version

Summary of AtREG645 (All List)

OrganismArabidopsis thaliana  
IDAtREG645  
SequenceCGGTTAAA  
Annotation  
PPDB MotifAACCG(G/A)  overlapping GT1 box  
PLACE MotifCNGTTR  Binding site for all animal MYB and at least two plant MYB proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis; ATMYB2 is involved in regulation of genes that are responsive to water stress in Arabidopsis; A petunia MYB protein (MYB.Ph3) is involved in regulation of flavonoid biosynthesis (Solano et al. EMBO J 14:1773 (1995)); See S000355;  
Total Entry Count274  

Entry Sequences (274 entries)

LocusGene modelSequenceDescription
AT1G01910AT1G01910.1TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT1G01910.2TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT1G01910.3TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT1G01910.4TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT1G01910.5TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT1G03890AT1G03890.1TTTCCGGTTAAAcupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf, seed; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: CRA1 (CRUCIFERINA); nutrient reservoir (TAIR:AT5G44120.3); Has 691 Blast hits to 656 proteins in 126 species: Archae - 0; Bacteria - 61; Metazoa - 2; Fungi - 0; Plants - 627; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G05010AT1G05010.1CGGTTAAAEncodes 1-aminocyclopropane-1-carboxylate oxidase 
AT1G05270AT1G05270.1ATCCGGTTAAATraB family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32340.1); Has 515 Blast hits to 497 proteins in 174 species: Archae - 89; Bacteria - 148; Metazoa - 111; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). 
AT1G08490AT1G08490.1TTTAACCGGTTTGChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. 
AT1G09190AT1G09190.1TTTAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: shoot apex, sperm cell, embryo, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G56310.1); Has 12606 Blast hits to 4809 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 33; Plants - 12368; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink). 
AT1G09932AT1G09932.1CGGTTAAAphosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT1G09932.2CGGTTAAAphosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT1G11320AT1G11320.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G12390AT1G12390.1TTTAACCGGAAAcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT1G12530AT1G12530.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56420.1); Has 29 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G13830AT1G13830.1CGGTTAAAbeta-1,3-glucanase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family protein 17 (TAIR:AT2G03505.1); Has 1380 Blast hits to 1160 proteins in 181 species: Archae - 6; Bacteria - 192; Metazoa - 167; Fungi - 74; Plants - 795; Viruses - 45; Other Eukaryotes - 101 (source: NCBI BLink). 
AT1G14400AT1G14400.1CCGGTTAAAubiquitin carrier protein 
AT1G14400.2CCGGTTAAAubiquitin carrier protein 
AT1G15370AT1G15370.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); Has 48 Blast hits to 48 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G17430AT1G17430.1TTTAACCGGAATTAACCGGAChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G72620.1); Has 3179 Blast hits to 3177 proteins in 659 species: Archae - 36; Bacteria - 2008; Metazoa - 134; Fungi - 8; Plants - 175; Viruses - 0; Other Eukaryotes - 818 (source: NCBI BLink). 
AT1G17490AT1G17490.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72690.1); Has 29 Blast hits to 23 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G19330AT1G19330.1TCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G19330.2TCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G19400AT1G19400.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75180.3); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G19400.2TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75180.3); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G19870AT1G19870.1TTTAACCGIQ-domain 32 (iqd32); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD31 (IQ-domain 31); calmodulin binding (TAIR:AT1G74690.1); Has 7574 Blast hits to 5259 proteins in 449 species: Archae - 14; Bacteria - 667; Metazoa - 3528; Fungi - 829; Plants - 616; Viruses - 32; Other Eukaryotes - 1888 (source: NCBI BLink). 
AT1G19990AT1G19990.1TTTAACCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). 
AT1G20220AT1G20220.1TTTAACCGGTTTAAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G76010.1); Has 42345 Blast hits to 16680 proteins in 1015 species: Archae - 19; Bacteria - 12355; Metazoa - 15425; Fungi - 3233; Plants - 4676; Viruses - 581; Other Eukaryotes - 6056 (source: NCBI BLink). 
AT1G21700AT1G21700.1TTGACTTTAACCGa member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). 
AT1G21710AT1G21710.1CGGTTAAAGTCAAEncodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. 
AT1G22310AT1G22310.1TTTAACCGGProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT1G22310.2TTTAACCGGProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT1G22960AT1G22960.1TTTAACCGpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink). 
AT1G22960.1TTTAACCGGTCpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink). 
AT1G24800AT1G24800.1TTTAACCGCONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25211.1); Has 745 Blast hits to 722 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G25211AT1G25211.1TTTAACCGCONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25055.1); Has 745 Blast hits to 722 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G25375AT1G25375.1ACGGTTTAACCGmetallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 3890 Blast hits to 3889 proteins in 863 species: Archae - 83; Bacteria - 2082; Metazoa - 121; Fungi - 86; Plants - 75; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink). 
