| Locus | Gene model | Sequence | Description |
| AT1G01100 | AT1G01100.1 | CGGCCCATCA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.2 | CGGCCCATCA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.3 | CGGCCCATCA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.4 | CGGCCCATCA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G03780 | AT1G03780.1 | GCCCATCA | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G03780.2 | GCCCATCA | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G04810 | AT1G04810.1 | TGGCCCATCA | 26S proteasome regulatory subunit, putative; FUNCTIONS IN: enzyme regulator activity, binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Proteasome/cyclosome, regulatory subunit (InterPro:IPR002015), Armadillo-type fold (InterPro:IPR016024), 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit (InterPro:IPR016642); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (TAIR:AT2G32730.1); Has 813 Blast hits to 749 proteins in 190 species: Archae - 12; Bacteria - 25; Metazoa - 307; Fungi - 211; Plants - 86; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink). |
| AT1G07170 | AT1G07170.1 | AAAAAGCCCATCA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT1G07170.2 | AAAAAGCCCATCA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT1G07440 | AT1G07440.1 | CCCGGCCCATCA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G29340.2); Has 82964 Blast hits to 82757 proteins in 2203 species: Archae - 469; Bacteria - 45784; Metazoa - 4525; Fungi - 4011; Plants - 1547; Viruses - 5; Other Eukaryotes - 26623 (source: NCBI BLink). |
| AT1G07440.2 | CCCGGCCCATCA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G29340.2); Has 82964 Blast hits to 82757 proteins in 2203 species: Archae - 469; Bacteria - 45784; Metazoa - 4525; Fungi - 4011; Plants - 1547; Viruses - 5; Other Eukaryotes - 26623 (source: NCBI BLink). |
| AT1G07590 | AT1G07590.1 | TGATGGGC | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 6623 Blast hits to 3122 proteins in 84 species: Archae - 0; Bacteria - 4; Metazoa - 30; Fungi - 22; Plants - 6377; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT1G07600 | AT1G07600.1 | TGATGGGC | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
| AT1G10030 | AT1G10030.1 | TCGGCCCATCA | Arabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G10910 | AT1G10910.1 | AAAAGCCCATCA | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink). |
| AT1G13380 | AT1G13380.1 | TTAGCCCATCAAGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27435.1); Has 150 Blast hits to 150 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G16000 | AT1G16000.1 | TGATGGGCCATAATAAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80890.1); Has 24 Blast hits to 23 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G19920 | AT1G19920.1 | TGATGGGCCGAA | encodes a chloroplast form of ATP sulfurylase |
| AT1G21350 | AT1G21350.1 | TTCGGCCCATCA | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT1G21350.2 | TTCGGCCCATCA | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT1G21350.3 | TTCGGCCCATCA | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT1G23710 | AT1G23710.1 | TCAGCCCATCACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G27070 | AT1G27070.1 | AGGGCCCATCA | 5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT1G44575 | AT1G44575.1 | TAAGCCCATCA | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT1G44575.2 | TAAGCCCATCA | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT1G44750 | AT1G44750.2 | TGATGGGCTAA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G44750.3 | TGATGGGCTAA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G56110 | AT1G56110.1 | TGATGGGCCGGG | NOP56-like protein |
| AT1G59740 | AT1G59740.1 | GCCCATCA | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G33440.1); Has 3939 Blast hits to 3857 proteins in 732 species: Archae - 0; Bacteria - 1785; Metazoa - 425; Fungi - 235; Plants - 1136; Viruses - 0; Other Eukaryotes - 358 (source: NCBI BLink). |
| AT1G62690 | AT1G62690.1 | TGATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G67430 | AT1G67430.1 | TGATGGGC | 60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink). |
| AT1G67910 | AT1G67910.1 | TGATGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24577.1); Has 90 Blast hits to 90 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G68590 | AT1G68590.1 | TGATGGGCCAA | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |
| AT1G68590.2 | TGATGGGCCAA | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |
| AT1G71780 | AT1G71780.1 | ATACCCTTTAGGCCCATCATAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72170 | AT1G72170.1 | TACGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22520.2); Has 60 Blast hits to 60 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G73930 | AT1G73930.1 | TGATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G73930.2 | TGATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G77420 | AT1G77420.1 | TGAGGCCCATCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT1G77440 | AT1G77440.1 | GAGGCCCATCA | Encodes beta subunit of 20s proteosome complex which is involved in protein degradation. |
