink).  |
| AT4G32300 | AT4G32300.1 | AAAGTCAAAAGTCAA | S-DOMAIN-2 5 (SD2-5); FUNCTIONS IN: carbohydrate binding, protein kinase activity, kinase activity; INVOLVED IN: protein amino acid autophosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATP binding / carbohydrate binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase/ sugar binding (TAIR:AT5G35370.1); Has 86237 Blast hits to 85082 proteins in 3060 species: Archae - 46; Bacteria - 7202; Metazoa - 37588; Fungi - 6750; Plants - 19563; Viruses - 369; Other Eukaryotes - 14719 (source: NCBI BLink).  |
| AT4G32360 | AT4G32360.1 | AAAGTCAA | NADP adrenodoxin-like ferredoxin reductase; FUNCTIONS IN: electron carrier activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Adrenodoxin reductase (InterPro:IPR000759), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GLT1; glutamate synthase (NADH) (TAIR:AT5G53460.1); Has 5902 Blast hits to 5892 proteins in 1133 species: Archae - 91; Bacteria - 3487; Metazoa - 194; Fungi - 173; Plants - 55; Viruses - 0; Other Eukaryotes - 1902 (source: NCBI BLink).  |
| AT4G32600 | AT4G32600.1 | AGGGGTAAAGTCAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G80400.1); Has 7180 Blast hits to 7160 proteins in 223 species: Archae - 0; Bacteria - 6; Metazoa - 2398; Fungi - 545; Plants - 2870; Viruses - 33; Other Eukaryotes - 1328 (source: NCBI BLink).  |
| AT4G32650 | AT4G32650.1 | AAAGTCAA | A member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1.  |
| AT4G32650.2 | AAAGTCAA | A member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1.  |
| AT4G32650.3 | AAAGTCAA | A member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1.  |
| AT4G32680 | AT4G32680.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G32690 | AT4G32690.1 | AAAGTCAA | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast.  |
| AT4G32720 | AT4G32720.1 | AAAGTCAA | Encodes AtLa1, a member of the highly abundant phosphoprotein La proteins. Predominantly localized to the nucleoplasm and was also detected in the nucleolar cavity. Has RNA binding activity. Required for normal ribosome biogenesis and embryogenesis.  |
| AT4G32720.2 | AAAGTCAA | Encodes AtLa1, a member of the highly abundant phosphoprotein La proteins. Predominantly localized to the nucleoplasm and was also detected in the nucleolar cavity. Has RNA binding activity. Required for normal ribosome biogenesis and embryogenesis.  |
| AT4G32960 | AT4G32960.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32970.1); Has 78 Blast hits to 78 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G33430 | AT4G33430.1 | TTGACTTT | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome.  |
| AT4G34110 | AT4G34110.1 | TTGACTTT | Putative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins.  |
| AT4G34150 | AT4G34150.1 | AAAGTCAA | C2 domain-containing protein; INVOLVED IN: response to cold; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G63220.1); Has 51670 Blast hits to 22878 proteins in 1065 species: Archae - 56; Bacteria - 5686; Metazoa - 20666; Fungi - 7378; Plants - 9433; Viruses - 1410; Other Eukaryotes - 7041 (source: NCBI BLink).  |
| AT4G34180 | AT4G34180.1 | AAAGTCAAAAGTCAA | cyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT1G44542.1); Has 819 Blast hits to 819 proteins in 310 species: Archae - 59; Bacteria - 600; Metazoa - 35; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
| AT4G35490 | AT4G35490.1 | AAAGTCAA | MITOCHONDRIAL RIBOSOMAL PROTEIN L11 (MRPL11); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11, bacterial-type (InterPro:IPR006519), Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome (TAIR:AT1G32990.1); Has 5744 Blast hits to 5744 proteins in 1575 species: Archae - 191; Bacteria - 2960; Metazoa - 99; Fungi - 83; Plants - 65; Viruses - 0; Other Eukaryotes - 2346 (source: NCBI BLink).  |
| AT4G36210 | AT4G36210.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT4G36210.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT4G36210.3 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT4G36390 | AT4G36390.1 | AAAGTCAA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), tRNA-i(6)A37 modification enzyme MiaB (InterPro:IPR006463), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT1G72090.1); Has 10307 Blast hits to 10292 proteins in 1299 species: Archae - 219; Bacteria - 4582; Metazoa - 258; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 5193 (source: NCBI BLink).  |
| AT4G36430 | AT4G36430.1 | AAAGTCAA | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to other organism; LOCATED IN: cell wall; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT2G18150.1); Has 2968 Blast hits to 2951 proteins in 229 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 92; Plants - 2824; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
| AT4G36500 | AT4G36500.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18210.1); Has 24 Blast hits to 24 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G37250 | AT4G37250.1 | AAAGTCAA | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G23300.1); Has 84705 Blast hits to 60717 proteins in 2650 species: Archae - 63; Bacteria - 5442; Metazoa - 27750; Fungi - 3433; Plants - 38255; Viruses - 214; Other Eukaryotes - 9548 (source: NCBI BLink).  |
| AT4G37370 | AT4G37370.1 | TTGACTTT | member of CYP81D  |
| AT4G37460 | AT4G37460.1 | AAAGTCAA | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity.  |
| AT4G37910 | AT4G37910.1 | AAAGTCAA | mitochondrial heat shock protein 70-1 (mtHsc70-1); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to salt stress, response to heat; LOCATED IN: mitochondrion, cell wall, plasma membrane, mitochondrial matrix; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Chaperone DnaK (InterPro:IPR012725), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: MTHSC70-2 (MITOCHONDRIAL HSP70 2); ATP binding (TAIR:AT5G09590.1); Has 25409 Blast hits to 25308 proteins in 3114 species: Archae - 101; Bacteria - 9998; Metazoa - 2940; Fungi - 1134; Plants - 697; Viruses - 241; Other Eukaryotes - 10298 (source: NCBI BLink).  |
| AT4G37970 | AT4G37970.1 | AAAGTCAAAACG | CINNAMYL ALCOHOL DEHYDROGENASE 6 (CAD6); FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 22264 Blast hits to 22252 proteins in 1793 species: Archae - 377; Bacteria - 12614; Metazoa - 1134; Fungi - 1791; Plants - 1846; Viruses - 3; Other Eukaryotes - 4499 (source: NCBI BLink).  |
| AT4G38180 | AT4G38180.1 | AAAGTCAA | FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 1; Fungi - 125; Plants - 879; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT4G38210 | AT4G38210.1 | AAAGTCAA | expansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.  |
| AT4G38770 | AT4G38770.1 | AAAGTCAA | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant.  |
