| Locus | Gene model | Sequence | Description |
| AT1G01720 | AT1G01720.1 | ACCGGAAA | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. |
| AT1G02100 | AT1G02100.1 | TTTCCGGT | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02100.2 | TTTCCGGT | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02100.3 | TTTCCGGT | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G03250 | AT1G03250.1 | TTAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 29; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G03430 | AT1G03430.1 | TTTCCGGT | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT1G03890 | AT1G03890.1 | TTTCCGGTTAAA | cupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf, seed; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: CRA1 (CRUCIFERINA); nutrient reservoir (TAIR:AT5G44120.3); Has 691 Blast hits to 656 proteins in 126 species: Archae - 0; Bacteria - 61; Metazoa - 2; Fungi - 0; Plants - 627; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G04690 | AT1G04690.1 | AAAACCGGAAA | POTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink). |
| AT1G04690.1 | ACCGGAAA | POTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink). |
| AT1G04850 | AT1G04850.1 | GAACCGGAAA | ubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), PUG (InterPro:IPR006567), Zinc finger, C2H2-type (InterPro:IPR007087), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48690.1); Has 17438 Blast hits to 9965 proteins in 571 species: Archae - 30; Bacteria - 1031; Metazoa - 7907; Fungi - 1971; Plants - 445; Viruses - 50; Other Eukaryotes - 6004 (source: NCBI BLink). |
| AT1G05205 | AT1G05205.1 | CAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G05620 | AT1G05620.1 | TTTCCGGTTTGG | URIDINE-RIBOHYDROLASE 2 (URH2); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/ hydrolase/ inosine nucleosidase/ uridine nucleosidase (TAIR:AT2G36310.1); Has 3510 Blast hits to 3474 proteins in 706 species: Archae - 26; Bacteria - 2065; Metazoa - 165; Fungi - 155; Plants - 94; Viruses - 0; Other Eukaryotes - 1005 (source: NCBI BLink). |
| AT1G05620.2 | TTTCCGGTTTGG | URIDINE-RIBOHYDROLASE 2 (URH2); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/ hydrolase/ inosine nucleosidase/ uridine nucleosidase (TAIR:AT2G36310.1); Has 3510 Blast hits to 3474 proteins in 706 species: Archae - 26; Bacteria - 2065; Metazoa - 165; Fungi - 155; Plants - 94; Viruses - 0; Other Eukaryotes - 1005 (source: NCBI BLink). |
| AT1G06700 | AT1G06700.1 | ACCGGAAA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink). |
| AT1G06700.2 | ACCGGAAA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink). |
| AT1G07485 | AT1G07485.1 | ACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, leaf whorl, embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G08840 | AT1G08840.1 | TTTCCGGTTTAA | embryo defective 2411 (emb2411); FUNCTIONS IN: ATP-dependent DNA helicase activity, DNA binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA replication factor Dna2 (InterPro:IPR014808); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G03270.1); Has 4081 Blast hits to 3639 proteins in 571 species: Archae - 158; Bacteria - 979; Metazoa - 1088; Fungi - 747; Plants - 269; Viruses - 30; Other Eukaryotes - 810 (source: NCBI BLink). |
| AT1G08845 | AT1G08845.1 | TTAAACCGGAAA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: endomembrane system, ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G22450.1). |
| AT1G09630 | AT1G09630.1 | TTTCCGGTTAAG | Encodes a putative GTP-binding protein. Associates with organelles on a pathway from the Golgi to the plasma membrane in interphase. In dividing cells acts at the cell plate. |
| AT1G09640 | AT1G09640.1 | CTTAACCGGAAA | elongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell, pollen tube, leaf, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G57720.2); Has 6774 Blast hits to 6759 proteins in 920 species: Archae - 2; Bacteria - 2995; Metazoa - 1594; Fungi - 400; Plants - 499; Viruses - 0; Other Eukaryotes - 1284 (source: NCBI BLink). |
| AT1G09740 | AT1G09740.1 | ACCGGAAA | ethylene-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G11930.1); Has 2952 Blast hits to 2858 proteins in 613 species: Archae - 247; Bacteria - 2061; Metazoa - 48; Fungi - 51; Plants - 388; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G10700 | AT1G10700.1 | TTAAACCGGAAA | ribose-phosphate pyrophosphokinase 3 / phosphoribosyl diphosphate synthetase 3 (PRS3); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 4 / phosphoribosyl diphosphate synthetase 4 (PRS4) (TAIR:AT2G42910.1); Has 6424 Blast hits to 6423 proteins in 1522 species: Archae - 142; Bacteria - 3196; Metazoa - 415; Fungi - 221; Plants - 120; Viruses - 5; Other Eukaryotes - 2325 (source: NCBI BLink). |
| AT1G12390 | AT1G12390.1 | TTTAACCGGAAA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT1G15810 | AT1G15810.1 | TAACCGGAAAAGTCAA | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink). |
| AT1G16190 | AT1G16190.1 | GTAAACCGGAAA | DNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink). |
| AT1G19350 | AT1G19350.1 | TTTCCGGT | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.3 | TTTCCGGT | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.4 | TTTCCGGT | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.5 | TTTCCGGT | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.6 | TTTCCGGT | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19700 | AT1G19700.1 | TTTCCGGT | Encodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light. |
| AT1G19700.2 | TTTCCGGT | Encodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light. |
| AT1G20220 | AT1G20220.1 | AAAACCGGAAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G76010.1); Has 42345 Blast hits to 16680 proteins in 1015 species: Archae - 19; Bacteria - 12355; Metazoa - 15425; Fungi - 3233; Plants - 4676; Viruses - 581; Other Eukaryotes - 6056 (source: NCBI BLink). |
| AT1G20460 | AT1G20460.1 | GAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G21930 | AT1G21930.1 | TTTCCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G42150.3); Has 24 Blast hits to 24 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22220 | AT1G22220.1 | TTTCCGGT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G78100.1); Has 82 Blast hits to 81 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22882 | AT1G22882.1 | TTTCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71360.1); Has 1862 Blast hits to 1619 proteins in 245 species: Archae - 32; Bacteria - 119; Metazoa - 736; Fungi - 195; Plants - 90; Viruses - 21; Other Eukaryotes - 669 (source: NCBI BLink). |
| AT1G22940 | AT1G22940.1 | ACCGGAAA | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
| AT1G23180 | AT1G23180.1 | TTTCCGGTTTG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein / F-box family protein (TAIR:AT2G44900.1); Has 1577 Blast hits to 1070 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 532; Fungi - 257; Plants - 682; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). |
