version

Summary of AtREG634 (All List)

OrganismArabidopsis thaliana  
IDAtREG634  
SequenceCTAAGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count119  

Entry Sequences (119 entries)

LocusGene modelSequenceDescription
AT1G02690AT1G02690.1CTAAGCCCAATATPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G02690.2CTAAGCCCAATATPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G03430AT1G03430.1GGGCCTAAGCCCAATTGGGEncodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). 
AT1G03860AT1G03860.1ATAATGGGCTTAGprohibitin 2 
AT1G03860.2ATAATGGGCTTAGprohibitin 2 
AT1G03860.3ATAATGGGCTTAGprohibitin 2 
AT1G04250AT1G04250.1GGGCTTAGTranscription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. 
AT1G04630AT1G04630.1AAATGGGCTTAGmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G04630.1CTAATGGGCTTAGmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G04635AT1G04635.1CTAAGCCCATTAGEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G04635.1CTAAGCCCATTTEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G12730AT1G12730.1GGGCCCTAAGCCCcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT1G12730.2GGGCCCTAAGCCCcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT1G13900AT1G13900.1GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G13910AT1G13910.1TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTACleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink). 
AT1G20960AT1G20960.1GTTGGGCTTAGembryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink). 
AT1G25230AT1G25230.1CTAAGCCCpurple acid phosphatase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 873 Blast hits to 869 proteins in 210 species: Archae - 0; Bacteria - 175; Metazoa - 324; Fungi - 6; Plants - 91; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink). 
AT1G33250AT1G33250.1CTAAGCCCATTCfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G33780AT1G33780.1TTATGGGCTTAGCCCACTAunknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink). 
AT1G51150AT1G51150.1TAATTGGGCCTAAGCCCATTGEncodes a putative DegP protease. 
AT1G62690AT1G62690.1CAATTGGGCTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G62820AT1G62820.1ATGGGCTTAGGAAGCCCATATAcalmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G12310.1); Has 12799 Blast hits to 10828 proteins in 1248 species: Archae - 0; Bacteria - 22; Metazoa - 5376; Fungi - 3677; Plants - 2002; Viruses - 0; Other Eukaryotes - 1722 (source: NCBI BLink). 
AT1G70900AT1G70900.1CTAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23110.3); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G74530AT1G74530.1CTAAGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G74530.2CTAAGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G74530.3CTAAGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G75630AT1G75630.1CTAAGCCCAATAAvacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, 
AT2G03270AT2G03270.1CTAAGCCCATTATDNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink). 
AT2G15090AT2G15090.1CTAAGCCCACEncodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). 
AT2G16750AT2G16750.1CTAAGCCCprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G35030.2); Has 78634 Blast hits to 77772 proteins in 2243 species: Archae - 39; Bacteria - 7066; Metazoa - 34040; Fungi - 5682; Plants - 18147; Viruses - 374; Other Eukaryotes - 13286 (source: NCBI BLink). 
AT2G21490AT2G21490.1CTAAGCCCDEHYDRIN LEA (LEA); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water, response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); BEST Arabidopsis thaliana protein match is: dehydrin family protein (TAIR:AT4G39130.1); Has 1199 Blast hits to 1011 proteins in 136 species: Archae - 0; Bacteria - 3; Metazoa - 16; Fungi - 16; Plants - 1152; Viruses - 2; Other Eukaryotes - 10 (source: NCBI BLink). 
AT2G24290AT2G24290.1CTAAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30996.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G26430AT2G26430.1CTAAGCCCAATAAGGGCCTAGEncodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. 
AT2G26430.2CTAAGCCCAATAAGGGCCTAGEncodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. 
AT2G26430.3CTAAGCCCAATAAGGGCCTAGEncodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. 
AT2G26660AT2G26660.1CTAAGCCCAACTSPX DOMAIN GENE 2 (SPX2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cellular response to phosphate starvation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331); BEST Arabidopsis thaliana protein match is: SPX1 (SPX DOMAIN GENE 1) (TAIR:AT5G20150.1); Has 816 Blast hits to 812 proteins in 153 species: Archae - 0; Bacteria - 2; Metazoa - 225; Fungi - 334; Plants - 177; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT2G30120AT2G30120.1ATTTGGGCTTAGunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1). 
AT2G30120.2ATTTGGGCTTAGunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1). 
AT2G32980AT2G32980.1TGGGCTAAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 31; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G40590AT2G40590.1ATAAAGCCTAAGCCCACTA40S ribosomal protein S26 (RPS26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT2G42560AT2G42560.1TAAATGGGGGCTTAGlate embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: ATECP63 (EMBRYONIC CELL PROTEIN 63) (TAIR:AT2G36640.1); Has 12374 Blast hits to 7501 proteins in 1066 species: Archae - 63; Bacteria - 4676; Metazoa - 2087; Fungi - 744; Plants - 1442; Viruses - 129; Other Eukaryotes - 3233 (source: NCBI BLink). 