| AT4G39280 | AT4G39280.1 | AAAGTCAA | phenylalanyl-tRNA synthetase, putative / phenylalanine--tRNA ligase, putative; FUNCTIONS IN: phenylalanine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: phenylalanyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phenylalanyl-tRNA synthetase, class IIc, C-terminal (InterPro:IPR018157), Phenylalanyl-tRNA synthetase, class IIc, alpha subunit (InterPro:IPR004529), Phenylalanyl-tRNA synthetase, class IIc, conserved region (InterPro:IPR002319), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: phenylalanyl-tRNA synthetase class IIc family protein (TAIR:AT3G58140.1); Has 7323 Blast hits to 7319 proteins in 1861 species: Archae - 218; Bacteria - 3707; Metazoa - 244; Fungi - 169; Plants - 50; Viruses - 0; Other Eukaryotes - 2935 (source: NCBI BLink).  |
| AT4G40070 | AT4G40070.1 | AAAGTCAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ATL6; protein binding / zinc ion binding (TAIR:AT3G05200.1); Has 6611 Blast hits to 6592 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 2223; Fungi - 509; Plants - 2677; Viruses - 63; Other Eukaryotes - 1139 (source: NCBI BLink).  |
| AT5G01220 | AT5G01220.1 | AAAGTCAA | involved in sulfolipid biosynthesis  |
| AT5G01260 | AT5G01260.1 | AAAGTCAA | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT5G01260.2 | AAAGTCAA | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT5G01750 | AT5G01750.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11740.1); Has 229 Blast hits to 229 proteins in 33 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 21; Plants - 190; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G01750.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11740.1); Has 229 Blast hits to 229 proteins in 33 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 21; Plants - 190; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G01830 | AT5G01830.1 | AAAGTCAA | armadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: PUB17 (PLANT U-BOX 17); ubiquitin-protein ligase (TAIR:AT1G29340.1); Has 1693 Blast hits to 1583 proteins in 125 species: Archae - 0; Bacteria - 16; Metazoa - 163; Fungi - 73; Plants - 1229; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).  |
| AT5G02290 | AT5G02290.1 | AAAGTCAA | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl.  |
| AT5G02290.2 | AAAGTCAA | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl.  |
| AT5G02370 | AT5G02370.1 | AAAGTCAA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink).  |
| AT5G02680 | AT5G02680.1 | TTGACTTT | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT1G10310.1); Has 160 Blast hits to 160 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 90; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
| AT5G02800 | AT5G02800.1 | AAAGTCAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G18610.1); Has 83344 Blast hits to 82187 proteins in 2998 species: Archae - 46; Bacteria - 7479; Metazoa - 36740; Fungi - 6377; Plants - 18583; Viruses - 348; Other Eukaryotes - 13771 (source: NCBI BLink).  |
| AT5G03020 | AT5G03020.1 | AAAGTCAA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, sperm cell, leaf; EXPRESSED DURING: LP.06 six leaves visible; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT5G02990.1); Has 4926 Blast hits to 3036 proteins in 204 species: Archae - 8; Bacteria - 170; Metazoa - 3686; Fungi - 57; Plants - 699; Viruses - 140; Other Eukaryotes - 166 (source: NCBI BLink).  |
| AT5G03140 | AT5G03140.1 | AAAGTCAA | lectin protein kinase family protein; FUNCTIONS IN: carbohydrate binding, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase-related (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: lectin protein kinase family protein (TAIR:AT3G53380.1); Has 86443 Blast hits to 85431 proteins in 3024 species: Archae - 50; Bacteria - 7703; Metazoa - 37587; Fungi - 6804; Plants - 19480; Viruses - 384; Other Eukaryotes - 14435 (source: NCBI BLink).  |
| AT5G03260 | AT5G03260.1 | AAAGTCAA | putative laccase, a member of laccase family of genes (17 members in Arabidopsis).  |
| AT5G05010 | AT5G05010.1 | TTGACTTT | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
| AT5G05010.2 | TTGACTTT | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
| AT5G05340 | AT5G05340.1 | AAAGTCAA | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G58400.1); Has 2945 Blast hits to 2930 proteins in 223 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 110; Plants - 2778; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
| AT5G05700 | AT5G05700.1 | AAAGTCAA | Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence.  |
| AT5G05710 | AT5G05710.1 | TTGACTTT | pleckstrin homology (PH) domain-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ATPH1 (ARABIDOPSIS THALIANA PLECKSTRIN HOMOLOGUE 1); phosphoinositide binding (TAIR:AT2G29700.1); Has 2462 Blast hits to 2395 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 2053; Fungi - 42; Plants - 46; Viruses - 3; Other Eukaryotes - 318 (source: NCBI BLink).  |
| AT5G05720 | AT5G05720.1 | TTGACTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G19610.1); Has 1775 Blast hits to 1417 proteins in 229 species: Archae - 0; Bacteria - 42; Metazoa - 880; Fungi - 402; Plants - 209; Viruses - 0; Other Eukaryotes - 242 (source: NCBI BLink).  |
| AT5G05730 | AT5G05730.1 | TTGACTTT | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots.  |
| AT5G05820 | AT5G05820.1 | AAAGTCAA | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT3G11320.1); Has 2065 Blast hits to 2060 proteins in 219 species: Archae - 12; Bacteria - 61; Metazoa - 649; Fungi - 309; Plants - 765; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink).  |
| AT5G06060 | AT5G06060.1 | AAAGTCAA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29290.2); Has 88350 Blast hits to 88156 proteins in 2259 species: Archae - 471; Bacteria - 47428; Metazoa - 5087; Fungi - 4564; Plants - 1650; Viruses - 7; Other Eukaryotes - 29143 (source: NCBI BLink).  |
| AT5G06320 | AT5G06320.1 | TTGACTTT | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane.  |
| AT5G06450 | AT5G06450.1 | AAAGTCAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT3G11770.1); Has 41 Blast hits to 41 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G06660 | AT5G06660.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
| AT5G07080 | AT5G07080.1 | TTGACTTT | transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G47170.1); Has 1269 Blast hits to 1261 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 37; Plants - 1231; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G07400 | AT5G07400.1 | TTGACTTT | forkhead-associated domain-containing protein / FHA domain-containing protein; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, phosphoric diester hydrolase activity, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA repair; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, seed; EXPRESSED DURING: F mature embryo stage; CONTAINS InterPro DOMAIN/s: Tyrosyl-DNA phosphodiesterase (InterPro:IPR010347), SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253), HIP116, Rad5p N-terminal (InterPro:IPR014905); BEST Arabidopsis thaliana protein match is: tyrosyl-DNA phosphodiesterase-related (TAIR:AT5G15170.1); Has 327 Blast hits to 296 proteins in 84 species: Archae - 0; Bacteria - 2; Metazoa - 187; Fungi - 58; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