AT1G25380AT1G25380.1CGGTTAAACCGTmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G47490.1); Has 21875 Blast hits to 10577 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10770; Fungi - 5942; Plants - 2991; Viruses - 5; Other Eukaryotes - 2167 (source: NCBI BLink). 
AT1G26180AT1G26180.1CCAAACCGGATTTTAACCGunknown protein; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 229 Blast hits to 229 proteins in 65 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT1G29240AT1G29240.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF688 (InterPro:IPR007789); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G34170.2); Has 42 Blast hits to 42 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G30540AT1G30540.1TTTAACCGATPase, BadF/BadG/BcrA/BcrD-type family; FUNCTIONS IN: ATPase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, BadF/BadG/BcrA/BcrD type (InterPro:IPR002731); Has 975 Blast hits to 975 proteins in 386 species: Archae - 31; Bacteria - 696; Metazoa - 107; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT1G31730AT1G31730.1AAAACCGGATTCCGGTTAAAepsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). 
AT1G33400AT1G33400.1ACCGGTTAAAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), SET (InterPro:IPR001214), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 5453 Blast hits to 4652 proteins in 333 species: Archae - 109; Bacteria - 690; Metazoa - 2585; Fungi - 539; Plants - 720; Viruses - 0; Other Eukaryotes - 810 (source: NCBI BLink). 
AT1G33780AT1G33780.1TTTAACCGAACCAAACCGunknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink). 
AT1G34120AT1G34120.1TTTAACCGCCGGTTCGEncodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2. 
AT1G34120.2TTTAACCGCCGGTTCGEncodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2. 
AT1G34120.3TTTAACCGCCGGTTCGEncodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2. 
AT1G51390AT1G51390.1TGGTTCGGTTAAATCCGGTTAAAEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. 
AT1G52870AT1G52870.1CGGTTAAAperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT1G52870.2CGGTTAAAperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT1G55630AT1G55630.1TTTAACCGpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G60050.1); Has 18827 Blast hits to 5565 proteins in 174 species: Archae - 4; Bacteria - 21; Metazoa - 383; Fungi - 322; Plants - 17397; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink). 
AT1G69330AT1G69330.1TTTAACCGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G69340AT1G69340.1CGGTTAAAappr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink). 
AT1G69460AT1G69460.1TTTAACCGemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). 
AT1G69490AT1G69490.1TTTAACCGEncodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. 
AT1G71430AT1G71430.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G72470AT1G72470.1CGGTTAAAA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. 
AT1G73090AT1G73090.1ACCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G73790AT1G73790.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09550.1); Has 149 Blast hits to 149 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 45; Fungi - 35; Plants - 40; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G74230AT1G74230.1TTTAACCGGGTCencodes a glycine-rich RNA binding protein. 
AT1G74380AT1G74380.1CGGTTAAAXYLOGLUCAN XYLOSYLTRANSFERASE 5 (XXT5); FUNCTIONS IN: xyloglucan 6-xylosyltransferase activity, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation, root hair elongation; LOCATED IN: Golgi apparatus, Golgi membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Galactosyl transferase (InterPro:IPR008630); BEST Arabidopsis thaliana protein match is: galactosyl transferase GMA12/MNN10 family protein (TAIR:AT5G07720.1); Has 301 Blast hits to 301 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 117; Plants - 172; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G75630AT1G75630.1TTTAACCGvacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, 
AT1G75780AT1G75780.1CGGTTAAAbeta tubulin gene downregulated by phytochrome A (phyA)-mediated far-red light high-irradiance and the phytochrome B (phyB)-mediated red light high-irradiance responses 
AT1G75800AT1G75800.1CGGTTAAApathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G20030.2); Has 1077 Blast hits to 1068 proteins in 152 species: Archae - 2; Bacteria - 22; Metazoa - 59; Fungi - 47; Plants - 930; Viruses - 4; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G79440AT1G79440.1CGGTTAAACTGCCACGTGGATEncodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). 
AT2G01320AT2G01320.1TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). 
AT2G01320.2TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). 
AT2G01320.3TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). 
AT2G01320.4TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). 
AT2G01520AT2G01520.1TTTAACCGMLP-LIKE PROTEIN 328 (MLP328); FUNCTIONS IN: copper ion binding; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP329 (MLP-LIKE PROTEIN 329); copper ion binding (TAIR:AT2G01530.1); Has 232 Blast hits to 210 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G03800AT2G03800.1TTTAACCGencodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. 