| AT1G26650 | AT1G26650.1 | ACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27840 | AT1G27840.1 | ACCGGAAA | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G27840.2 | ACCGGAAA | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G27840.3 | ACCGGAAA | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G32550 | AT1G32550.1 | GTAAACCGGAAA | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1). |
| AT1G32550.1 | TTTCCGGTTT | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1). |
| AT1G32550.2 | GTAAACCGGAAA | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1). |
| AT1G32550.2 | TTTCCGGTTT | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1). |
| AT1G32560 | AT1G32560.1 | ATAAACCGGAAA | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G32560.1 | TTTCCGGTTTAC | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G34000 | AT1G34000.1 | TTTCCGGTTTGG | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. |
| AT1G35340 | AT1G35340.2 | TTAAACCGGAAA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G35340.3 | TTAAACCGGAAA | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G48090 | AT1G48090.1 | ACCGGAAA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17140.1); Has 1972 Blast hits to 1096 proteins in 156 species: Archae - 2; Bacteria - 10; Metazoa - 987; Fungi - 338; Plants - 230; Viruses - 0; Other Eukaryotes - 405 (source: NCBI BLink). |
| AT1G48090.2 | ACCGGAAA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17140.1); Has 1972 Blast hits to 1096 proteins in 156 species: Archae - 2; Bacteria - 10; Metazoa - 987; Fungi - 338; Plants - 230; Viruses - 0; Other Eukaryotes - 405 (source: NCBI BLink). |
| AT1G48300 | AT1G48300.1 | TTTCCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT1G49380 | AT1G49380.1 | ATAAACCGGAAA | cytochrome c biogenesis protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cytochrome complex assembly; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ResB-like (InterPro:IPR007816); Has 930 Blast hits to 928 proteins in 301 species: Archae - 0; Bacteria - 569; Metazoa - 2; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 335 (source: NCBI BLink). |
| AT1G49590 | AT1G49590.1 | TTTCCGGTTTG | formin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G49590.2 | TTTCCGGTTTG | formin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G53320 | AT1G53320.1 | ATCCGGTTTAGTCGTCGTTTCCGGTTTAG | Member of TLP family |
| AT1G53570 | AT1G53570.1 | ACCGGAAA | MEK kinase (MAP3Ka) |
| AT1G53570.2 | ACCGGAAA | MEK kinase (MAP3Ka) |
| AT1G53570.3 | ACCGGAAA | MEK kinase (MAP3Ka) |
| AT1G54090 | AT1G54090.1 | TTTCCGGT | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G54520 | AT1G54520.1 | ACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1517 (InterPro:IPR010903); Has 198 Blast hits to 197 proteins in 64 species: Archae - 0; Bacteria - 91; Metazoa - 6; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G59600 | AT1G59600.1 | GAACCGGAAA | ZCW7; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 107 Blast hits to 107 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G61780 | AT1G61780.1 | AAGGGTATTTGCCGTTTACCGGAAA | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G61790 | AT1G61790.1 | TTTCCGGTAAACGGC | OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G62040 | AT1G62040.1 | TTTCCGGTTC | autophagy 8c (ATG8C); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: autophagy 8d (APG8d) (TAIR:AT2G05630.1); Has 1161 Blast hits to 1159 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 579; Fungi - 124; Plants - 171; Viruses - 3; Other Eukaryotes - 284 (source: NCBI BLink). |
| AT1G62580 | AT1G62580.1 | ACCGGAAA | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Dimethylaniline monooxygenase, N-oxide-forming (InterPro:IPR012143); BEST Arabidopsis thaliana protein match is: FAD binding / NADP or NADPH binding / electron carrier/ flavin-containing monooxygenase/ monooxygenase (TAIR:AT1G63340.1); Has 8079 Blast hits to 7827 proteins in 911 species: Archae - 42; Bacteria - 3448; Metazoa - 964; Fungi - 712; Plants - 400; Viruses - 0; Other Eukaryotes - 2513 (source: NCBI BLink). |
| AT1G62850 | AT1G62850.2 | CGAACCGGAAA | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G62850.2 | GTAAACCGGAAA | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G62850.2 | TGAACCGGAAA | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G62850.3 | CGAACCGGAAA | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G62850.3 | GTAAACCGGAAA | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G62850.3 | TGAACCGGAAA | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G70780 | AT1G70780.1 | AAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23150.1); Has 70 Blast hits to 70 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G70782 | AT1G70782.1 | AAAACCGGAAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF28 represents a conserved upstream opening reading frame relative to major ORF AT1G70780.1 |
| AT1G71090 | AT1G71090.1 | TTAAACCGGAAA | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G72175 | AT1G72175.1 | CAAACCGGAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G22510.1); Has 591 Blast hits to 591 proteins in 84 species: Archae - 0; Bacteria - 8; Metazoa - 474; Fungi - 32; Plants - 29; Viruses - 2; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G75100 | AT1G75100.1 | ACCGGAAA | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. |
| AT1G75200 | AT1G75200.1 | ACCGGAAA | flavodoxin family protein / radical SAM domain-containing protein; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Flavodoxin-like (InterPro:IPR001094), Flavodoxin/nitric oxide synthase (InterPro:IPR008254), Radical SAM (InterPro:IPR007197), Wyosine base formation (InterPro:IPR013917); BEST Arabidopsis thaliana protein match is: ATR2 (ARABIDOPSIS P450 REDUCTASE 2); NADPH-hemoprotein reductase (TAIR:AT4G30210.2); Has 2213 Blast hits to 2197 proteins in 587 species: Archae - 120; Bacteria - 563; Metazoa - 592; Fungi - 399; Plants - 128; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink). |
| AT1G75670 | AT1G75670.1 | AAAACCGGAAA | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G75670.2 | AAAACCGGAAA | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G76850 | AT1G76850.1 | ACCGGAAA | EXOCYST COMPLEX COMPONENT SEC5 (SEC5A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: SEC5B (TAIR:AT1G21170.1); Has 394 Blast hits to 372 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 200; Fungi - 94; Plants - 52; Viruses - 4; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT1G78700 | AT1G78700.1 | ATAACCGGAAA | brassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink). |
| AT1G80410 | AT1G80410.1 | AAACCGGAAA | EMBRYO DEFECTIVE 2753 (EMB2753); FUNCTIONS IN: binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 3255 Blast hits to 2440 proteins in 375 species: Archae - 356; Bacteria - 819; Metazoa - 489; Fungi - 174; Plants - 61; Viruses - 3; Other Eukaryotes - 1353 (source: NCBI BLink). |