| AT5G07770 | AT5G07770.1 | AAAGTCAA | formin homology 2 domain-containing protein / FH2 domain-containing protein; FUNCTIONS IN: actin binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: formin homology 2 domain-containing protein / FH2 domain-containing protein (TAIR:AT5G07780.1); Has 30202 Blast hits to 12248 proteins in 656 species: Archae - 50; Bacteria - 2578; Metazoa - 12793; Fungi - 3250; Plants - 6039; Viruses - 1524; Other Eukaryotes - 3968 (source: NCBI BLink).  |
| AT5G08180 | AT5G08180.1 | AAAGTCAAAAGTCAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1570 Blast hits to 1570 proteins in 296 species: Archae - 226; Bacteria - 0; Metazoa - 560; Fungi - 291; Plants - 151; Viruses - 0; Other Eukaryotes - 342 (source: NCBI BLink).  |
| AT5G08310 | AT5G08310.1 | TTGACTTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G06540.1); Has 28943 Blast hits to 5852 proteins in 175 species: Archae - 3; Bacteria - 8; Metazoa - 285; Fungi - 340; Plants - 27269; Viruses - 0; Other Eukaryotes - 1038 (source: NCBI BLink).  |
| AT5G08450 | AT5G08450.1 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylation protein Rxt3 (InterPro:IPR013951); Has 32702 Blast hits to 18312 proteins in 878 species: Archae - 45; Bacteria - 1760; Metazoa - 16233; Fungi - 3347; Plants - 1326; Viruses - 208; Other Eukaryotes - 9783 (source: NCBI BLink).  |
| AT5G08450.2 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylation protein Rxt3 (InterPro:IPR013951); Has 32702 Blast hits to 18312 proteins in 878 species: Archae - 45; Bacteria - 1760; Metazoa - 16233; Fungi - 3347; Plants - 1326; Viruses - 208; Other Eukaryotes - 9783 (source: NCBI BLink).  |
| AT5G08450.3 | TTGACTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylation protein Rxt3 (InterPro:IPR013951); Has 32702 Blast hits to 18312 proteins in 878 species: Archae - 45; Bacteria - 1760; Metazoa - 16233; Fungi - 3347; Plants - 1326; Viruses - 208; Other Eukaryotes - 9783 (source: NCBI BLink).  |
| AT5G09510 | AT5G09510.1 | AAAGTCAA | 40S ribosomal protein S15 (RPS15D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15, eukaryotic/archaeal (InterPro:IPR005713), Ribosomal protein S19/S15 (InterPro:IPR002222); BEST Arabidopsis thaliana protein match is: RPS15 (CYTOSOLIC RIBOSOMAL PROTEIN S15); structural constituent of ribosome (TAIR:AT1G04270.1); Has 5257 Blast hits to 5257 proteins in 1528 species: Archae - 179; Bacteria - 2329; Metazoa - 207; Fungi - 153; Plants - 533; Viruses - 0; Other Eukaryotes - 1856 (source: NCBI BLink).  |
| AT5G09510.2 | AAAGTCAA | 40S ribosomal protein S15 (RPS15D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15, eukaryotic/archaeal (InterPro:IPR005713), Ribosomal protein S19/S15 (InterPro:IPR002222); BEST Arabidopsis thaliana protein match is: RPS15 (CYTOSOLIC RIBOSOMAL PROTEIN S15); structural constituent of ribosome (TAIR:AT1G04270.1); Has 5257 Blast hits to 5257 proteins in 1528 species: Archae - 179; Bacteria - 2329; Metazoa - 207; Fungi - 153; Plants - 533; Viruses - 0; Other Eukaryotes - 1856 (source: NCBI BLink).  |
| AT5G09640 | AT5G09640.1 | TTGACTTT | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase.  |
| AT5G10030 | AT5G10030.1 | TTGACTTT | Encodes a member of basic leucine zipper transcription gene family. Nomenclature according to Xiang, et al. (1997).  |
| AT5G10470 | AT5G10470.1 | AAAGTCAA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT5G65460.1); Has 10636 Blast hits to 9695 proteins in 419 species: Archae - 26; Bacteria - 319; Metazoa - 5207; Fungi - 1022; Plants - 952; Viruses - 6; Other Eukaryotes - 3104 (source: NCBI BLink).  |
| AT5G10470.2 | AAAGTCAA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT5G65460.1); Has 10636 Blast hits to 9695 proteins in 419 species: Archae - 26; Bacteria - 319; Metazoa - 5207; Fungi - 1022; Plants - 952; Viruses - 6; Other Eukaryotes - 3104 (source: NCBI BLink).  |
| AT5G10690 | AT5G10690.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12775.1); Has 9217 Blast hits to 4059 proteins in 145 species: Archae - 2; Bacteria - 6; Metazoa - 124; Fungi - 115; Plants - 8658; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).  |
| AT5G10695 | AT5G10695.1 | TTGACTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G10830 | AT5G10830.1 | AAAGTCAA | embryo-abundant protein-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: embryo-abundant protein-related (TAIR:AT4G22530.1); Has 723 Blast hits to 719 proteins in 270 species: Archae - 2; Bacteria - 413; Metazoa - 59; Fungi - 86; Plants - 109; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
| AT5G10840 | AT5G10840.1 | TTGACTTT | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae - 0; Bacteria - 38; Metazoa - 446; Fungi - 142; Plants - 235; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
| AT5G11000 | AT5G11000.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF868, plant (InterPro:IPR008586); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25200.1); Has 142 Blast hits to 142 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G11500 | AT5G11500.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF814 (InterPro:IPR008532); Has 474 Blast hits to 464 proteins in 164 species: Archae - 0; Bacteria - 62; Metazoa - 174; Fungi - 86; Plants - 37; Viruses - 1; Other Eukaryotes - 114 (source: NCBI BLink).  |
| AT5G11630 | AT5G11630.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G11630.2 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G11960 | AT5G11960.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); Has 392 Blast hits to 392 proteins in 102 species: Archae - 0; Bacteria - 106; Metazoa - 113; Fungi - 51; Plants - 71; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
| AT5G12010 | AT5G12010.1 | AAAGTCAA | unknown protein; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29780.1); Has 746 Blast hits to 744 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 425; Fungi - 40; Plants - 268; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT5G12130 | AT5G12130.1 | AAAGTCAA | PIGMENT DEFECTIVE 149 (PDE149); INVOLVED IN: thylakoid membrane organization; LOCATED IN: chloroplast thylakoid membrane, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Integral membrane protein TerC (InterPro:IPR005496); Has 2303 Blast hits to 2303 proteins in 668 species: Archae - 4; Bacteria - 1555; Metazoa - 2; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 721 (source: NCBI BLink).  |
| AT5G13030 | AT5G13030.1 | TGAACCGGAAAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0061 (InterPro:IPR003846); Has 4055 Blast hits to 4018 proteins in 759 species: Archae - 4; Bacteria - 1451; Metazoa - 102; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 2390 (source: NCBI BLink).  |