| AT1G80550 | AT1G80550.1 | TGATGGGCCTAAG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink). |
| AT2G01470 | AT2G01470.1 | TGATGGGCCTATA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G02500 | AT2G02500.1 | TTAATGGGCCTGATGGGCTTAT | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity). |
| AT2G02510 | AT2G02510.1 | ATAAGCCCATCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G03690 | AT2G03690.1 | TGATGGGCCAC | Ubiquinone biosynthesis protein COQ4 homolog. |
| AT2G14282 | AT2G14282.1 | GTGGCCCATCA | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G19740 | AT2G19740.1 | AAAAGCCCATCAGGCCCATA | 60S ribosomal protein L31 (RPL31A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, chloroplast, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31C) (TAIR:AT5G56710.1); Has 851 Blast hits to 851 proteins in 263 species: Archae - 99; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). |
| AT2G20060 | AT2G20060.1 | TGATGGGCTTAT | ribosomal protein L4 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4 (InterPro:IPR015498), Ribosomal protein L4/L1e, bacterial-type (InterPro:IPR013005), Ribosomal protein L4/L1e (InterPro:IPR002136); BEST Arabidopsis thaliana protein match is: RPL4; poly(U) binding / structural constituent of ribosome (TAIR:AT1G07320.4); Has 5451 Blast hits to 5451 proteins in 1497 species: Archae - 63; Bacteria - 2944; Metazoa - 100; Fungi - 82; Plants - 60; Viruses - 0; Other Eukaryotes - 2202 (source: NCBI BLink). |
| AT2G22990 | AT2G22990.1 | GCCCATCA | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G22990.2 | GCCCATCA | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G22990.3 | GCCCATCA | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G22990.4 | GCCCATCA | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G22990.5 | GCCCATCA | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G22990.6 | GCCCATCA | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G27285 | AT2G27285.1 | TCGGCCCATCA | unknown protein; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2040, coiled-coil (InterPro:IPR018612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27280.1); Has 35706 Blast hits to 21282 proteins in 1150 species: Archae - 208; Bacteria - 3585; Metazoa - 16311; Fungi - 2551; Plants - 911; Viruses - 174; Other Eukaryotes - 11966 (source: NCBI BLink). |
| AT2G29180 | AT2G29180.1 | TTGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 21 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G32600 | AT2G32600.1 | TGATGGGCTGATATTGGGCCTTAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, intracellular, spliceosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 17385 Blast hits to 7765 proteins in 482 species: Archae - 26; Bacteria - 1475; Metazoa - 7274; Fungi - 1847; Plants - 3510; Viruses - 897; Other Eukaryotes - 2356 (source: NCBI BLink). |
| AT2G36060 | AT2G36060.1 | TTGGCCCATCA | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. |
| AT2G36060.2 | TTGGCCCATCA | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. |
| AT2G36060.3 | TTGGCCCATCA | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. |
| AT2G36485 | AT2G36485.1 | TGATGGGCCTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: PCFS4 (PCF11P-SIMILAR PROTEIN 4); zinc ion binding (TAIR:AT4G04885.1); Has 87 Blast hits to 87 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 33; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G38560 | AT2G38560.1 | AAAAGCCCATCA | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
| AT2G40830 | AT2G40830.1 | ACAGGCCCATCA | Encodes a putative RING-H2 finger protein RHC1a. |
| AT2G40830.2 | ACAGGCCCATCA | Encodes a putative RING-H2 finger protein RHC1a. |
| AT2G40830.3 | ACAGGCCCATCA | Encodes a putative RING-H2 finger protein RHC1a. |
| AT2G42700 | AT2G42700.1 | TGATGGGCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport, vesicle docking during exocytosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sec1-like protein (InterPro:IPR001619); Has 95 Blast hits to 92 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT2G43120 | AT2G43120.1 | GAAGCCCATCATGGCCCACA | pirin, putative; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: stem, flower; CONTAINS InterPro DOMAIN/s: Pirin, C-terminal (InterPro:IPR008778), Pirin (InterPro:IPR012093), Cupin, RmlC-type (InterPro:IPR011051), Pirin, N-terminal (InterPro:IPR003829); BEST Arabidopsis thaliana protein match is: PRN (PIRIN); calmodulin binding (TAIR:AT3G59220.1); Has 5405 Blast hits to 5403 proteins in 856 species: Archae - 43; Bacteria - 2852; Metazoa - 62; Fungi - 147; Plants - 68; Viruses - 0; Other Eukaryotes - 2233 (source: NCBI BLink). |