| AT2G04540 | AT2G04540.1 | CCAAACCGGAAA | 3-oxoacyl-(acyl-carrier-protein) synthase II, putative; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, fatty-acid synthase activity, catalytic activity; INVOLVED IN: biosynthetic process, fatty acid biosynthetic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-ketoacyl synthase (InterPro:IPR000794), Thiolase-like (InterPro:IPR016039), Beta-ketoacyl synthase, C-terminal (InterPro:IPR014031), 3-oxoacyl-[acyl-carrier-protein] synthase 2 (InterPro:IPR017568), Beta-ketoacyl synthase, N-terminal (InterPro:IPR014030), Thiolase-like, subgroup (InterPro:IPR016038), Beta-ketoacyl synthase, active site (InterPro:IPR018201); BEST Arabidopsis thaliana protein match is: FAB1 (FATTY ACID BIOSYNTHESIS 1); 3-oxoacyl-[acyl-carrier-protein] synthase/ fatty-acid synthase (TAIR:AT1G74960.2); Has 19605 Blast hits to 17878 proteins in 2069 species: Archae - 5; Bacteria - 11810; Metazoa - 457; Fungi - 1652; Plants - 223; Viruses - 0; Other Eukaryotes - 5458 (source: NCBI BLink). |
| AT2G04700 | AT2G04700.1 | TTCCGGTTATTTCCGGTTTG | ferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT2G04890 | AT2G04890.1 | ACCGGAAA | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
| AT2G05220 | AT2G05220.1 | TTTCCGGTTAAA | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05220.2 | TTTCCGGTTAAA | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G20550 | AT2G20550.1 | ACCGGAAA | DNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT2G20550.2 | ACCGGAAA | DNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT2G20790 | AT2G20790.2 | TTTCCGGT | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968); Has 201 Blast hits to 201 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 25; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT2G20790.3 | TTTCCGGT | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968); Has 201 Blast hits to 201 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 25; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT2G21960 | AT2G21960.1 | TTTCCGGT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56180.1); Has 140 Blast hits to 140 proteins in 40 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT2G24180 | AT2G24180.1 | TTTCCGGT | cytochrome P450 monooxygenase |
| AT2G25850 | AT2G25850.1 | CGAACCGGAAA | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT2G25850.2 | CGAACCGGAAA | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT2G25850.3 | CGAACCGGAAA | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT2G25870 | AT2G25870.1 | TTTCCGGTTCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cof protein (InterPro:IPR000150), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200), Uncharacterised protein family UPF0054 (InterPro:IPR002036); Has 11617 Blast hits to 11603 proteins in 1525 species: Archae - 144; Bacteria - 9370; Metazoa - 28; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 2020 (source: NCBI BLink). |
| AT2G28450 | AT2G28450.1 | CAAACCGGAAA | zinc finger (CCCH-type) family protein; FUNCTIONS IN: methyltransferase activity, zinc ion binding, RNA methyltransferase activity, nucleic acid binding; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280); BEST Arabidopsis thaliana protein match is: RNA methyltransferase family protein (TAIR:AT3G21300.1); Has 4397 Blast hits to 3845 proteins in 1016 species: Archae - 74; Bacteria - 3383; Metazoa - 309; Fungi - 76; Plants - 54; Viruses - 3; Other Eukaryotes - 498 (source: NCBI BLink). |
| AT2G28550 | AT2G28550.1 | AAAACCGGAAA | RELATED TO AP2.7 (RAP2.7); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: organ morphogenesis, regulation of transcription, DNA-dependent, vegetative to reproductive phase transition; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: TOE2; DNA binding / transcription factor (TAIR:AT5G60120.1); Has 3106 Blast hits to 2890 proteins in 180 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 3041; Viruses - 7; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT2G28550.2 | AAAACCGGAAA | RELATED TO AP2.7 (RAP2.7); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: organ morphogenesis, regulation of transcription, DNA-dependent, vegetative to reproductive phase transition; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: TOE2; DNA binding / transcription factor (TAIR:AT5G60120.1); Has 3106 Blast hits to 2890 proteins in 180 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 3041; Viruses - 7; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT2G29020 | AT2G29020.1 | TTTCCGGT | Rab5-interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rab5-interacting (InterPro:IPR010742); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59410.1); Has 144 Blast hits to 144 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT2G30260 | AT2G30260.1 | TTTCCGGTTCAA | encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. |
| AT2G31170 | AT2G31170.1 | TTAAACCGAACCGGAAA | SYCO ARATH; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT5G38830.1); Has 8663 Blast hits to 8413 proteins in 1630 species: Archae - 200; Bacteria - 3464; Metazoa - 434; Fungi - 181; Plants - 82; Viruses - 3; Other Eukaryotes - 4299 (source: NCBI BLink). |
| AT2G31410 | AT2G31410.1 | TTTCCGGTTCGGTTCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1826 Blast hits to 1084 proteins in 146 species: Archae - 5; Bacteria - 17; Metazoa - 730; Fungi - 159; Plants - 161; Viruses - 1; Other Eukaryotes - 753 (source: NCBI BLink). |
| AT2G31740 | AT2G31740.1 | TTTCCGGTTCGGTTTGG | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: spermidine synthase-related / putrescine aminopropyltransferase-related (TAIR:AT5G04610.1); Has 1448 Blast hits to 1421 proteins in 339 species: Archae - 18; Bacteria - 478; Metazoa - 298; Fungi - 34; Plants - 123; Viruses - 0; Other Eukaryotes - 497 (source: NCBI BLink). |
| AT2G32380 | AT2G32380.1 | CAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 102 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 9; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G39480 | AT2G39480.1 | ACCGGAAA | P-GLYCOPROTEIN 6 (PGP6); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane region, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane region (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PGP20 (P-GLYCOPROTEIN 20); ATPase, coupled to transmembrane movement of substances (TAIR:AT3G55320.1); Has 425152 Blast hits to 214184 proteins in 2609 species: Archae - 7629; Bacteria - 293193; Metazoa - 15627; Fungi - 7875; Plants - 4410; Viruses - 13; Other Eukaryotes - 96405 (source: NCBI BLink). |