| AT5G13470 | AT5G13470.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G13990 | AT5G13990.1 | AAAGTCAACGGTC | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.  |
| AT5G14030 | AT5G14030.1 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G14030.2 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G14030.3 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G14030.4 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G14380 | AT5G14380.1 | AAAGTCAA | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth.  |
| AT5G14930 | AT5G14930.1 | TTGACTTT | encodes an acyl hydrolase involved in senescence .  |
| AT5G14930.2 | TTGACTTT | encodes an acyl hydrolase involved in senescence .  |
| AT5G14930.3 | TTGACTTT | encodes an acyl hydrolase involved in senescence .  |
| AT5G15980 | AT5G15980.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G02490.1); Has 4016 Blast hits to 1961 proteins in 56 species: Archae - 0; Bacteria - 17; Metazoa - 19; Fungi - 4; Plants - 3946; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
| AT5G16010 | AT5G16010.1 | AAAGTCAA | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, 3-oxo-5-alpha-steroid 4-dehydrogenase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104); BEST Arabidopsis thaliana protein match is: DET2 (DE-ETIOLATED 2); sterol 5-alpha reductase (TAIR:AT2G38050.1); Has 1046 Blast hits to 1046 proteins in 184 species: Archae - 0; Bacteria - 40; Metazoa - 396; Fungi - 154; Plants - 129; Viruses - 0; Other Eukaryotes - 327 (source: NCBI BLink).  |
| AT5G16210 | AT5G16210.1 | TTGACTTT | HEAT repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), LisH dimerisation motif (InterPro:IPR006594), Armadillo-type fold (InterPro:IPR016024); Has 5435 Blast hits to 4228 proteins in 406 species: Archae - 36; Bacteria - 578; Metazoa - 2571; Fungi - 341; Plants - 173; Viruses - 14; Other Eukaryotes - 1722 (source: NCBI BLink).  |
| AT5G16970 | AT5G16970.1 | AAAGTCAA | encodes a 2-alkenal reductase (EC 1.3.1.74), plays a key role in the detoxification of reactive carbonyls  |
| AT5G17820 | AT5G17820.1 | TTGACTTT | peroxidase 57 (PER57) (P57) (PRXR10); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: cell wall, membrane, plant-type cell wall; EXPRESSED IN: root, leaf; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G03670.1); Has 2859 Blast hits to 2843 proteins in 198 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 46; Plants - 2774; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
| AT5G18420 | AT5G18420.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 177 Blast hits to 177 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
| AT5G18420.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 177 Blast hits to 177 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
| AT5G18420.3 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 177 Blast hits to 177 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
| AT5G18620 | AT5G18620.1 | TTGACTTT | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  |
| AT5G18620.2 | TTGACTTT | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  |
| AT5G18630 | AT5G18630.1 | AAAGTCAA | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  |
| AT5G18630.2 | AAAGTCAA | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  |
| AT5G18630.3 | AAAGTCAA | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  |
| AT5G19230 | AT5G19230.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: callus; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19240.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G19690 | AT5G19690.1 | CGGTTTGGAAAGTCAA | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions  |
| AT5G20060 | AT5G20060.1 | AAAGTCAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.2 | AAAGTCAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.3 | AAAGTCAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20090 | AT5G20090.1 | TTGACTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT5G20090.2 | TTGACTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT5G20090.3 | TTGACTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT5G20160 | AT5G20160.1 | AAAGTCAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
| AT5G20160.2 | AAAGTCAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
| AT5G20160.3 | AAAGTCAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
| AT5G20190 | AT5G20190.1 | AAAGTCAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G80130.1); Has 303 Blast hits to 195 proteins in 27 species: Archae - 0; Bacteria - 78; Metazoa - 7; Fungi - 10; Plants - 171; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
| AT5G20400 | AT5G20400.1 | AAAGTCAA | encodes a protein whose sequence is similar to flavanone 3 hydroxylase from Malus.  |
| AT5G20650 | AT5G20650.1 | TTGACTTT | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast  |
| AT5G20660 | AT5G20660.1 | AAAGTCAA | 24 kDa vacuolar protein, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M28 (InterPro:IPR007484); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT1G67420.1); Has 935 Blast hits to 925 proteins in 208 species: Archae - 6; Bacteria - 236; Metazoa - 415; Fungi - 154; Plants - 39; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
| AT5G20830 | AT5G20830.1 | TTGACTTT | Encodes a protein with sucrose synthase activity (SUS1).  |
| AT5G20830.2 | TTGACTTT | Encodes a protein with sucrose synthase activity (SUS1).  |
| AT5G20900 | AT5G20900.1 | AAAGTCAA | JASMONATE-ZIM-DOMAIN PROTEIN 12 (JAZ12); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ11 (JASMONATE-ZIM-DOMAIN PROTEIN 11) (TAIR:AT3G43440.1); Has 247 Blast hits to 242 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 245; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G22220 | AT5G22220.2 | TTGACTTT | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. Binds DPA and RBR1 proteins. Expressed throughout the cell cycle. Abundance increased by auxin through stabilization of the protein. Elevates CDK levels and activity, even under hormone-free conditions. Promotes cell division and shortens cell doubling time, inhibits cell growth. Transgenic plants overexpressing AtE2Fa contained an increased level of AtE2Fb transcripts that is paralleled by an increase in the amount of the AtE2Fb protein, suggesting that AtE2Fb expression might actually be up-regulated by the AtE2Fa transcription factor.  |
| AT5G22220.3 | TTGACTTT | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. Binds DPA and RBR1 proteins. Expressed throughout the cell cycle. Abundance increased by auxin through stabilization of the protein. Elevates CDK levels and activity, even under hormone-free conditions. Promotes cell division and shortens cell doubling time, inhibits cell growth. Transgenic plants overexpressing AtE2Fa contained an increased level of AtE2Fb transcripts that is paralleled by an increase in the amount of the AtE2Fb protein, suggesting that AtE2Fb expression might actually be up-regulated by the AtE2Fa transcription factor.  |