| AT2G47580 | AT2G47580.1 | TGATGGGCTAA | encodes spliceosomal protein U1A |
| AT2G47580.1 | TGATGGGCTTATTAGGGCTTTA | encodes spliceosomal protein U1A |
| AT3G01480 | AT3G01480.1 | AAAGCCCAACTAACGGCCCATCA | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. |
| AT3G01480.2 | AAAGCCCAACTAACGGCCCATCA | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. |
| AT3G02050 | AT3G02050.1 | TGATGGGCTTTTA | potassium transporter KUP3p (KUP3) |
| AT3G02160 | AT3G02160.1 | AAAGCCCATCA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15570.1); Has 126 Blast hits to 126 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G03320 | AT3G03320.1 | GCCCATCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ProFAR isomerase-like (InterPro:IPR010759), ASCH domain (InterPro:IPR007374); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G43465.1); Has 65 Blast hits to 65 proteins in 18 species: Archae - 31; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G03970 | AT3G03970.1 | GCCCATCA | binding; FUNCTIONS IN: binding; INVOLVED IN: spliceosome assembly, nuclear mRNA splicing, via spliceosome; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Survival motor neuron interacting protein 1 (InterPro:IPR007022); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G54385.2); Has 49 Blast hits to 49 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03970.2 | GCCCATCA | binding; FUNCTIONS IN: binding; INVOLVED IN: spliceosome assembly, nuclear mRNA splicing, via spliceosome; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Survival motor neuron interacting protein 1 (InterPro:IPR007022); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G54385.2); Has 49 Blast hits to 49 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03970.3 | GCCCATCA | binding; FUNCTIONS IN: binding; INVOLVED IN: spliceosome assembly, nuclear mRNA splicing, via spliceosome; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Survival motor neuron interacting protein 1 (InterPro:IPR007022); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G54385.2); Has 49 Blast hits to 49 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06420 | AT3G06420.1 | TGATGGGCCCAAAA | autophagy 8h (ATG8H); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase/ microtubule binding (TAIR:AT3G15580.1); Has 1119 Blast hits to 1117 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 577; Fungi - 124; Plants - 171; Viruses - 3; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G07630 | AT3G07630.1 | GTGGCCCATCA | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G07630.2 | GTGGCCCATCA | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G07990 | AT3G07990.1 | GCCCAATTGCCCATCA | serine carboxypeptidase-like 27 (SCPL27); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl26 (serine carboxypeptidase-like 26); serine-type carboxypeptidase (TAIR:AT2G35780.1); Has 2491 Blast hits to 2440 proteins in 260 species: Archae - 0; Bacteria - 86; Metazoa - 579; Fungi - 564; Plants - 959; Viruses - 0; Other Eukaryotes - 303 (source: NCBI BLink). |
| AT3G10730 | AT3G10730.1 | TTATTGGGCTTTTAAAAGCCCATCA | sad1/unc-84-like 2 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, endoplasmic reticulum, spindle, phragmoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919); BEST Arabidopsis thaliana protein match is: sad1/unc-84 protein-related (TAIR:AT5G04990.1); Has 419 Blast hits to 416 proteins in 105 species: Archae - 4; Bacteria - 31; Metazoa - 294; Fungi - 27; Plants - 31; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G14190 | AT3G14190.1 | TGATGGGCCTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12360.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G16260 | AT3G16260.1 | TGATGGGCCGG | Encodes a tRNase Z. |
| AT3G17780 | AT3G17780.1 | CAATTGGGCCGTAAAAAGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48440.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G17880 | AT3G17880.1 | TAGCCCATCAAGGCCCAATG | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT3G17880.2 | TAGCCCATCAAGGCCCAATG | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT3G18880 | AT3G18880.1 | CAAAGCCCATCA | ribosomal protein S17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: emb1129 (embryo defective 1129); structural constituent of ribosome (TAIR:AT1G49400.1); Has 4907 Blast hits to 4907 proteins in 1461 species: Archae - 81; Bacteria - 2923; Metazoa - 31; Fungi - 32; Plants - 65; Viruses - 0; Other Eukaryotes - 1775 (source: NCBI BLink). |
| AT3G23470 | AT3G23470.1 | GCCCATCATAAGCCCAT | cyclopropane-fatty-acyl-phospholipid synthase; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: cyclopropane fatty acid synthase-related (TAIR:AT3G23480.1); Has 6742 Blast hits to 6734 proteins in 950 species: Archae - 28; Bacteria - 2782; Metazoa - 17; Fungi - 240; Plants - 103; Viruses - 0; Other Eukaryotes - 3572 (source: NCBI BLink). |