| AT2G40850 | AT2G40850.1 | TTTCCGGT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: tapetum, microspore; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: inositol or phosphatidylinositol kinase/ phosphotransferase, alcohol group as acceptor (TAIR:AT3G56600.1); Has 343 Blast hits to 338 proteins in 100 species: Archae - 0; Bacteria - 2; Metazoa - 105; Fungi - 40; Plants - 128; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT2G42560 | AT2G42560.1 | ACCGGAAA | late embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: ATECP63 (EMBRYONIC CELL PROTEIN 63) (TAIR:AT2G36640.1); Has 12374 Blast hits to 7501 proteins in 1066 species: Archae - 63; Bacteria - 4676; Metazoa - 2087; Fungi - 744; Plants - 1442; Viruses - 129; Other Eukaryotes - 3233 (source: NCBI BLink). |
| AT2G43210 | AT2G43210.1 | TTTCCGGTTTT | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink). |
| AT2G43210.2 | TTTCCGGTTTT | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink). |
| AT2G44040 | AT2G44040.1 | TTTCCGGTTTG | dihydrodipicolinate reductase family protein; FUNCTIONS IN: dihydrodipicolinate reductase activity; INVOLVED IN: oxidation reduction, lysine biosynthetic process via diaminopimelate, metabolic process, diaminopimelate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Dihydrodipicolinate reductase, plant (InterPro:IPR011859), Dihydrodipicolinate reductase, bacterial and plant (InterPro:IPR011770), Dihydrodipicolinate reductase (InterPro:IPR000846); BEST Arabidopsis thaliana protein match is: dihydrodipicolinate reductase family protein (TAIR:AT3G59890.1); Has 2046 Blast hits to 2045 proteins in 732 species: Archae - 80; Bacteria - 1476; Metazoa - 2; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). |
| AT2G44050 | AT2G44050.1 | CAAACCGGAAA | 6,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase [Arabidopsis thaliana]. Acts in the jasmonic acid signaling pathway. |
| AT2G44870 | AT2G44870.1 | TTTCCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46260 | AT2G46260.1 | ACCGGAAA | BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT2G46900 | AT2G46900.1 | AAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink). |
| AT3G01370 | AT3G01370.1 | ATAAACCGGAAA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT3G02190 | AT3G02190.1 | TTTCCGGTTAAA | 60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT3G02200 | AT3G02200.1 | TTTAACCGGAAA | proteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT3G02200.2 | TTTAACCGGAAA | proteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT3G03810 | AT3G03810.1 | TTGAACCGGAAAGTCAATTGGG | embryo sac development arrest 30 (EDA30); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, polar nucleus fusion, pollen tube development; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30300.1); Has 433 Blast hits to 418 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 433; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03890 | AT3G03890.1 | ATAAACCGGAAA | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G03890.2 | ATAAACCGGAAA | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G04080 | AT3G04080.1 | TTTCCGGT | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination. |
| AT3G04110 | AT3G04110.1 | ACCGGAAA | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G04680 | AT3G04680.1 | TTAACCGGAAA | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT3G04680.2 | TTAACCGGAAA | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT3G05190 | AT3G05190.1 | TTTCCGGTTAT | aminotransferase class IV family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544), Aminotransferase, class IV, conserved site (InterPro:IPR018300); BEST Arabidopsis thaliana protein match is: aminotransferase class IV family protein (TAIR:AT5G27410.1); Has 9097 Blast hits to 9096 proteins in 1178 species: Archae - 99; Bacteria - 4133; Metazoa - 10; Fungi - 55; Plants - 190; Viruses - 0; Other Eukaryotes - 4610 (source: NCBI BLink). |
| AT3G06050 | AT3G06050.1 | TTTCCGGT | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
| AT3G06140 | AT3G06140.1 | CCAAACCGGAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink). |
| AT3G06430 | AT3G06430.1 | TTTCCGGTTCGGTT | embryo defective 2750 (EMB2750); INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13889 Blast hits to 5167 proteins in 165 species: Archae - 3; Bacteria - 14; Metazoa - 269; Fungi - 227; Plants - 12750; Viruses - 0; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT3G07590 | AT3G07590.1 | TTTCCGGTTTG | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT3G07740 | AT3G07740.1 | TTTCCGGT | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
| AT3G07740.2 | TTTCCGGT | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
| AT3G07740.3 | TTTCCGGT | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
| AT3G08630 | AT3G08630.1 | TTTCCGGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: alphavirus core protein family (TAIR:AT3G08640.1); Has 3471 Blast hits to 1913 proteins in 226 species: Archae - 0; Bacteria - 450; Metazoa - 1700; Fungi - 130; Plants - 787; Viruses - 19; Other Eukaryotes - 385 (source: NCBI BLink). |
| AT3G10140 | AT3G10140.1 | TTTCCGGT | recA homolog 3 (RECA3); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA-dependent ATPase activity, DNA binding, nucleotide binding, ATP binding; INVOLVED IN: DNA repair, SOS response, DNA recombination, DNA metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), RecA (InterPro:IPR013765), RecA bacterial DNA recombination (InterPro:IPR001553); BEST Arabidopsis thaliana protein match is: recA family protein (TAIR:AT2G19490.1); Has 13670 Blast hits to 13583 proteins in 3361 species: Archae - 216; Bacteria - 8994; Metazoa - 140; Fungi - 177; Plants - 138; Viruses - 71; Other Eukaryotes - 3934 (source: NCBI BLink). |
| AT3G10650 | AT3G10650.1 | ACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: nucleoporin-related (TAIR:AT5G20200.1); Has 51621 Blast hits to 25162 proteins in 1378 species: Archae - 161; Bacteria - 11485; Metazoa - 15659; Fungi - 10121; Plants - 1099; Viruses - 600; Other Eukaryotes - 12496 (source: NCBI BLink). |
| AT3G11590 | AT3G11590.1 | TTTCCGGTTTT | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink). |
| AT3G11690 | AT3G11690.1 | ACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06380.1); Has 48 Blast hits to 48 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11945 | AT3G11945.1 | CCGAACCGGAAA | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT3G11945.2 | CCGAACCGGAAA | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT3G12130 | AT3G12130.1 | TTTCCGGTTTAT | KH domain-containing protein / zinc finger (CCCH type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein / zinc finger (CCCH type) family protein (TAIR:AT5G06770.1); Has 951 Blast hits to 736 proteins in 106 species: Archae - 0; Bacteria - 4; Metazoa - 647; Fungi - 21; Plants - 174; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G12260 | AT3G12260.1 | TAACCGGAAATAATTACG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G12760 | AT3G12760.1 | TTTCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defective in cullin neddylation (InterPro:IPR014764), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Protein of unknown function DUF298 (InterPro:IPR005176), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15860.2); Has 628 Blast hits to 626 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 408; Fungi - 99; Plants - 64; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G13470 | AT3G13470.1 | ACCGGAAA | chaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24486 Blast hits to 24452 proteins in 5132 species: Archae - 390; Bacteria - 14009; Metazoa - 1525; Fungi - 954; Plants - 450; Viruses - 2; Other Eukaryotes - 7156 (source: NCBI BLink). |