| AT5G22860 | AT5G22860.1 | TTGACTTT | serine carboxypeptidase S28 family protein; FUNCTIONS IN: serine-type peptidase activity, peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S28 (InterPro:IPR008758); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S28 family protein (TAIR:AT5G65760.1); Has 891 Blast hits to 867 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 514; Fungi - 129; Plants - 106; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT5G22860.2 | TTGACTTT | serine carboxypeptidase S28 family protein; FUNCTIONS IN: serine-type peptidase activity, peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S28 (InterPro:IPR008758); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S28 family protein (TAIR:AT5G65760.1); Has 891 Blast hits to 867 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 514; Fungi - 129; Plants - 106; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT5G23340 | AT5G23340.1 | TTGACTTT | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL4) (TAIR:AT4G15475.1); Has 9095 Blast hits to 3545 proteins in 210 species: Archae - 0; Bacteria - 454; Metazoa - 4575; Fungi - 774; Plants - 2118; Viruses - 15; Other Eukaryotes - 1159 (source: NCBI BLink).  |
| AT5G23710 | AT5G23710.1 | TTGACTTT | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpc34-like (InterPro:IPR016049), RNA polymerase Rpc34 (InterPro:IPR007832); Has 254 Blast hits to 241 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
| AT5G24110 | AT5G24110.1 | AAAGTCAA | member of WRKY Transcription Factor; Group III  |
| AT5G24270 | AT5G24270.1 | AAAGTCAA | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium.  |
| AT5G24890 | AT5G24890.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24550.1); Has 719 Blast hits to 663 proteins in 155 species: Archae - 0; Bacteria - 8; Metazoa - 291; Fungi - 108; Plants - 144; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink).  |
| AT5G25260 | AT5G25260.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25250.1); Has 4214 Blast hits to 3442 proteins in 652 species: Archae - 14; Bacteria - 1365; Metazoa - 1204; Fungi - 198; Plants - 130; Viruses - 8; Other Eukaryotes - 1295 (source: NCBI BLink).  |
| AT5G25440 | AT5G25440.1 | TTGACTTT | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G11410.1); Has 37433 Blast hits to 37026 proteins in 1128 species: Archae - 24; Bacteria - 1745; Metazoa - 15094; Fungi - 1709; Plants - 13857; Viruses - 129; Other Eukaryotes - 4875 (source: NCBI BLink).  |
| AT5G25450 | AT5G25450.1 | AAAGTCAA | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT4G32470.1); Has 242 Blast hits to 242 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 160; Fungi - 25; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G25820 | AT5G25820.1 | TTGACTTT | exostosin family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: membrane; EXPRESSED IN: stem, root, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT4G32790.1); Has 8434 Blast hits to 4016 proteins in 504 species: Archae - 32; Bacteria - 1053; Metazoa - 1697; Fungi - 739; Plants - 1189; Viruses - 158; Other Eukaryotes - 3566 (source: NCBI BLink).  |
| AT5G26290 | AT5G26290.1 | AAAGTCAA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT5G26280.1); Has 263 Blast hits to 213 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 250; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT5G26760 | AT5G26760.2 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF408 (InterPro:IPR007308); Has 247 Blast hits to 205 proteins in 87 species: Archae - 0; Bacteria - 73; Metazoa - 105; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT5G27100 | AT5G27100.1 | TTGACTTT | member of Putative ligand-gated ion channel subunit family  |
| AT5G27600 | AT5G27600.1 | TTGACTTT | Encode peroxisomal long-chain acyl-CoA synthetase. Activates fatty acids for further metabolism. Interacts with PEX5.  |
| AT5G27630 | AT5G27630.1 | AAAGTCAA | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport.  |
| AT5G28040 | AT5G28040.1 | TTGACTTT | transcription regulator; FUNCTIONS IN: transcription regulator activity; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT3G04930.1); Has 185 Blast hits to 182 proteins in 24 species: Archae - 0; Bacteria - 12; Metazoa - 14; Fungi - 2; Plants - 148; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT5G35630 | AT5G35630.1 | AAAGTCAA | chloroplastic glutamine synthetase  |
| AT5G35630.2 | AAAGTCAA | chloroplastic glutamine synthetase  |
| AT5G35630.3 | AAAGTCAA | chloroplastic glutamine synthetase  |
| AT5G35740 | AT5G35740.1 | AAAGTCAA | glycosyl hydrolase family protein 17; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family protein 17 (TAIR:AT2G04910.2); Has 750 Blast hits to 714 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 747; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G36930 | AT5G36930.1 | AAAGTCAA | disease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: transmembrane receptor activity, protein binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT5G17680.1); Has 20829 Blast hits to 15249 proteins in 546 species: Archae - 25; Bacteria - 1319; Metazoa - 3573; Fungi - 114; Plants - 15065; Viruses - 4; Other Eukaryotes - 729 (source: NCBI BLink).  |
| AT5G36930.2 | AAAGTCAA | disease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: transmembrane receptor activity, protein binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT5G17680.1); Has 20829 Blast hits to 15249 proteins in 546 species: Archae - 25; Bacteria - 1319; Metazoa - 3573; Fungi - 114; Plants - 15065; Viruses - 4; Other Eukaryotes - 729 (source: NCBI BLink).  |
| AT5G37010 | AT5G37010.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65710.1); Has 6220 Blast hits to 4682 proteins in 319 species: Archae - 5; Bacteria - 344; Metazoa - 3406; Fungi - 489; Plants - 297; Viruses - 48; Other Eukaryotes - 1631 (source: NCBI BLink).  |
| AT5G38020 | AT5G38020.1 | TTGACTTT | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus)  |
| AT5G39250 | AT5G39250.1 | AAAGTCAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G39785 | AT5G39785.1 | AAAGTCAA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195), Protein of unknown function DUF1666 (InterPro:IPR012870); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G69610.1); Has 391 Blast hits to 361 proteins in 78 species: Archae - 0; Bacteria - 12; Metazoa - 50; Fungi - 48; Plants - 52; Viruses - 4; Other Eukaryotes - 225 (source: NCBI BLink).  |
| AT5G39785.2 | AAAGTCAA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195), Protein of unknown function DUF1666 (InterPro:IPR012870); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G69610.1); Has 391 Blast hits to 361 proteins in 78 species: Archae - 0; Bacteria - 12; Metazoa - 50; Fungi - 48; Plants - 52; Viruses - 4; Other Eukaryotes - 225 (source: NCBI BLink).  |