AT2G46870AT2G46870.1CTAAGCCCACNGATHA1 (NGA1); FUNCTIONS IN: transcription factor activity; INVOLVED IN: flower development, leaf development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: NGA2 (NGATHA2); transcription factor (TAIR:AT3G61970.1); Has 734 Blast hits to 729 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 734; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G05590AT3G05590.1CTAAGCCCATTTEncodes cytoplasmic ribosomal protein L18. 
AT3G06790AT3G06790.1CAAAGGCCCACTAAGCCCATATAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06790.2CAAAGGCCCACTAAGCCCATATAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G10160AT3G10160.1TGTTGGGCTTAGGCCCAAGEncodes a protein with tetrahydrofolylpolyglutamate synthase activity that is located in the mitochondrial matrix. 
AT3G10572AT3G10572.1TTTTGGGCTTAG3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G12100AT3G12100.1TATATGGGCTTAGcation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). 
AT3G12100.2TATATGGGCTTAGcation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). 
AT3G13120AT3G13120.1TTAATGGGCTTAG30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink). 
AT3G15120AT3G15120.1CTAAGCCCAATTAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: cell division cycle protein 48-related / CDC48-related (TAIR:AT1G05910.1); Has 65380 Blast hits to 45049 proteins in 2200 species: Archae - 999; Bacteria - 13338; Metazoa - 21190; Fungi - 6719; Plants - 3370; Viruses - 463; Other Eukaryotes - 19301 (source: NCBI BLink). 
AT3G15356AT3G15356.1CTAAGCCClegume lectin family protein; FUNCTIONS IN: carbohydrate binding, sugar binding; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), L-type lectin, plant (InterPro:IPR016363); BEST Arabidopsis thaliana protein match is: legume lectin family protein (TAIR:AT3G16530.1); Has 1383 Blast hits to 1370 proteins in 111 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 1349; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT3G27230AT3G27230.1CTAAGCCCAATTALOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G40830.2); Has 184 Blast hits to 183 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 182; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G46040AT3G46040.1ATAATGGGCTTAGRegulated by TCP20. 
AT3G46310AT3G46310.1TAAATGGGCCTAAGCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G49400AT3G49400.1ATTTGGGCTTAGCCCATCAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT3G49601AT3G49601.1ATATTGGGCCTAAGCCCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf21 (InterPro:IPR013170); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37820.1); Has 58354 Blast hits to 32469 proteins in 1203 species: Archae - 56; Bacteria - 5471; Metazoa - 26539; Fungi - 6511; Plants - 2874; Viruses - 282; Other Eukaryotes - 16621 (source: NCBI BLink). 
AT3G49800AT3G49800.1CTAAGCCCATTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G50920AT3G50920.1CTAAGCCCATAphosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT3G50920.2CTAAGCCCATAphosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT3G51500AT3G51500.1CTAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51510AT3G51510.1CTAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G52750AT3G52750.1CTAAGCCCANuclear gene that encodes a plastidial division protein (FtsZ2-2). 
AT3G53430AT3G53430.1CTAAGCCCATATAATATTGGGTTGGGCCGTT60S ribosomal protein L12 (RPL12B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12A) (TAIR:AT2G37190.1); Has 1163 Blast hits to 1163 proteins in 435 species: Archae - 208; Bacteria - 279; Metazoa - 292; Fungi - 110; Plants - 81; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). 
AT3G54860AT3G54860.1TGAGGCCCATTTCTAAGCCCATTTAHomologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. 
AT3G54860.2TGAGGCCCATTTCTAAGCCCATTTAHomologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. 
AT3G55200AT3G55200.1TATATGGGCTTAGsplicing factor, putative; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage and polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: splicing factor, putative (TAIR:AT3G55220.1); Has 768 Blast hits to 695 proteins in 165 species: Archae - 0; Bacteria - 2; Metazoa - 341; Fungi - 160; Plants - 119; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
AT3G62240AT3G62240.1ATTTGGGCTTAGTTTTGGGCTTTzinc finger (C2H2 type) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: nucleic acid binding / protein binding / zinc ion binding (TAIR:AT2G47090.1); Has 3224 Blast hits to 1336 proteins in 208 species: Archae - 0; Bacteria - 156; Metazoa - 809; Fungi - 335; Plants - 89; Viruses - 4; Other Eukaryotes - 1831 (source: NCBI BLink). 
AT3G62250AT3G62250.1AAAGCCCAAAACTAAGCCCAAATubiquitin 5 (UBQ5); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein ubiquitination during ubiquitin-dependent protein catabolic process, protein modification process, translation; LOCATED IN: cytosolic small ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein S27a (InterPro:IPR002906), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ6; protein binding (TAIR:AT2G47110.1); Has 9355 Blast hits to 5604 proteins in 655 species: Archae - 78; Bacteria - 7; Metazoa - 4233; Fungi - 952; Plants - 1981; Viruses - 176; Other Eukaryotes - 1928 (source: NCBI BLink). 
AT3G62260AT3G62260.1TAGGGCTTAGprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). 
AT3G62260.2TAGGGCTTAGprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). 
AT3G63070AT3G63070.1GAATGGGCTTAGPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). 