| AT3G13920 | AT3G13920.1 | AGGGGTAAAACCGGAAA | eukaryotic translation initiation factor 4A-1 |
| AT3G13920.2 | AGGGGTAAAACCGGAAA | eukaryotic translation initiation factor 4A-1 |
| AT3G13920.3 | AGGGGTAAAACCGGAAA | eukaryotic translation initiation factor 4A-1 |
| AT3G14180 | AT3G14180.1 | ACCGGAAA | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT3G14930 | AT3G14930.1 | ACCGGAAA | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G14930.2 | ACCGGAAA | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G14930.3 | ACCGGAAA | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G15420 | AT3G15420.1 | TTTCCGGTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15430 | AT3G15430.1 | GAACCGGAAA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). |
| AT3G15430.2 | GAACCGGAAA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). |
| AT3G16750 | AT3G16750.1 | GTAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4694 Blast hits to 1384 proteins in 164 species: Archae - 36; Bacteria - 1175; Metazoa - 1347; Fungi - 379; Plants - 64; Viruses - 23; Other Eukaryotes - 1670 (source: NCBI BLink). |
| AT3G16810 | AT3G16810.1 | TTAAACCGGAAA | Arabidopsis Pumilio 24 (APUM24); FUNCTIONS IN: RNA binding, binding; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 1729 Blast hits to 925 proteins in 171 species: Archae - 0; Bacteria - 1; Metazoa - 1021; Fungi - 301; Plants - 205; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT3G16910 | AT3G16910.1 | TAACCGGAAA | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT3G16910.1 | TTTCCGGT | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT3G19810 | AT3G19810.1 | TTTCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF177 (InterPro:IPR003772); Has 362 Blast hits to 362 proteins in 133 species: Archae - 0; Bacteria - 259; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G22845 | AT3G22845.1 | TTTCCGGTTTGG | emp24/gp25L/p24 protein-related; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT3G07680.1); Has 1355 Blast hits to 1355 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 771; Fungi - 319; Plants - 146; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT3G23255 | AT3G23255.1 | TTTCCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G24100 | AT3G24100.1 | AAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G26090 | AT3G26090.1 | ACCGGAAA | Encodes ArRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. |
| AT3G26400 | AT3G26400.1 | TTTCCGGT | member of eIF4B - eukaryotic initiation factor 4B |
| AT3G26922 | AT3G26922.1 | TTTCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G52680.2). |
| AT3G42950 | AT3G42950.1 | TTTCCGGTTCA | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT1G19170.1); Has 2496 Blast hits to 2489 proteins in 316 species: Archae - 2; Bacteria - 615; Metazoa - 8; Fungi - 925; Plants - 839; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G45420 | AT3G45420.1 | TTTCCGGT | lectin protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: mitochondrion; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase-related (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: lectin protein kinase family protein (TAIR:AT3G45410.1); Has 86033 Blast hits to 84943 proteins in 3095 species: Archae - 45; Bacteria - 7776; Metazoa - 37180; Fungi - 6768; Plants - 19628; Viruses - 380; Other Eukaryotes - 14256 (source: NCBI BLink). |
| AT3G49400 | AT3G49400.1 | ACCGGAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT3G49580 | AT3G49580.1 | ATAAACCGGAAA | RESPONSE TO LOW SULFUR 1 (LSU1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: LSU3 (RESPONSE TO LOW SULFUR 3) (TAIR:AT3G49570.1); Has 45 Blast hits to 45 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G49744 | AT3G49744.1 | TTTCCGGT | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT3G52200 | AT3G52200.1 | TTTCCGGTTCGGT | dihydrolipoamide S-acetyltransferase (LTA3) mRNA, nuclear |
| AT3G52610 | AT3G52610.1 | ATAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 38 Blast hits to 37 proteins in 11 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G53710 | AT3G53710.1 | ACCGGAAA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G53710.2 | ACCGGAAA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G54300 | AT3G54300.1 | AAACCGGAAA | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
| AT3G54300.2 | AAACCGGAAA | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
| AT3G54750 | AT3G54750.1 | ATAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 113 Blast hits to 113 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G54750.2 | ATAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 113 Blast hits to 113 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G55830 | AT3G55830.1 | ACCGGAAA | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant. |
| AT3G55850 | AT3G55850.1 | TTTCCGGTTAT | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT3G57550 | AT3G57550.1 | CAGCGTTTTCCGGT | guanylate kinase |
| AT3G57550.2 | CAGCGTTTTCCGGT | guanylate kinase |
| AT3G60240 | AT3G60240.2 | ACCGGAAA | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60240.3 | ACCGGAAA | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60240.4 | ACCGGAAA | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G61790 | AT3G61790.1 | CAGCGTTTCCGGTTCA | seven in absentia (SINA) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: seven in absentia (SINA) family protein (TAIR:AT4G27880.1); Has 1422 Blast hits to 1414 proteins in 637 species: Archae - 0; Bacteria - 0; Metazoa - 1099; Fungi - 9; Plants - 250; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT3G61930 | AT3G61930.1 | AAATACCCAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G62360 | AT3G62360.1 | ACCGGAAA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G00058 | AT4G00058.1 | TTTCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. |
| AT4G00560 | AT4G00560.1 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.2 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.3 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00620 | AT4G00620.1 | AAAACCGGAAA | tetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00600.1); Has 7121 Blast hits to 7116 proteins in 1557 species: Archae - 77; Bacteria - 3120; Metazoa - 345; Fungi - 203; Plants - 87; Viruses - 0; Other Eukaryotes - 3289 (source: NCBI BLink). |