| AT5G40370 | AT5G40370.1 | TTGACTTT | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  |
| AT5G40370.2 | TTGACTTT | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  |
| AT5G40590 | AT5G40590.1 | TTGACTTT | DC1 domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT2G44370.1); Has 1561 Blast hits to 538 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1553; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G41140 | AT5G41140.1 | TTGACTTTTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63300.1); Has 134231 Blast hits to 67045 proteins in 2157 species: Archae - 1495; Bacteria - 17732; Metazoa - 63246; Fungi - 9993; Plants - 4740; Viruses - 695; Other Eukaryotes - 36330 (source: NCBI BLink).  |
| AT5G41170 | AT5G41170.1 | AAAGTCAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: stem, sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16710.1); Has 27867 Blast hits to 6121 proteins in 185 species: Archae - 5; Bacteria - 18; Metazoa - 886; Fungi - 644; Plants - 24943; Viruses - 0; Other Eukaryotes - 1371 (source: NCBI BLink).  |
| AT5G41950 | AT5G41950.1 | TTGACTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990); Has 4082 Blast hits to 2807 proteins in 401 species: Archae - 36; Bacteria - 931; Metazoa - 1006; Fungi - 261; Plants - 81; Viruses - 23; Other Eukaryotes - 1744 (source: NCBI BLink).  |
| AT5G41990 | AT5G41990.1 | TTGACTTT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Interacts specifically with and phosphorylates AtVHA-C, subunit C of the vacuolar H+-ATPase.  |
| AT5G41992 | AT5G41992.1 | TTGACTTT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF58 represents a conserved upstream opening reading frame relative to major ORF AT5G41990.1  |
| AT5G42740 | AT5G42740.1 | TTGACTTT | glucose-6-phosphate isomerase, cytosolic (PGIC); FUNCTIONS IN: glucose-6-phosphate isomerase activity; INVOLVED IN: response to cadmium ion, gluconeogenesis, glycolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglucose isomerase, conserved site (InterPro:IPR018189), Phosphoglucose isomerase (PGI) (InterPro:IPR001672); BEST Arabidopsis thaliana protein match is: PGI1 (PHOSPHOGLUCOSE ISOMERASE 1); glucose-6-phosphate isomerase (TAIR:AT4G24620.2); Has 7416 Blast hits to 7411 proteins in 2035 species: Archae - 34; Bacteria - 3763; Metazoa - 548; Fungi - 156; Plants - 870; Viruses - 0; Other Eukaryotes - 2045 (source: NCBI BLink).  |
| AT5G42860 | AT5G42860.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45688.1); Has 116 Blast hits to 115 proteins in 22 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 8; Plants - 91; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT5G43450 | AT5G43450.1 | AAAGTCAA | encodes a protein whose sequence is similar to ACC oxidase  |
| AT5G44080 | AT5G44080.1 | AAAGTCAA | bZIP transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: GBF4; DNA binding / sequence-specific DNA binding / transcription factor (TAIR:AT1G03970.1); Has 730 Blast hits to 730 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 2; Plants - 496; Viruses - 1; Other Eukaryotes - 22 (source: NCBI BLink).  |
| AT5G44568 | AT5G44568.1 | AAAGTCAAAGCGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 11 Blast hits to 11 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G44585 | AT5G44585.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G44660 | AT5G44660.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G20190.1); Has 881 Blast hits to 385 proteins in 98 species: Archae - 0; Bacteria - 247; Metazoa - 260; Fungi - 83; Plants - 38; Viruses - 6; Other Eukaryotes - 247 (source: NCBI BLink).  |
| AT5G44910 | AT5G44910.1 | TTGACTTT | Toll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: transmembrane receptor (TAIR:AT5G45000.1); Has 819 Blast hits to 775 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 819; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G44910.1 | TTGACTTT | Toll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: transmembrane receptor (TAIR:AT5G45000.1); Has 819 Blast hits to 775 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 819; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G45428 | AT5G45428.1 | AAAGTCAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF24 represents a conserved upstream opening reading frame relative to major ORF AT5G45430.1  |
| AT5G45800 | AT5G45800.1 | TTGACTTT | maternal effect embryo arrest 62 (MEE62); FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G24230.1); Has 55296 Blast hits to 36416 proteins in 1147 species: Archae - 36; Bacteria - 3164; Metazoa - 17246; Fungi - 1111; Plants - 30254; Viruses - 106; Other Eukaryotes - 3379 (source: NCBI BLink).  |
| AT5G46700 | AT5G46700.1 | AAAGTCAA | Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis.  |
| AT5G46780 | AT5G46780.1 | AAAGTCAA | VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: VQ motif-containing protein (TAIR:AT2G35230.1); Has 4220 Blast hits to 3332 proteins in 353 species: Archae - 0; Bacteria - 235; Metazoa - 1741; Fungi - 535; Plants - 1009; Viruses - 213; Other Eukaryotes - 487 (source: NCBI BLink).  |
| AT5G46780.2 | AAAGTCAA | VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: VQ motif-containing protein (TAIR:AT2G35230.1); Has 4220 Blast hits to 3332 proteins in 353 species: Archae - 0; Bacteria - 235; Metazoa - 1741; Fungi - 535; Plants - 1009; Viruses - 213; Other Eukaryotes - 487 (source: NCBI BLink).  |
| AT5G47430 | AT5G47430.1 | AAAGTCAA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G17410.1); Has 12501 Blast hits to 8536 proteins in 350 species: Archae - 0; Bacteria - 308; Metazoa - 7733; Fungi - 1802; Plants - 953; Viruses - 24; Other Eukaryotes - 1681 (source: NCBI BLink).  |
| AT5G47435 | AT5G47435.1 | TTGACTTT | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.  |
| AT5G47435.2 | TTGACTTT | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.  |
| AT5G48020 | AT5G48020.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 401 Blast hits to 401 proteins in 128 species: Archae - 0; Bacteria - 152; Metazoa - 8; Fungi - 34; Plants - 61; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
| AT5G48370 | AT5G48370.1 | AAAGTCAA | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT2G30720.1); Has 1582 Blast hits to 1273 proteins in 389 species: Archae - 24; Bacteria - 872; Metazoa - 411; Fungi - 61; Plants - 38; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).  |
| AT5G48370.2 | AAAGTCAA | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT2G30720.1); Has 1582 Blast hits to 1273 proteins in 389 species: Archae - 24; Bacteria - 872; Metazoa - 411; Fungi - 61; Plants - 38; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).  |
| AT5G48380 | AT5G48380.1 | AAAGTCAA | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein binding, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT1G27190.1); Has 76033 Blast hits to 53540 proteins in 1650 species: Archae - 26; Bacteria - 4465; Metazoa - 21735; Fungi - 2786; Plants - 38673; Viruses - 192; Other Eukaryotes - 8156 (source: NCBI BLink).  |