AT2G05220AT2G05220.1TTTCCGGTTAAA40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G05220.2TTTCCGGTTAAA40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G17130AT2G17130.1CGGTTAAANAD+ dependent isocitrate dehydrogenase subunit 2 (IDH2) 
AT2G17130.2CGGTTAAANAD+ dependent isocitrate dehydrogenase subunit 2 (IDH2) 
AT2G17510AT2G17510.1CTAAACCGGTTTTAACCGEMBRYO DEFECTIVE 2763 (EMB2763); FUNCTIONS IN: ribonuclease activity, RNA binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide binding protein, PINc (InterPro:IPR006596), Ribonuclease II and R (InterPro:IPR001900); BEST Arabidopsis thaliana protein match is: ribonuclease II family protein (TAIR:AT1G77680.1); Has 5395 Blast hits to 5320 proteins in 1284 species: Archae - 25; Bacteria - 2941; Metazoa - 370; Fungi - 272; Plants - 61; Viruses - 2; Other Eukaryotes - 1724 (source: NCBI BLink). 
AT2G17790AT2G17790.1CGGTTAAAVPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT2G20400AT2G20400.1CCGGTTTAACCGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 913 Blast hits to 906 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 900; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT2G20450AT2G20450.1TTTAACCGAACCA60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT2G21500AT2G21500.1TTTAACCGGTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G21500.2TTTAACCGGTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G22300AT2G22300.1TTTAACCGEncodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses. 
AT2G22300.2TTTAACCGEncodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses. 
AT2G24040AT2G24040.1CGGTTAAAhydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT4G28088.1); Has 526 Blast hits to 526 proteins in 160 species: Archae - 0; Bacteria - 141; Metazoa - 39; Fungi - 151; Plants - 185; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT2G26330AT2G26330.1CGGTTAAAHomologous to receptor protein kinases. Involved in specification of organs originating from the shoot apical meristem. Contains a cytoplasmic protein kinase catalytic domain, a transmembrane region, and an extracellular leucine-rich repeat. ER has been identified as a quantitative trait locus for transpiration efficiency by influencing epidermal and mesophyll development, stomatal density and porosity of leaves. It has been implicated in resistance to the bacterium Ralstonia solanacearum and to the necrotrophic fungus Plectosphaerella cucumerina. Together with ERL1 and ERL2, ER governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. 
AT2G27830AT2G27830.1ACCGGTTAAAFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G22760.1); Has 68 Blast hits to 68 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G28690AT2G28690.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1635 (InterPro:IPR012862); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59760.1); Has 49 Blast hits to 49 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G33855AT2G33855.1TTTAACCGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G36000AT2G36000.1ATAAACCGGTTAAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT2G36000.2ATAAACCGGTTAAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT2G40070AT2G40070.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1); Has 94255 Blast hits to 49644 proteins in 1573 species: Archae - 225; Bacteria - 11215; Metazoa - 37735; Fungi - 21320; Plants - 3339; Viruses - 2662; Other Eukaryotes - 17759 (source: NCBI BLink). 
AT2G40070.2TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1); Has 94255 Blast hits to 49644 proteins in 1573 species: Archae - 225; Bacteria - 11215; Metazoa - 37735; Fungi - 21320; Plants - 3339; Viruses - 2662; Other Eukaryotes - 17759 (source: NCBI BLink). 
AT2G40995AT2G40995.1TTTAACCGEncodes a defensin-like (DEFL) family protein. 
AT2G41600AT2G41600.1TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.2TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.3TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.4TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.5TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G44640AT2G44640.1CCGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G44640.1CGGTTAAAACCGGTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G45470AT2G45470.1TTTAACCGFASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8 (FLA8); LOCATED IN: anchored to plasma membrane, apoplast, plasma membrane, anchored to membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA10 (TAIR:AT3G60900.1); Has 13304 Blast hits to 6149 proteins in 712 species: Archae - 78; Bacteria - 4055; Metazoa - 1332; Fungi - 777; Plants - 1681; Viruses - 864; Other Eukaryotes - 4517 (source: NCBI BLink). 
AT2G45730AT2G45730.1TTTAACCGeukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT2G46260AT2G46260.1CCAAACCGGTTAAABTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink). 
AT2G46330AT2G46330.1TTTAACCGGTCEncodes arabinogalactan protein (AGP16). 
AT2G46330.2TTTAACCGGTCEncodes arabinogalactan protein (AGP16). 
AT2G46520AT2G46520.1AATAGCCCATTTAACCGACTTAcellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT3G01430AT3G01430.1CGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT5G14890.1); Has 48 Blast hits to 48 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G02190AT3G02190.1TTTCCGGTTAAA60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G02200AT3G02200.1TTTAACCGGAAAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT3G02200.2TTTAACCGGAAAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT3G04410AT3G04410.1CGGTTAAAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC004 (Arabidopsis NAC domain containing protein 4); transcription factor (TAIR:AT1G02230.1); Has 26 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G05020AT3G05020.1ATCCGGTTAAAencodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. 