| AT4G01200 | AT4G01200.1 | ACCGGAAA | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT2G33320.1); Has 143 Blast hits to 143 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 143; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G01330 | AT4G01330.1 | TTTCCGGTTC | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G01540.2); Has 62408 Blast hits to 61982 proteins in 2735 species: Archae - 19; Bacteria - 4713; Metazoa - 27742; Fungi - 4275; Plants - 16191; Viruses - 174; Other Eukaryotes - 9294 (source: NCBI BLink). |
| AT4G01900 | AT4G01900.1 | CTAAACCGGAAA | encodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine. |
| AT4G03380 | AT4G03380.1 | TTTCCGGTTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: NAF1 (NUCLEAR ASSEMBLY FACTOR 1) (TAIR:AT1G03530.1); Has 13 Blast hits to 13 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04740 | AT4G04740.1 | TTTCCGGTATA | member of Calcium Dependent Protein Kinase |
| AT4G08350 | AT4G08350.1 | TTTCCGGTTTAG | GLOBAL TRANSCRIPTION FACTOR GROUP A2 (GTA2); FUNCTIONS IN: transcription elongation regulator activity, structural constituent of ribosome, transcription factor activity; INVOLVED IN: translation, regulation of transcription from RNA polymerase II promoter, positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), Transcription elongation factor Spt5 (InterPro:IPR017071), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824), Supt5 repeat (InterPro:IPR005100); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome / transcription elongation regulator/ transcription initiation factor (TAIR:AT2G34210.1); Has 14306 Blast hits to 8900 proteins in 471 species: Archae - 78; Bacteria - 505; Metazoa - 6585; Fungi - 2279; Plants - 912; Viruses - 310; Other Eukaryotes - 3637 (source: NCBI BLink). |
| AT4G13780 | AT4G13780.1 | CAAACCGGAAA | methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative; FUNCTIONS IN: methionine-tRNA ligase activity, tRNA binding, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, methionyl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: tRNA-binding region domain-containing protein (TAIR:AT2G40660.1); Has 12421 Blast hits to 12391 proteins in 1665 species: Archae - 324; Bacteria - 5389; Metazoa - 513; Fungi - 358; Plants - 127; Viruses - 3; Other Eukaryotes - 5707 (source: NCBI BLink). |
| AT4G16710 | AT4G16710.1 | GGCGTTTTTCCGGT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G16710.2 | GGCGTTTTTCCGGT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G17420 | AT4G17420.1 | TTAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF124 (InterPro:IPR002838), Tryptophan RNA-binding attenuator protein-like (InterPro:IPR016031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47420.1); Has 588 Blast hits to 588 proteins in 254 species: Archae - 60; Bacteria - 418; Metazoa - 0; Fungi - 6; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT4G17420.2 | TTAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF124 (InterPro:IPR002838), Tryptophan RNA-binding attenuator protein-like (InterPro:IPR016031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47420.1); Has 588 Blast hits to 588 proteins in 254 species: Archae - 60; Bacteria - 418; Metazoa - 0; Fungi - 6; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT4G17420.3 | TTAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF124 (InterPro:IPR002838), Tryptophan RNA-binding attenuator protein-like (InterPro:IPR016031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47420.1); Has 588 Blast hits to 588 proteins in 254 species: Archae - 60; Bacteria - 418; Metazoa - 0; Fungi - 6; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT4G17900 | AT4G17900.1 | ATAAACCGGAAA | zinc-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF597 (InterPro:IPR006734); BEST Arabidopsis thaliana protein match is: zinc-binding family protein (TAIR:AT1G32700.1); Has 193 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G17900.2 | ATAAACCGGAAA | zinc-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF597 (InterPro:IPR006734); BEST Arabidopsis thaliana protein match is: zinc-binding family protein (TAIR:AT1G32700.1); Has 193 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18580 | AT4G18580.1 | TTTCCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18580.2 | TTTCCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18810 | AT4G18810.1 | ACCGGTTAATTAAACCGGAAA | binding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink). |
| AT4G20260 | AT4G20260.1 | TTTCCGGTT | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. |
| AT4G20260.2 | TTTCCGGTT | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. |
| AT4G20260.3 | TTTCCGGTT | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. |
| AT4G20260.4 | TTTCCGGTT | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. |
| AT4G20960 | AT4G20960.1 | TTTCCGGTTA | encodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis |
| AT4G21660 | AT4G21660.1 | CCAAACCGGAAA | proline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink). |
| AT4G25672 | AT4G25672.1 | GAACCGGAAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF12 represents a conserved upstream opening reading frame relative to major ORF AT4G25670.1 |
| AT4G25880 | AT4G25880.1 | ACCGGAAA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink). |
| AT4G25880.2 | ACCGGAAA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink). |
| AT4G25880.3 | ACCGGAAA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink). |
| AT4G27630 | AT4G27630.2 | TTGAACCGGAAA | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT4G29480 | AT4G29480.1 | TTTCCGGTTA | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G29810 | AT4G29810.1 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29810.2 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29810.3 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29840 | AT4G29840.1 | TTTCCGGTTTAA | threonine synthase |
| AT4G32340 | AT4G32340.1 | GAACCGGAAA | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G80130.1); Has 2680 Blast hits to 1282 proteins in 184 species: Archae - 2; Bacteria - 433; Metazoa - 1247; Fungi - 71; Plants - 657; Viruses - 13; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G32840 | AT4G32840.1 | AAAACCGGAAA | PHOSPHOFRUCTOKINASE 6 (PFK6); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK1 (PHOSPHOFRUCTOKINASE 1); 6-phosphofructokinase (TAIR:AT4G29220.1); Has 4932 Blast hits to 4525 proteins in 1180 species: Archae - 20; Bacteria - 2587; Metazoa - 575; Fungi - 273; Plants - 227; Viruses - 2; Other Eukaryotes - 1248 (source: NCBI BLink). |
| AT4G33030 | AT4G33030.1 | AACCGGAAA | involved in sulfolipid biosynthesis |