| AT5G48870 | AT5G48870.1 | AAAGTCAA | SAD1 encodes a polypeptide similar to multifunctional Sm-like snRNP proteins that are required for mRNA splicing, export, and degradation. Mutation in this gene increases plant sensitivity to drought stress and ABA in seed germination, root growth, and the expression of some stress-responsive genes.  |
| AT5G48940 | AT5G48940.1 | TTGACTTT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; EXPRESSED IN: root, cultured cell; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT3G24240.1); Has 168264 Blast hits to 96906 proteins in 2671 species: Archae - 101; Bacteria - 14907; Metazoa - 64564; Fungi - 7222; Plants - 59925; Viruses - 357; Other Eukaryotes - 21188 (source: NCBI BLink).  |
| AT5G49020 | AT5G49020.1 | AAAGTCAA | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.  |
| AT5G49020.2 | AAAGTCAA | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.  |
| AT5G49890 | AT5G49890.1 | TTGACTTT | member of Anion channel protein family  |
| AT5G50430 | AT5G50430.1 | TTGACTTT | ubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).  |
| AT5G50430.2 | TTGACTTT | ubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).  |
| AT5G50430.3 | TTGACTTT | ubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).  |
| AT5G51180 | AT5G51180.1 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25770.1); Has 499 Blast hits to 490 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 189; Plants - 98; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
| AT5G51180.1 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25770.1); Has 499 Blast hits to 490 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 189; Plants - 98; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
| AT5G51180.2 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25770.1); Has 499 Blast hits to 490 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 189; Plants - 98; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
| AT5G51180.2 | AAAGTCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25770.1); Has 499 Blast hits to 490 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 189; Plants - 98; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
| AT5G51570 | AT5G51570.1 | AAAGTCAA | band 7 family protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT5G62740.1); Has 3856 Blast hits to 3856 proteins in 1128 species: Archae - 126; Bacteria - 2499; Metazoa - 129; Fungi - 135; Plants - 159; Viruses - 18; Other Eukaryotes - 790 (source: NCBI BLink).  |
| AT5G51700 | AT5G51700.1 | AAAGTCAA | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation.  |
| AT5G52200 | AT5G52200.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 509 Blast hits to 471 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 232; Fungi - 109; Plants - 74; Viruses - 6; Other Eukaryotes - 88 (source: NCBI BLink).  |
| AT5G53530 | AT5G53530.1 | AAAGTCAA | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.  |
| AT5G53560 | AT5G53560.1 | AAAGTCAAAGCCCAACT | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase.  |
| AT5G53940 | AT5G53940.1 | TTGACTTT | yippee family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 696 Blast hits to 696 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
| AT5G54230 | AT5G54230.1 | TTGACTTT | Encodes a putative transcription factor (MYB49).  |
| AT5G54860 | AT5G54860.1 | AAAGTCAA | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT1G64890.1); Has 636 Blast hits to 542 proteins in 109 species: Archae - 2; Bacteria - 124; Metazoa - 4; Fungi - 2; Plants - 156; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink).  |
| AT5G55120 | AT5G55120.1 | AAAGTCAA | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2.  |
| AT5G55260 | AT5G55260.1 | TTGACTTT | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase.  |
| AT5G55310 | AT5G55310.1 | AAAGTCAA | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality.  |
| AT5G55610 | AT5G55610.1 | AAAGTCAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G55610.1 | AAAGTCAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G55610.2 | AAAGTCAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G55610.2 | AAAGTCAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G55940 | AT5G55940.1 | TTGACTTT | embryo defective 2731 (emb2731); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51620.3); Has 220 Blast hits to 219 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 10; Plants - 30; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).  |
| AT5G56350 | AT5G56350.1 | AAAGTCAA | pyruvate kinase, putative; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: pyruvate kinase, putative (TAIR:AT4G26390.1); Has 6880 Blast hits to 6803 proteins in 1521 species: Archae - 99; Bacteria - 3257; Metazoa - 491; Fungi - 169; Plants - 287; Viruses - 0; Other Eukaryotes - 2577 (source: NCBI BLink).  |
| AT5G57040 | AT5G57040.1 | TTGACTTT | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 744 Blast hits to 744 proteins in 277 species: Archae - 0; Bacteria - 578; Metazoa - 2; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
| AT5G57360 | AT5G57360.1 | AAAGTCAA | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1.  |
| AT5G57360.2 | AAAGTCAA | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1.  |
| AT5G57535 | AT5G57535.1 | AAAGTCAA | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
| AT5G57900 | AT5G57900.1 | AAAGTCAA | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner  |
| AT5G57940 | AT5G57940.1 | TTGACTTT | member of Cyclic nucleotide gated channel family  |
| AT5G57940.2 | TTGACTTT | member of Cyclic nucleotide gated channel family  |
| AT5G57940.3 | TTGACTTT | member of Cyclic nucleotide gated channel family  |
| AT5G58330 | AT5G58330.1 | TTATTGGGCCTTAACTGGGCCTAAAAGTCAA | malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink).  |
| AT5G58330.2 | TTATTGGGCCTTAACTGGGCCTAAAAGTCAA | malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink).  |
| AT5G58330.3 | TTATTGGGCCTTAACTGGGCCTAAAAGTCAA | malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink).  |
| AT5G58340 | AT5G58340.1 | TTGACTTTTAGGCCCAGTTAAGGCCC | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: TRFL5 (TRF-LIKE 5); DNA binding / transcription factor (TAIR:AT1G15720.1); Has 281 Blast hits to 279 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 51; Fungi - 13; Plants - 202; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT5G58720 | AT5G58720.1 | AAAGTCAA | PRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT5G58720.2 | AAAGTCAA | PRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT5G58720.3 | AAAGTCAA | PRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT5G59500 | AT5G59500.1 | AAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae - 22; Bacteria - 353; Metazoa - 4; Fungi - 21; Plants - 20; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