AT3G05100AT3G05100.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 12 (InterPro:IPR013217); Has 53 Blast hits to 53 proteins in 21 species: Archae - 2; Bacteria - 27; Metazoa - 0; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT3G06240AT3G06240.1TTGAACCGTTTAACCGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G23880.1); Has 1173 Blast hits to 1161 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1171; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G06960AT3G06960.1TTTAACCGTTAGPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06960.2TTTAACCGTTAGPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G07170AT3G07170.1TTTAACCGCGTsterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G09210AT3G09210.1CCGGTTAAAPLASTID TRANSCRIPTIONALLY ACTIVE13 (PTAC13); FUNCTIONS IN: transcription elongation regulator activity; INVOLVED IN: positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), Translation protein SH3-like, subgroup (InterPro:IPR014722), KOW (InterPro:IPR005824); Has 2507 Blast hits to 2507 proteins in 692 species: Archae - 0; Bacteria - 1288; Metazoa - 0; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 1201 (source: NCBI BLink). 
AT3G09360AT3G09360.1CGGTTAAARNA polymerase II transcription factor/ protein binding / transcription activator/ transcription regulator/ translation initiation factor/ zinc ion binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: translational initiation, positive regulation of transcription, regulation of transcription, DNA-dependent, transcription initiation; LOCATED IN: transcription factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Brf1-like TBP-binding (InterPro:IPR011665), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: MEE65 (maternal effect embryo arrest 65); RNA polymerase II transcription factor/ cation:chloride symporter (TAIR:AT2G01280.1); Has 20399 Blast hits to 12051 proteins in 760 species: Archae - 341; Bacteria - 837; Metazoa - 8420; Fungi - 1909; Plants - 698; Viruses - 262; Other Eukaryotes - 7932 (source: NCBI BLink). 
AT3G09410AT3G09410.1TTCCGGTTAAApectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G09410.3TTCCGGTTAAApectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G10720AT3G10720.2CGGTTAAApectinesterase, putative; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase, putative (TAIR:AT5G04970.1); Has 3431 Blast hits to 1956 proteins in 277 species: Archae - 0; Bacteria - 297; Metazoa - 196; Fungi - 470; Plants - 1442; Viruses - 376; Other Eukaryotes - 650 (source: NCBI BLink). 
AT3G11100AT3G11100.1TTTAACCGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT5G05550.1); Has 522 Blast hits to 488 proteins in 92 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 65; Plants - 221; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). 
AT3G11330AT3G11330.1TTTAACCGleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT5G05850.1); Has 56721 Blast hits to 22652 proteins in 869 species: Archae - 19; Bacteria - 4682; Metazoa - 27023; Fungi - 1823; Plants - 19445; Viruses - 12; Other Eukaryotes - 3717 (source: NCBI BLink). 
AT3G11470AT3G11470.1ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G11470.2ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G11470.3ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G12650AT3G12650.1GAACCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G14330AT3G14330.1TTTAACCGGAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 13083 Blast hits to 5154 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 59; Fungi - 57; Plants - 12750; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink). 
AT3G15480AT3G15480.1CCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52910.1); Has 159 Blast hits to 159 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 159; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G17070AT3G17070.1CGGTTAAAperoxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G40150.1); Has 3116 Blast hits to 3101 proteins in 241 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 305; Plants - 2754; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). 
AT3G17790AT3G17790.1TTTAACCGPAP17; FUNCTIONS IN: phosphatase activity, protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: response to hydrogen peroxide, cellular phosphate ion homeostasis; LOCATED IN: cell surface; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 911 Blast hits to 906 proteins in 224 species: Archae - 2; Bacteria - 200; Metazoa - 324; Fungi - 6; Plants - 95; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink). 
AT3G17790.1TTTAACCGPAP17; FUNCTIONS IN: phosphatase activity, protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: response to hydrogen peroxide, cellular phosphate ion homeostasis; LOCATED IN: cell surface; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 911 Blast hits to 906 proteins in 224 species: Archae - 2; Bacteria - 200; Metazoa - 324; Fungi - 6; Plants - 95; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink). 
AT3G17860AT3G17860.1TTTAACCGACTJAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. 
AT3G18100AT3G18100.1TTTAACCGMember of the R2R3 transcription factor gene family. 
AT3G18160AT3G18160.1TGGTTCGGTTAAGTTCGGTTAAAperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). 
AT3G18160.2TGGTTCGGTTAAGTTCGGTTAAAperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). 
AT3G18160.3TGGTTCGGTTAAGTTCGGTTAAAperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). 
AT3G18190AT3G18190.1TTTAACCGchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink). 
AT3G19508AT3G19508.1TTTAACCGGTCunknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G19920AT3G19920.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64230.1); Has 113 Blast hits to 113 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G23450AT3G23450.1CGGTTAAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages. 