| AT4G34200 | AT4G34200.1 | TTTCCGGT | embryo sac development arrest 9 (EDA9); FUNCTIONS IN: ATP binding; INVOLVED IN: megagametogenesis; LOCATED IN: mitochondrion, chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-3-phosphoglycerate dehydrogenase (InterPro:IPR006236), D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), D-3-phosphogylcerate Dehydrogenase (InterPro:IPR015508), Amino acid-binding ACT (InterPro:IPR002912), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative (TAIR:AT3G19480.1); Has 20829 Blast hits to 20828 proteins in 1560 species: Archae - 296; Bacteria - 9792; Metazoa - 668; Fungi - 756; Plants - 318; Viruses - 5; Other Eukaryotes - 8994 (source: NCBI BLink). |
| AT4G35000 | AT4G35000.1 | ACCGGAAA | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35700 | AT4G35700.1 | TTTCCGGTTCA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G35610.1); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35785 | AT4G35785.1 | ACCGGAAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.2 | ACCGGAAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.3 | ACCGGAAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35850 | AT4G35850.1 | TTTCCGGTTTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink). |
| AT4G39520 | AT4G39520.1 | TTAAACCGGAAA | GTP-binding protein, putative; FUNCTIONS IN: GTP binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), TGS (InterPro:IPR004095), GTP1/OBG (InterPro:IPR006073), GTP1/OBG, conserved site (InterPro:IPR006074), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: developmentally regulated GTP-binding protein, putative (TAIR:AT1G72660.3); Has 12043 Blast hits to 12023 proteins in 1588 species: Archae - 468; Bacteria - 6069; Metazoa - 728; Fungi - 429; Plants - 176; Viruses - 0; Other Eukaryotes - 4173 (source: NCBI BLink). |
| AT4G40042 | AT4G40042.1 | TTTCCGGTTCA | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 56; Plants - 39; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G01600 | AT5G01600.1 | GAACCGGAAA | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT5G01890 | AT5G01890.1 | TTTCCGGT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT3G56370.1); Has 147293 Blast hits to 98287 proteins in 3603 species: Archae - 89; Bacteria - 11351; Metazoa - 61054; Fungi - 6977; Plants - 48384; Viruses - 332; Other Eukaryotes - 19106 (source: NCBI BLink). |
| AT5G03830 | AT5G03830.1 | TTTCCGGTTCAGGCCCCAATTGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G03900 | AT5G03900.1 | TTGAACCGTTTCCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G03900.2 | TTGAACCGTTTCCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G05200 | AT5G05200.1 | TTAACCGGAAA | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink). |
| AT5G05210 | AT5G05210.1 | TTTCCGGTTAA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G05210.2 | TTTCCGGTTAA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G07320 | AT5G07320.1 | CAAACCGGAAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink). |
| AT5G07320.1 | TTTCCGGTTTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink). |
| AT5G10840 | AT5G10840.1 | CCAAACCGGAAA | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae - 0; Bacteria - 38; Metazoa - 446; Fungi - 142; Plants - 235; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT5G11010 | AT5G11010.1 | TTTCCGGTTCG | pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G11010.2 | TTTCCGGTTCG | pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G11010.3 | TTTCCGGTTCG | pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G12130 | AT5G12130.1 | AAAACCGGAAA | PIGMENT DEFECTIVE 149 (PDE149); INVOLVED IN: thylakoid membrane organization; LOCATED IN: chloroplast thylakoid membrane, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Integral membrane protein TerC (InterPro:IPR005496); Has 2303 Blast hits to 2303 proteins in 668 species: Archae - 4; Bacteria - 1555; Metazoa - 2; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 721 (source: NCBI BLink). |
| AT5G12290 | AT5G12290.1 | TTAACCGGAAA | Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. |
| AT5G13030 | AT5G13030.1 | TGAACCGGAAAAGTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0061 (InterPro:IPR003846); Has 4055 Blast hits to 4018 proteins in 759 species: Archae - 4; Bacteria - 1451; Metazoa - 102; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 2390 (source: NCBI BLink). |
| AT5G15550 | AT5G15550.1 | CTAAACCGGAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink). |
| AT5G15550.2 | CTAAACCGGAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink). |
| AT5G16780 | AT5G16780.1 | TGAACCGGAAA | Encodes a protein belonging to SART-1 family. The gene is expressed in the basal region of the developing embryo during heart stage. Phenotypic analyses of dot2 mutants suggest that this protein plays a role in root, shoot, and flower development. dot2 mutants are dwarved plants that display an aberrant spurred leaf venation pattern and fail to flower. In the roots DOT2 appears to be require for normal meristem organization and maintenance and the proper expression of PIN and PLT genes. |
| AT5G17270 | AT5G17270.1 | TTTCCGGT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). |
| AT5G18200 | AT5G18200.1 | TTTCCGGTTCAA | encodes an adenylyltransferase |
| AT5G19020 | AT5G19020.1 | TTTCCGGT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G22070.1); Has 16806 Blast hits to 5030 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 61; Fungi - 55; Plants - 16323; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink). |
| AT5G19950 | AT5G19950.1 | AAACCGGAAA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.2 | AAACCGGAAA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.3 | AAACCGGAAA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19960 | AT5G19960.1 | TTTCCGGTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP8; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G39260.2); Has 17397 Blast hits to 14212 proteins in 592 species: Archae - 12; Bacteria - 964; Metazoa - 9774; Fungi - 1887; Plants - 2774; Viruses - 3; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT5G23310 | AT5G23310.1 | TTTCCGGTTCG | Fe superoxide dismutase |
| AT5G25070 | AT5G25070.1 | TTTCCGGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink). |
| AT5G26160 | AT5G26160.1 | GGACCCACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20610.1); Has 138 Blast hits to 117 proteins in 36 species: Archae - 0; Bacteria - 14; Metazoa - 25; Fungi - 15; Plants - 62; Viruses - 2; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G26751 | AT5G26751.1 | ACCGGAAA | encodes a SHAGGY-related kinase involved in meristem organization. |
| AT5G27270 | AT5G27270.1 | ATAAACCGGAAA | EMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink). |
| AT5G27440 | AT5G27440.1 | TTTCCGGTTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G27450 | AT5G27450.1 | TTTAACCGGAAA | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G27450.2 | TTTAACCGGAAA | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G27730 | AT5G27730.1 | TTTCCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47900.1); Has 651 Blast hits to 616 proteins in 129 species: Archae - 0; Bacteria - 235; Metazoa - 100; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 256 (source: NCBI BLink). |