| AT5G59730 | AT5G59730.1 | TTGACTTT | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.  |
| AT5G59730.2 | TTGACTTT | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.  |
| AT5G59790 | AT5G59790.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF966 (InterPro:IPR010369); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46110.1); Has 96 Blast hits to 95 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 90; Viruses - 3; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G59840 | AT5G59840.1 | TTGACTTT | Ras-related GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB8; GTP binding (TAIR:AT3G53610.3); Has 23810 Blast hits to 23756 proteins in 654 species: Archae - 17; Bacteria - 124; Metazoa - 13243; Fungi - 2913; Plants - 2226; Viruses - 19; Other Eukaryotes - 5268 (source: NCBI BLink).  |
| AT5G60410 | AT5G60410.1 | AAAGTCAA | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
| AT5G60410.2 | AAAGTCAA | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
| AT5G60410.3 | AAAGTCAA | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
| AT5G60410.4 | AAAGTCAA | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
| AT5G60410.5 | AAAGTCAA | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
| AT5G61440 | AT5G61440.1 | AAAGTCAA | Encodes a member of the thioredoxin family protein. Located in the chloroplast.  |
| AT5G62050 | AT5G62050.1 | AAAGTCAA | essential factor for protein sorting and assembly into membranes  |
| AT5G62060 | AT5G62060.1 | TTGACTTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G32420.1); Has 662 Blast hits to 644 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 662; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G62070 | AT5G62070.1 | AAAGTCAA | IQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 4; Plants - 406; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G62070.1 | TCAGGCCCATTGACTTTAACCG | IQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 4; Plants - 406; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT5G62270 | AT5G62270.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: mucin-related (TAIR:AT2G02880.1); Has 48 Blast hits to 48 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G62560 | AT5G62560.1 | AAAGTCAA | armadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein / U-box domain-containing protein (TAIR:AT3G47820.1); Has 2475 Blast hits to 1682 proteins in 159 species: Archae - 0; Bacteria - 12; Metazoa - 520; Fungi - 340; Plants - 1368; Viruses - 0; Other Eukaryotes - 235 (source: NCBI BLink).  |
| AT5G62920 | AT5G62920.1 | TTGACTTT | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin.  |
| AT5G63450 | AT5G63450.1 | AAAGTCAA | member of CYP94B  |
| AT5G63570 | AT5G63570.1 | TTGACTTT | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced.  |
| AT5G63595 | AT5G63595.1 | TTGACTTT | FLAVONOL SYNTHASE 4 (FLS4); FUNCTIONS IN: flavonol synthase activity, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: FLS (FLAVONOL SYNTHASE); flavonol synthase (TAIR:AT5G08640.1); Has 5083 Blast hits to 5065 proteins in 627 species: Archae - 0; Bacteria - 630; Metazoa - 62; Fungi - 314; Plants - 3036; Viruses - 0; Other Eukaryotes - 1041 (source: NCBI BLink).  |
| AT5G63670 | AT5G63670.1 | AAAGTCAA | SPT4 HOMOLOG 2 (SPT42); FUNCTIONS IN: positive transcription elongation factor activity, zinc ion binding; INVOLVED IN: positive regulation of transcription, N-terminal protein myristoylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation Spt4 (InterPro:IPR009287), Transcription initiation Spt4-like (InterPro:IPR016046); BEST Arabidopsis thaliana protein match is: positive transcription elongation factor/ zinc ion binding (TAIR:AT5G08565.1); Has 324 Blast hits to 324 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 119; Plants - 27; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
| AT5G63770 | AT5G63770.1 | TTGACTTT | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold.  |
| AT5G63840 | AT5G63840.1 | TTGACTTT | radial swelling mutant shown to be specifically impaired in cellulose production. Encodes the alpha-subunit of a glucosidase II enzyme.  |
| AT5G63860 | AT5G63860.1 | AAAGTCAA | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus.  |
| AT5G64120 | AT5G64120.1 | AAAGTCAA | encodes a cell wall bound peroxidase that is induced by hypo-osmolarity  |
| AT5G64290 | AT5G64290.1 | TTGACTTT | DICARBOXYLATE TRANSPORT 2.1 (DIT2.1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: malate transport, response to nematode; LOCATED IN: chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DiT2.2 (dicarboxylate transporter 2.2); oxoglutarate:malate antiporter (TAIR:AT5G64280.1); Has 2721 Blast hits to 2720 proteins in 602 species: Archae - 47; Bacteria - 2055; Metazoa - 43; Fungi - 9; Plants - 101; Viruses - 2; Other Eukaryotes - 464 (source: NCBI BLink).  |
| AT5G65210 | AT5G65210.6 | TTGACTTT | TGA1; FUNCTIONS IN: transcription factor activity, calmodulin binding, DNA binding; INVOLVED IN: defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: TGA4 (TGACG MOTIF-BINDING FACTOR 4); DNA binding / calmodulin binding / transcription factor (TAIR:AT5G10030.1); Has 474 Blast hits to 473 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 439; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
| AT5G65490 | AT5G65490.1 | AAAGTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SGT1 (InterPro:IPR010770); Has 4480 Blast hits to 3390 proteins in 346 species: Archae - 8; Bacteria - 210; Metazoa - 1070; Fungi - 582; Plants - 124; Viruses - 61; Other Eukaryotes - 2425 (source: NCBI BLink).  |
| AT5G65495 | AT5G65495.1 | TTGACTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G65660 | AT5G65660.1 | AAAGTCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT5G66240 | AT5G66240.1 | AAAGTCAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink).  |
| AT5G66240.2 | AAAGTCAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink).  |
| AT5G67400 | AT5G67400.1 | AAAGTCAA | peroxidase 73 (PER73) (P73) (PRXR11); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G49960.1); Has 2886 Blast hits to 2873 proteins in 211 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 2764; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT5G67400.1 | GGGCCTGAAAGCCCATAAAAGTCAA | peroxidase 73 (PER73) (P73) (PRXR11); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G49960.1); Has 2886 Blast hits to 2873 proteins in 211 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 2764; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| ATCG00490 | ATCG00490.1 | AAAGTCAA | large subunit of RUBISCO. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.  |
| ATCG00720 | ATCG00720.1 | AAAGTCAA | Encodes the cytochrome b(6) subunit of the cytochrome b6f complex.  |
| ATMG01370 | ATMG01370.1 | AAAGTCAA | hypothetical protein  |