| AT3G27820 | AT3G27820.1 | TGATGGGCCAA | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G49400 | AT3G49400.1 | ATTTGGGCTTAGCCCATCA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT3G51890 | AT3G51890.1 | TAAAAGCCCATCA | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G40060.1); Has 258 Blast hits to 256 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 126; Fungi - 42; Plants - 56; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G53020 | AT3G53020.1 | TGATGGGCCTATTTAGTGGGCTTA | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20. |
| AT3G53030 | AT3G53030.1 | TAAGCCCACTAAATAGGCCCATCA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
| AT3G54210 | AT3G54210.1 | TATAGGCCCATTAAGGCCCATCA | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae - 0; Bacteria - 3017; Metazoa - 102; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2110 (source: NCBI BLink). |
| AT3G55480 | AT3G55480.1 | TGATGGGCTTTAT | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). |
| AT3G55480.2 | TGATGGGCTTTAT | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). |
| AT3G55800 | AT3G55800.1 | GCCCAATTGCCCATCA | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. |
| AT3G63500 | AT3G63500.2 | TGATGGGCCTTAC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1423, plant (InterPro:IPR004082); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14740.1); Has 2817 Blast hits to 2297 proteins in 310 species: Archae - 8; Bacteria - 278; Metazoa - 1232; Fungi - 288; Plants - 201; Viruses - 10; Other Eukaryotes - 800 (source: NCBI BLink). |
| AT4G01010 | AT4G01010.1 | GTTAGGCCCATCA | member of Cyclic nucleotide gated channel family |
| AT4G02250 | AT4G02250.1 | GTAGGCCCATCA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G55770.1); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G05190 | AT4G05190.1 | TGATGGGCCTGA | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. |
| AT4G05190.1 | TGATGGGCCTGA | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. |
| AT4G14840 | AT4G14840.1 | GCCCATCA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 1350 Blast hits to 1200 proteins in 204 species: Archae - 9; Bacteria - 99; Metazoa - 566; Fungi - 111; Plants - 49; Viruses - 5; Other Eukaryotes - 511 (source: NCBI BLink). |
| AT4G17300 | AT4G17300.1 | TGATGGGCCTCT | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT4G19120 | AT4G19120.1 | TTGGCCCATCA | early-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT4G19120.2 | TTGGCCCATCA | early-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT4G20330 | AT4G20330.1 | TGATGGGCCTAAC | transcription initiation factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIIE, beta subunit (InterPro:IPR016656), Transcription factor TFIIE beta subunit-like, DNA-binding (InterPro:IPR017935); BEST Arabidopsis thaliana protein match is: transcription initiation factor-related (TAIR:AT4G21010.1); Has 212 Blast hits to 212 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 68; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G24730 | AT4G24730.1 | TGAGCCCATCA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter (TAIR:AT5G50200.3); Has 243 Blast hits to 242 proteins in 66 species: Archae - 0; Bacteria - 73; Metazoa - 54; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G24730.2 | TGAGCCCATCA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter (TAIR:AT5G50200.3); Has 243 Blast hits to 242 proteins in 66 species: Archae - 0; Bacteria - 73; Metazoa - 54; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G24730.3 | TGAGCCCATCA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter (TAIR:AT5G50200.3); Has 243 Blast hits to 242 proteins in 66 species: Archae - 0; Bacteria - 73; Metazoa - 54; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G25730 | AT4G25730.1 | GAAGCCCATCA | FtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing, rRNA methylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spb1, C-terminal (InterPro:IPR012920), Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT5G01230.1); Has 26567 Blast hits to 17790 proteins in 1345 species: Archae - 124; Bacteria - 5586; Metazoa - 8358; Fungi - 2488; Plants - 691; Viruses - 228; Other Eukaryotes - 9092 (source: NCBI BLink). |
| AT4G27740 | AT4G27740.1 | GATGGGCCCATCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT4G28510 | AT4G28510.1 | AAAGCCCATCA | prohibitin 1 (Atphb1) |
| AT4G29060 | AT4G29060.1 | TGATGGGCCTTAG | embryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink). |
| AT4G29060.2 | TGATGGGCCTTAG | embryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink). |