AT3G23930AT3G23930.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13540.1); Has 9839 Blast hits to 6470 proteins in 434 species: Archae - 58; Bacteria - 550; Metazoa - 4915; Fungi - 656; Plants - 186; Viruses - 86; Other Eukaryotes - 3388 (source: NCBI BLink). 
AT3G24490AT3G24490.1CGGTTAAAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae - 0; Bacteria - 71; Metazoa - 1163; Fungi - 123; Plants - 222; Viruses - 36; Other Eukaryotes - 873 (source: NCBI BLink). 
AT3G26170AT3G26170.1TTTAACCGputative cytochrome P450 
AT3G26240AT3G26240.1TTTAACCGGDC1 domain-containing protein; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT3G26250.1); Has 1177 Blast hits to 494 proteins in 22 species: Archae - 0; Bacteria - 6; Metazoa - 8; Fungi - 2; Plants - 1157; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G28715AT3G28715.1TTTAACCGGGTH+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28710.1); Has 448 Blast hits to 447 proteins in 191 species: Archae - 19; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G44890AT3G44890.1TTTAACCGTTAAAPlastid ribosomal protein CL9 
AT3G45630AT3G45630.1TTTAACCGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: protein binding, RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding / protein binding / zinc ion binding (TAIR:AT5G60170.1); Has 1885 Blast hits to 933 proteins in 202 species: Archae - 0; Bacteria - 444; Metazoa - 427; Fungi - 276; Plants - 89; Viruses - 2; Other Eukaryotes - 647 (source: NCBI BLink). 
AT3G46100AT3G46100.1TTTAACCGGAChistidyl-tRNA synthetase 
AT3G49260AT3G49260.1AACGGCGTTTAACCGAACCCCACGTGACIQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT3G49260.2AACGGCGTTTAACCGAACCCCACGTGACIQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT3G51440AT3G51440.1TTTAACCGstrictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). 
AT3G53470AT3G53470.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G53470.2TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G54560AT3G54560.1TTTAACCGEncodes HTA11, a histone H2A protein. 
AT3G54840AT3G54840.1CGGTTAAAEncodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome. 
AT3G54840.2CGGTTAAAEncodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome. 
AT3G57800AT3G57800.1ACCGGTTAAAGCCCAAAAGGCCCAAGbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G57800.2ACCGGTTAAAGCCCAAAAGGCCCAAGbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G61060AT3G61060.1CGGTTAAAArabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G61060.2CGGTTAAAArabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G61260AT3G61260.1TTTAACCGDNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink). 
AT3G61430AT3G61430.1CGGTTAAAa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. 
AT3G61430.2CGGTTAAAa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. 
AT3G62020AT3G62020.2CGGTTAAAgermin-like protein (GLP10) 
AT3G62907AT3G62907.1TTTAACCGunknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). 
AT4G00990AT4G00990.1TTTAACCGGTtranscription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT4G01810AT4G01810.1TTTAACCGprotein transport protein-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895); BEST Arabidopsis thaliana protein match is: transport protein, putative (TAIR:AT2G21630.1); Has 7526 Blast hits to 4938 proteins in 507 species: Archae - 16; Bacteria - 861; Metazoa - 2084; Fungi - 961; Plants - 2123; Viruses - 449; Other Eukaryotes - 1032 (source: NCBI BLink). 
AT4G03410AT4G03410.1TTTAACCGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G03410.2TTTAACCGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G05180AT4G05180.1TTTAACCGEncodes the PsbQ subunit of the oxygen evolving complex of photosystem II. 
AT4G08310AT4G08310.1TTTAACCGAACCCGACCCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink). 
AT4G10080AT4G10080.1TTTAACCGunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13530.1); Has 73 Blast hits to 67 proteins in 15 species: Archae - 2; Bacteria - 1; Metazoa - 0; Fungi - 12; Plants - 54; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G10610AT4G10610.1CGGTTAAARNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). 
AT4G10610.2CGGTTAAARNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). 
AT4G12720AT4G12720.1CGGTTAAAEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. 
AT4G12720.2CGGTTAAAEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. 
AT4G12720.3CGGTTAAAEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. 
AT4G14600AT4G14600.1ATCCAACGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G14600.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G17140AT4G17140.1ACCGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G48090.2). 
AT4G17140.2ACCGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G48090.2). 
AT4G18593AT4G18593.1GTCCGGTTAAACCGGdual specificity protein phosphatase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 272 Blast hits to 272 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 76; Plants - 42; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT4G21580AT4G21580.1CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink). 
AT4G21580.1CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink). 
AT4G21580.2CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink). 
AT4G21580.2CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink). 
AT4G21580.3CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink). 
AT4G21580.3CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink). 
AT4G21600AT4G21600.1CGGTTAAAEncodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). 
AT4G22350AT4G22350.1GGCCTTTTAACCGubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink). 
AT4G23670AT4G23670.1TTTAACCGmajor latex protein-related / MLP-related; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cadmium ion, response to salt stress, defense response to bacterium; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT4G23680.1); Has 228 Blast hits to 209 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 228; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G24830AT4G24830.1TTTAACCGGTTTarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). 
AT4G24830.2TTTAACCGGTTTarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). 
AT4G26970AT4G26970.1ATCCAACGGTTAAAaconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink). 
AT4G29120AT4G29120.1TTTAACCGAACCA6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, phosphogluconate dehydrogenase (decarboxylating) activity, binding, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 12459 Blast hits to 12442 proteins in 1308 species: Archae - 93; Bacteria - 6200; Metazoa - 393; Fungi - 342; Plants - 184; Viruses - 2; Other Eukaryotes - 5245 (source: NCBI BLink). 
AT4G29160AT4G29160.1TGGTTCGGTTAAASNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). 
AT4G29160.2TGGTTCGGTTAAASNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). 
AT4G29160.3TGGTTCGGTTAAASNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). 
AT4G29350AT4G29350.1TTTAACCGGATEncodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression. 
AT4G29810AT4G29810.1TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G29810.2TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G29810.3TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G30010AT4G30010.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31430AT4G31430.1TTTAACCGunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 1991 Blast hits to 609 proteins in 150 species: Archae - 0; Bacteria - 281; Metazoa - 325; Fungi - 191; Plants - 52; Viruses - 14; Other Eukaryotes - 1128 (source: NCBI BLink). 
AT4G31430.2TTTAACCGunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 1991 Blast hits to 609 proteins in 150 species: Archae - 0; Bacteria - 281; Metazoa - 325; Fungi - 191; Plants - 52; Viruses - 14; Other Eukaryotes - 1128 (source: NCBI BLink). 
AT4G31430.3TTTAACCGunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 1991 Blast hits to 609 proteins in 150 species: Archae - 0; Bacteria - 281; Metazoa - 325; Fungi - 191; Plants - 52; Viruses - 14; Other Eukaryotes - 1128 (source: NCBI BLink). 
AT4G32270AT4G32270.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 99 Blast hits to 97 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G32270.2CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 99 Blast hits to 97 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G32400AT4G32400.1CGGTTAAAEncodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. 
AT4G32915AT4G32915.1GACCGGTTAAAACCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). 
AT4G35550AT4G35550.1GCCGTTTAACCGEncodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. 
AT4G39550AT4G39550.1CGGTTAAAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae - 6; Bacteria - 90; Metazoa - 1470; Fungi - 6; Plants - 681; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink). 
AT5G01510AT5G01510.1ATAAACCGAATTTAACCGGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT5G03380AT5G03380.1CCGGTTAAAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). 
AT5G03380.2CCGGTTAAAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). 
AT5G08740AT5G08740.1TTTAACCGNAD(P)H dehydrogenase C1 (NDC1); FUNCTIONS IN: NADH dehydrogenase activity; LOCATED IN: intrinsic to mitochondrial inner membrane, cell wall, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027); BEST Arabidopsis thaliana protein match is: NDA2 (ALTERNATIVE NAD(P)H DEHYDROGENASE 2); FAD binding / NADH dehydrogenase/ oxidoreductase (TAIR:AT2G29990.1); Has 6169 Blast hits to 6166 proteins in 1233 species: Archae - 193; Bacteria - 4156; Metazoa - 270; Fungi - 344; Plants - 171; Viruses - 0; Other Eukaryotes - 1035 (source: NCBI BLink). 
AT5G10920AT5G10920.1GACCGGTTAAAargininosuccinate lyase, putative / arginosuccinase, putative; FUNCTIONS IN: argininosuccinate lyase activity, catalytic activity; INVOLVED IN: arginine biosynthetic process via ornithine, arginine biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Argininosuccinate lyase (InterPro:IPR009049), L-Aspartase-like (InterPro:IPR008948), Delta crystallin (InterPro:IPR003031), Fumarate lyase (InterPro:IPR000362); Has 10040 Blast hits to 10035 proteins in 1495 species: Archae - 255; Bacteria - 5320; Metazoa - 254; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 3997 (source: NCBI BLink). 
AT5G11440AT5G11440.1CCGGTTAAAInteracts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain. 
AT5G11450AT5G11450.1TTTAACCGGoxygen-evolving complex-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 81 Blast hits to 81 proteins in 22 species: Archae - 0; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G11850AT5G11850.1TTTAACCGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G73660.1); Has 91962 Blast hits to 90314 proteins in 3336 species: Archae - 43; Bacteria - 7366; Metazoa - 41562; Fungi - 7560; Plants - 19045; Viruses - 454; Other Eukaryotes - 15932 (source: NCBI BLink). 