| AT5G27830 | AT5G27830.1 | TTTCCGGTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G27830.2 | TTTCCGGTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G27830.3 | TTTCCGGTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G35320 | AT5G35320.1 | CCAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G37830 | AT5G37830.1 | AAAACCGGAAA | Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. |
| AT5G40450 | AT5G40450.1 | ACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28770.1); Has 222145 Blast hits to 74171 proteins in 2066 species: Archae - 1478; Bacteria - 23379; Metazoa - 97811; Fungi - 22006; Plants - 7575; Viruses - 1468; Other Eukaryotes - 68428 (source: NCBI BLink). |
| AT5G40450.2 | ACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28770.1); Has 222145 Blast hits to 74171 proteins in 2066 species: Archae - 1478; Bacteria - 23379; Metazoa - 97811; Fungi - 22006; Plants - 7575; Viruses - 1468; Other Eukaryotes - 68428 (source: NCBI BLink). |
| AT5G43280 | AT5G43280.1 | AAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G43280.1 | CCAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G43280.2 | AAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G43280.2 | CCAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G45410 | AT5G45410.1 | CTAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45410.2 | CTAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45410.3 | CTAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45620 | AT5G45620.1 | CCAAACCGGAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45620.2 | CCAAACCGGAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G48240 | AT5G48240.1 | CTTAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). |
| AT5G48240.2 | CTTAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). |
| AT5G48240.3 | CTTAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). |
| AT5G48335 | AT5G48335.1 | TTTCCGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07580.1); Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G48550 | AT5G48550.1 | TTTCCGGTTC | F-box family protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: leaf whorl; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G47730.1); Has 160 Blast hits to 160 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G50380 | AT5G50380.1 | TTAAACCGGAAAATAACCGGT | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G51350 | AT5G51350.1 | TTAAACCGGAAA | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G61480.1); Has 68844 Blast hits to 28909 proteins in 838 species: Archae - 29; Bacteria - 3219; Metazoa - 20839; Fungi - 694; Plants - 39080; Viruses - 14; Other Eukaryotes - 4969 (source: NCBI BLink). |
| AT5G51740 | AT5G51740.1 | ACCGGAAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 4555 Blast hits to 4524 proteins in 759 species: Archae - 2; Bacteria - 2617; Metazoa - 54; Fungi - 111; Plants - 18; Viruses - 0; Other Eukaryotes - 1753 (source: NCBI BLink). |
| AT5G57240 | AT5G57240.1 | TTTCCGGT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4C (ORP4C); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4B (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B); oxysterol binding (TAIR:AT4G25850.1); Has 1659 Blast hits to 1658 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 914; Fungi - 432; Plants - 123; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT5G57240.2 | TTTCCGGT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4C (ORP4C); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4B (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B); oxysterol binding (TAIR:AT4G25850.1); Has 1659 Blast hits to 1658 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 914; Fungi - 432; Plants - 123; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | TTTCCGGT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | TTTCCGGT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G58040 | AT5G58040.1 | TTCGGTTTTCCGGT | Encodes a subunit of the polyadenylation apparatus that interacts with and stimulates the activity of poly(A) polymerase. Additionally , it interacts with several polyadenylation factor subunits and is an RNA-binding protein. It is suggested that this protein coordinates a number of polyadenylation factor subunits with PAP and with RNA. |
| AT5G58040.1 | TTTCCGGT | Encodes a subunit of the polyadenylation apparatus that interacts with and stimulates the activity of poly(A) polymerase. Additionally , it interacts with several polyadenylation factor subunits and is an RNA-binding protein. It is suggested that this protein coordinates a number of polyadenylation factor subunits with PAP and with RNA. |
| AT5G59440 | AT5G59440.1 | TGAACCGGAAA | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
| AT5G59440.2 | TGAACCGGAAA | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
| AT5G59440.3 | TGAACCGGAAA | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
| AT5G59600 | AT5G59600.1 | TTTCCGGTTCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2758 (embryo defective 2758) (TAIR:AT4G33990.1); Has 16346 Blast hits to 5424 proteins in 162 species: Archae - 0; Bacteria - 5; Metazoa - 170; Fungi - 149; Plants - 15583; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). |
| AT5G59610 | AT5G59610.1 | TGAACCGGAAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT4G39960.1); Has 16478 Blast hits to 16475 proteins in 1921 species: Archae - 123; Bacteria - 5355; Metazoa - 3420; Fungi - 1454; Plants - 1202; Viruses - 14; Other Eukaryotes - 4910 (source: NCBI BLink). |
| AT5G59610.2 | TGAACCGGAAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT4G39960.1); Has 16478 Blast hits to 16475 proteins in 1921 species: Archae - 123; Bacteria - 5355; Metazoa - 3420; Fungi - 1454; Plants - 1202; Viruses - 14; Other Eukaryotes - 4910 (source: NCBI BLink). |
| AT5G62560 | AT5G62560.1 | TTTCCGGTTTAA | armadillo/beta-catenin repeat family protein / U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein / U-box domain-containing protein (TAIR:AT3G47820.1); Has 2475 Blast hits to 1682 proteins in 159 species: Archae - 0; Bacteria - 12; Metazoa - 520; Fungi - 340; Plants - 1368; Viruses - 0; Other Eukaryotes - 235 (source: NCBI BLink). |
| AT5G66730 | AT5G66730.1 | TTTCCGGT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: AtIDD2 (Arabidopsis thaliana Indeterminate(ID)-Domain 2); nucleic acid binding / transcription factor/ zinc ion binding (TAIR:AT3G50700.1); Has 48818 Blast hits to 17866 proteins in 272 species: Archae - 0; Bacteria - 118; Metazoa - 44861; Fungi - 332; Plants - 434; Viruses - 0; Other Eukaryotes - 3073 (source: NCBI BLink). |
| AT5G67300 | AT5G67300.1 | CTTAACCGGTTTCCGGTTAT | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. |