| AT4G34140 | AT4G34140.1 | TGATGGGCCTAAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT3G54230.1); Has 432 Blast hits to 428 proteins in 79 species: Archae - 0; Bacteria - 2; Metazoa - 338; Fungi - 40; Plants - 36; Viruses - 3; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT4G36515 | AT4G36515.1 | TGATGGGCCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G37090 | AT4G37090.1 | GCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37090.2 | GCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37830 | AT4G37830.1 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G37830.2 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G38225 | AT4G38225.1 | TCGTCGTTGATGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.2 | TCGTCGTTGATGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.3 | TCGTCGTTGATGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38230 | AT4G38230.1 | TGATGGGC | member of Calcium Dependent Protein Kinase |
| AT4G38280 | AT4G38280.1 | TGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45250.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38920 | AT4G38920.1 | TAGTGGGCCGTATGATGGGCCTAAG | VACUOLAR-TYPE H(+)-ATPASE C3 (ATVHA-C3); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: AVA-P1; ATPase/ proton-transporting ATPase, rotational mechanism (TAIR:AT4G34720.1); Has 1818 Blast hits to 1637 proteins in 400 species: Archae - 127; Bacteria - 312; Metazoa - 519; Fungi - 315; Plants - 225; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). |
| AT4G39240 | AT4G39240.1 | ATATGGGCCTAAGCCCATCA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G02470 | AT5G02470.1 | TGATGGGCTA | core cell cycle genes |
| AT5G02470.2 | TGATGGGCTA | core cell cycle genes |
| AT5G02470.3 | TGATGGGCTA | core cell cycle genes |
| AT5G02960 | AT5G02960.1 | TGATGGGCCAA | 40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink). |
| AT5G03160 | AT5G03160.1 | TTTTGGGCCCATCA | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT5G05780 | AT5G05780.1 | TCAGGCCCATCATATTGGGCTTA | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. |
| AT5G06060 | AT5G06060.1 | TGATGGGCTTTG | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29290.2); Has 88350 Blast hits to 88156 proteins in 2259 species: Archae - 471; Bacteria - 47428; Metazoa - 5087; Fungi - 4564; Plants - 1650; Viruses - 7; Other Eukaryotes - 29143 (source: NCBI BLink). |
| AT5G06360 | AT5G06360.1 | TGATGGGCTTTTA | ribosomal protein S8e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047); Has 361 Blast hits to 360 proteins in 172 species: Archae - 6; Bacteria - 2; Metazoa - 152; Fungi - 111; Plants - 23; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G09880 | AT5G09880.1 | CTATTGGGCCCATCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink). |
| AT5G10350 | AT5G10350.1 | GGGCCTATGATGGGCCGAA | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10350.2 | GGGCCTATGATGGGCCGAA | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G11150 | AT5G11150.1 | TGATGGGC | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT5G14030 | AT5G14030.1 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.2 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.3 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.4 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14200 | AT5G14200.1 | TGATGGGCTA | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14200.2 | TGATGGGCTA | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14200.3 | TGATGGGCTA | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G17840 | AT5G17840.1 | TGATGGGC | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G20480 | AT5G20480.1 | AAAGGCCCATCA | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu. |
| AT5G22300 | AT5G22300.1 | CAAGCCCATCA | encodes a nitrilase isomer. The purified enzyme shows a strong substrate specificity for beta-cyano-L-alanine, a intermediate product of the cyanide detoxification pathway. |
| AT5G22500 | AT5G22500.1 | TGATGGGCCGA | FATTY ACID REDUCTASE 1 (FAR1); FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, fatty acyl-CoA reductase (alcohol-forming) activity; INVOLVED IN: microsporogenesis, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Male sterility (InterPro:IPR004262), NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: FAR4 (FATTY ACID REDUCTASE 4); binding / catalytic/ oxidoreductase, acting on the CH-CH group of donors (TAIR:AT3G44540.1); Has 1821 Blast hits to 1792 proteins in 332 species: Archae - 0; Bacteria - 455; Metazoa - 873; Fungi - 189; Plants - 136; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT5G24310 | AT5G24310.1 | TGATGGGC | ABL INTERACTOR-LIKE PROTEIN 3 (ABIL3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ABIL2 (ABL INTERACTOR-LIKE PROTEIN 2) (TAIR:AT3G49290.2); Has 228 Blast hits to 205 proteins in 36 species: Archae - 0; Bacteria - 2; Metazoa - 102; Fungi - 8; Plants - 105; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT5G24310.2 | TGATGGGC | ABL INTERACTOR-LIKE PROTEIN 3 (ABIL3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ABIL2 (ABL INTERACTOR-LIKE PROTEIN 2) (TAIR:AT3G49290.2); Has 228 Blast hits to 205 proteins in 36 species: Archae - 0; Bacteria - 2; Metazoa - 102; Fungi - 8; Plants - 105; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT5G26340 | AT5G26340.1 | TGATGGGC | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