AT5G11980AT5G11980.1CGGTTAAAconserved oligomeric Golgi complex component-related / COG complex component-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved oligomeric Golgi complex, COG8 (InterPro:IPR016632), Dor1-like protein (InterPro:IPR007255); Has 311 Blast hits to 311 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 82; Plants - 28; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT5G12230AT5G12230.1ACCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19480.2); Has 22700 Blast hits to 10061 proteins in 421 species: Archae - 37; Bacteria - 1646; Metazoa - 10568; Fungi - 2003; Plants - 1402; Viruses - 41; Other Eukaryotes - 7003 (source: NCBI BLink). 
AT5G14430AT5G14430.1TTTAACCGCGTdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14430.2TTTAACCGCGTdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14720AT5G14720.1CGGTTAAACCGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G79640.1); Has 89319 Blast hits to 87983 proteins in 2109 species: Archae - 58; Bacteria - 7891; Metazoa - 38520; Fungi - 7962; Plants - 17967; Viruses - 455; Other Eukaryotes - 16466 (source: NCBI BLink). 
AT5G15350AT5G15350.1AAAACGCGGTTAAAplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, vacuole, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G12880.1); Has 768 Blast hits to 760 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 768; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G16300AT5G16300.1TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.2TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G16300.3TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G17270AT5G17270.1TTTAACCGGTTCGtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). 
AT5G17710AT5G17710.1ATCCAACGGTTAAAembryo defective 1241 (EMB1241); FUNCTIONS IN: protein binding, adenyl-nucleotide exchange factor activity, chaperone binding, protein homodimerization activity; INVOLVED IN: embryonic development ending in seed dormancy, protein folding; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GrpE nucleotide exchange factor (InterPro:IPR000740), GrpE nucleotide exchange factor, coiled-coil (InterPro:IPR013805), GrpE nucleotide exchange factor, head (InterPro:IPR009012); BEST Arabidopsis thaliana protein match is: co-chaperone grpE family protein (TAIR:AT1G36390.2); Has 5868 Blast hits to 5837 proteins in 1527 species: Archae - 92; Bacteria - 2831; Metazoa - 204; Fungi - 113; Plants - 94; Viruses - 7; Other Eukaryotes - 2527 (source: NCBI BLink). 
AT5G17710.2ATCCAACGGTTAAAembryo defective 1241 (EMB1241); FUNCTIONS IN: protein binding, adenyl-nucleotide exchange factor activity, chaperone binding, protein homodimerization activity; INVOLVED IN: embryonic development ending in seed dormancy, protein folding; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GrpE nucleotide exchange factor (InterPro:IPR000740), GrpE nucleotide exchange factor, coiled-coil (InterPro:IPR013805), GrpE nucleotide exchange factor, head (InterPro:IPR009012); BEST Arabidopsis thaliana protein match is: co-chaperone grpE family protein (TAIR:AT1G36390.2); Has 5868 Blast hits to 5837 proteins in 1527 species: Archae - 92; Bacteria - 2831; Metazoa - 204; Fungi - 113; Plants - 94; Viruses - 7; Other Eukaryotes - 2527 (source: NCBI BLink). 
AT5G20140AT5G20140.1TTTAACCGSOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink). 
AT5G24360AT5G24360.1TTTAACCGATCCGGTTATINOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink). 
AT5G27270AT5G27270.1TTTAACCGEMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink). 
AT5G27270.1TTTAACCGGATEMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink). 
AT5G27440AT5G27440.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27440.1TTTCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27450AT5G27450.1CGGTTAAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27450.1TTTAACCGGAAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27450.2CGGTTAAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27450.2TTTAACCGGAAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27680AT5G27680.1GGTTCGGTTAAADNA helicase 
AT5G35730AT5G35730.1CGGTTAAAEXS family protein / ERD1/XPR1/SYG1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EXS, C-terminal (InterPro:IPR004342); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32295.1); Has 598 Blast hits to 593 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 179; Plants - 106; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). 
AT5G38110AT5G38110.1ACCGGTTAAAThis gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation. 
AT5G38420AT5G38420.1TTTAACCGribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 8 components; EXPRESSED IN: 10 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1722 Blast hits to 1701 proteins in 391 species: Archae - 0; Bacteria - 341; Metazoa - 0; Fungi - 0; Plants - 874; Viruses - 0; Other Eukaryotes - 507 (source: NCBI BLink). 
AT5G39320AT5G39320.1TTTAACCGUDP-glucose 6-dehydrogenase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucose/GDP-mannose dehydrogenase, N-terminal (InterPro:IPR001732), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), UDP-glucose/GDP-mannose dehydrogenase, dimerisation and substrate-binding (InterPro:IPR014028), UDP-glucose/GDP-mannose dehydrogenase, C-terminal (InterPro:IPR014027), NAD(P)-binding (InterPro:IPR016040), UDP-glucose/GDP-mannose dehydrogenase, dimerisation (InterPro:IPR014026), Nucleotide sugar dehydrogenase (InterPro:IPR017476); BEST Arabidopsis thaliana protein match is: UDP-glucose 6-dehydrogenase, putative (TAIR:AT3G29360.2); Has 10074 Blast hits to 10058 proteins in 1240 species: Archae - 198; Bacteria - 3918; Metazoa - 183; Fungi - 74; Plants - 117; Viruses - 14; Other Eukaryotes - 5570 (source: NCBI BLink). 
AT5G39570AT5G39570.1CCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G40190AT5G40190.1CGGTTAAAIdentified in a screen for calmodulin-binding proteins obtained from an auxin treated cDNA library. 
AT5G42380AT5G42380.1TTTAACCGCALMODULIN LIKE 37 (CML37); FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to ozone; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin-related protein, putative (TAIR:AT1G76640.1); Has 13184 Blast hits to 10239 proteins in 1127 species: Archae - 0; Bacteria - 39; Metazoa - 6469; Fungi - 2027; Plants - 2539; Viruses - 2; Other Eukaryotes - 2108 (source: NCBI BLink). 
AT5G42390AT5G42390.1ACCGGTTAAAmetalloendopeptidase; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT5G56730.1); Has 6181 Blast hits to 5988 proteins in 1271 species: Archae - 12; Bacteria - 4040; Metazoa - 465; Fungi - 284; Plants - 136; Viruses - 3; Other Eukaryotes - 1241 (source: NCBI BLink). 
AT5G46110AT5G46110.2CGGTTAAAmutant has Altered acclimation responses; Chloroplast Triose Phosphate Translocator 
AT5G50430AT5G50430.1ATCCGGTTAAAubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink). 
AT5G50430.2ATCCGGTTAAAubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink). 
AT5G50430.3ATCCGGTTAAAubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink). 
AT5G51510AT5G51510.1TGGTTCGGTTTAGTTCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G53490AT5G53490.1TTTAACCGthylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. 
AT5G53490.2TTTAACCGthylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. 
AT5G57950AT5G57950.1CCGGTTAAA26S proteasome regulatory subunit, putative; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: proteasome regulatory particle; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PDZ/DHR/GLGF (InterPro:IPR001478); Has 352 Blast hits to 352 proteins in 164 species: Archae - 0; Bacteria - 46; Metazoa - 112; Fungi - 85; Plants - 23; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT5G59380AT5G59380.1CGGTTAAAProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT5G59600AT5G59600.1TTTAACCGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2758 (embryo defective 2758) (TAIR:AT4G33990.1); Has 16346 Blast hits to 5424 proteins in 162 species: Archae - 0; Bacteria - 5; Metazoa - 170; Fungi - 149; Plants - 15583; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). 
AT5G59610AT5G59610.1CGGTTAAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT4G39960.1); Has 16478 Blast hits to 16475 proteins in 1921 species: Archae - 123; Bacteria - 5355; Metazoa - 3420; Fungi - 1454; Plants - 1202; Viruses - 14; Other Eukaryotes - 4910 (source: NCBI BLink). 
AT5G59610.2CGGTTAAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT4G39960.1); Has 16478 Blast hits to 16475 proteins in 1921 species: Archae - 123; Bacteria - 5355; Metazoa - 3420; Fungi - 1454; Plants - 1202; Viruses - 14; Other Eukaryotes - 4910 (source: NCBI BLink). 
AT5G62070AT5G62070.1TCAGGCCCATTGACTTTAACCGIQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 4; Plants - 406; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G62920AT5G62920.1CGGTTAAAEncodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. 
AT5G63000AT5G63000.1TTTAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G63860AT5G63860.1CGGTTAAAUV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. 
AT5G63910AT5G63910.1CGGTTAAAencodes for a farnesylcysteine lyase (EC 1.8.3.5 - prenylcysteine oxidase) involved in a salvage pathway of farnesyl diphosphate. 
AT5G64180AT5G64180.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 61 species: Archae - 0; Bacteria - 5; Metazoa - 125; Fungi - 11; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G64960AT5G64960.1TTTAACCGGTTTGEncodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. 
AT5G64960.2TTTAACCGGTTTGEncodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. 
AT5G65840AT5G65840.1CGGTTAAAACCCTAGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37240.1); Has 167 Blast hits to 165 proteins in 51 species: Archae - 0; Bacteria - 28; Metazoa - 51; Fungi - 13; Plants - 59; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.