AT4G00026AT4G00026.1CTAAGCCCAAGCCCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); Has 168 Blast hits to 168 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 52; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G00030AT4G00030.1TTGGGCTTGGGCTTAGplastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 126 Blast hits to 126 proteins in 26 species: Archae - 0; Bacteria - 11; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G00720AT4G00720.1GTGGGCTTAGSHAGGY-LIKE PROTEIN KINASE 32 (ATSK32); FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: SK13 (SHAGGY-LIKE KINASE 13); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT5G14640.1); Has 74054 Blast hits to 73135 proteins in 2264 species: Archae - 36; Bacteria - 5684; Metazoa - 31554; Fungi - 7580; Plants - 14010; Viruses - 325; Other Eukaryotes - 14865 (source: NCBI BLink). 
AT4G02210AT4G02210.1CTAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02220AT4G02220.1TTATTGGGCTTAGzinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). 
AT4G02230AT4G02230.1AGGCCTATAATGGGCTTAG60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). 
AT4G02460AT4G02460.1CTAAGCCCAATGEncodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. 
AT4G11010AT4G11010.1CTAAGCCCACnucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria 
AT4G12340AT4G12340.1CTAAGCCCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); Has 33 Blast hits to 31 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18140AT4G18140.1ATATGGGCCTAAGCCCATTATphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18140.2ATATGGGCCTAAGCCCATTATphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G19150AT4G19150.1ATTTGGGCTTAGTTTGGGCTTAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G09890.1); Has 67868 Blast hits to 22594 proteins in 807 species: Archae - 53; Bacteria - 4070; Metazoa - 36594; Fungi - 4728; Plants - 2294; Viruses - 864; Other Eukaryotes - 19265 (source: NCBI BLink). 
AT4G19150.2ATTTGGGCTTAGTTTGGGCTTAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G09890.1); Has 67868 Blast hits to 22594 proteins in 807 species: Archae - 53; Bacteria - 4070; Metazoa - 36594; Fungi - 4728; Plants - 2294; Viruses - 864; Other Eukaryotes - 19265 (source: NCBI BLink). 
AT4G22260AT4G22260.1CTAAGCCCAATAAGSimilar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. 
AT4G27800AT4G27800.1ATTTGGGCCTAAGCCCAAAAprotein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink). 
AT4G27800.2ATTTGGGCCTAAGCCCAAAAprotein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink). 
AT4G27800.3ATTTGGGCCTAAGCCCAAAAprotein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink). 
AT4G28510AT4G28510.1CTAAGCCCAATAAprohibitin 1 (Atphb1) 
AT4G28770AT4G28770.1CTAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20230.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G30820AT4G30820.1CTAAGCCCATATcyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G30820.2CTAAGCCCATATcyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G30820.3CTAAGCCCATATcyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G33060AT4G33060.1TTAATGGGCTGGGCTTAGpeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 18511 Blast hits to 16644 proteins in 1616 species: Archae - 90; Bacteria - 4190; Metazoa - 5100; Fungi - 1622; Plants - 926; Viruses - 34; Other Eukaryotes - 6549 (source: NCBI BLink). 
AT4G34090AT4G34090.1CTAAGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G34090.2CTAAGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G34100AT4G34100.1AGATGGGCTTAGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). 
AT4G34100.2AGATGGGCTTAGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). 
AT4G35730AT4G35730.1CAAAGCCCATCTAAGCCCATTATunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT4G39240AT4G39240.1ATATGGGCCTAAGCCCATCAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink). 
AT4G39240.1ATATGGGCCTAAGCCCATTTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink). 
AT5G01990AT5G01990.1GGGCTTTTGGGCTTAGauxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT1G71090.1); Has 303 Blast hits to 283 proteins in 69 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 152; Plants - 93; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT5G08280AT5G08280.1GTTTGGGCTAAGCCCEncodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. 
AT5G08290AT5G08290.1GGGCTTAGCCCAAACEncodes Dim1 homolog. 
AT5G08670AT5G08670.1ATAGGCCCAACTAAGCCCATTAACTAAGCCCACEncodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. 
AT5G10160AT5G10160.1CTAATGGGCTTAGbeta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). 
AT5G18400AT5G18400.1CTAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.2CTAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.3CTAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G24830AT5G24830.1CTAAGCCCpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae - 6; Bacteria - 14; Metazoa - 418; Fungi - 405; Plants - 20611; Viruses - 0; Other Eukaryotes - 881 (source: NCBI BLink). 
AT5G47880AT5G47880.1TACTGGGCTTAGGCCCATTAAEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. 
AT5G47880.2TACTGGGCTTAGGCCCATTAAEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. 
AT5G51100AT5G51100.1GGGCTTAGFe superoxide dismutase whose mRNA levels are increased in response to exposure to UV-B. 
AT5G63190AT5G63190.1CTAAGCCCMA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). 
AT5G63190.2CTAAGCCCMA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). 
AT5G66410AT5G66410.1CTAAGCCCTAEncodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. 
AT5G67270AT5G67270.1TTTTGGGCTTAGencodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. 
ATMG00160ATMG00160.1CTAAGCCCcytochrome c oxidase subunit 2 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.