| AT5G26680 | AT5G26680.1 | TGATGGGCCTTAA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G26680.1 | TGATGGGCTCA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G26680.2 | TGATGGGCCTTAA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G26680.2 | TGATGGGCTCA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G28060 | AT5G28060.1 | TTCGGCCCATCA | 40S ribosomal protein S24 (RPS24B); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24A) (TAIR:AT3G04920.1); Has 644 Blast hits to 644 proteins in 256 species: Archae - 59; Bacteria - 0; Metazoa - 306; Fungi - 104; Plants - 74; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G46250 | AT5G46250.1 | AAAAGCCCATCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46250.2 | AAAAGCCCATCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46250.3 | AAAAGCCCATCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46420 | AT5G46420.1 | GCCCATCA | 16S rRNA processing protein RimM family; FUNCTIONS IN: ribosome binding, nucleotidyltransferase activity; INVOLVED IN: metabolic process, rRNA processing, ribosome biogenesis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRC-barrel (InterPro:IPR007903), UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618), RimM protein (InterPro:IPR002676), 16S rRNA processing protein RimM (InterPro:IPR011961); BEST Arabidopsis thaliana protein match is: UDP-N-acetylglucosamine pyrophosphorylase-related (TAIR:AT1G31070.2); Has 3596 Blast hits to 3596 proteins in 1249 species: Archae - 0; Bacteria - 2487; Metazoa - 162; Fungi - 86; Plants - 59; Viruses - 0; Other Eukaryotes - 802 (source: NCBI BLink). |
| AT5G48760 | AT5G48760.1 | TTCGGCCCATCA | 60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). |
| AT5G48760.2 | TTCGGCCCATCA | 60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). |
| AT5G49200 | AT5G49200.1 | TGATGGGCCTAAA | WD-40 repeat family protein / zfwd4 protein (ZFWD4); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / zfwd3 protein (ZFWD3) (TAIR:AT5G40880.1); Has 25041 Blast hits to 14412 proteins in 471 species: Archae - 20; Bacteria - 3252; Metazoa - 10699; Fungi - 5302; Plants - 2300; Viruses - 0; Other Eukaryotes - 3468 (source: NCBI BLink). |
| AT5G51430 | AT5G51430.1 | ACGGCCCATCA | Encodes a protein that is homologous to Cog7, a subunit of the conserved oligomeric Golgi (COG) complex, which is required for the normal morphology and function of the Golgi apparatus. It is likely to be involved in transport or retention of Golgi-localized proteins and in maintenance of Golgi morphology. |
| AT5G52300 | AT5G52300.1 | TGATGGGCCAAT | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. |
| AT5G52300.2 | TGATGGGCCAAT | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. |
| AT5G54680 | AT5G54680.1 | TGATGGGCCTTG | iaa-leucine resistant3 (ILR3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51070.1); Has 563 Blast hits to 555 proteins in 74 species: Archae - 4; Bacteria - 10; Metazoa - 69; Fungi - 13; Plants - 431; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G56700 | AT5G56700.1 | TGATGGGCCTATA | F-box protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G60610.1); Has 668 Blast hits to 656 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 666; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G63370 | AT5G63370.2 | TGATGGGC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G67580.2); Has 90774 Blast hits to 89322 proteins in 2847 species: Archae - 52; Bacteria - 8004; Metazoa - 39518; Fungi - 8567; Plants - 16625; Viruses - 438; Other Eukaryotes - 17570 (source: NCBI BLink). |
| AT5G63370.3 | TGATGGGC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G67580.2); Has 90774 Blast hits to 89322 proteins in 2847 species: Archae - 52; Bacteria - 8004; Metazoa - 39518; Fungi - 8567; Plants - 16625; Viruses - 438; Other Eukaryotes - 17570 (source: NCBI BLink). |
| AT5G66190 | AT5G66190.1 | AGAGGCCCATCA | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66190.2 | AGAGGCCCATCA | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G67490 | AT5G67490.1 | TGATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1674 (InterPro:IPR012875); Has 340 Blast hits to 340 proteins in 113 species: Archae - 0; Bacteria - 97; Metazoa - 109; Fungi - 4; Plants - 24; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). |
| AT5G67500 | AT5G67500.1 | CAAGCCCATCA | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |