| Locus | Gene model | Sequence | Description |
| AT1G01500 | AT1G01500.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G02990 | AT1G02990.1 | TAATTACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).  |
| AT1G02990.2 | TAATTACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).  |
| AT1G03560 | AT1G03560.1 | TAATTACG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 22539 Blast hits to 6065 proteins in 191 species: Archae - 3; Bacteria - 41; Metazoa - 565; Fungi - 536; Plants - 20393; Viruses - 0; Other Eukaryotes - 1001 (source: NCBI BLink).  |
| AT1G04920 | AT1G04920.1 | TTGCCACGTAATTA | Encodes a protein with putative sucrose-phosphate synthase activity.  |
| AT1G05900 | AT1G05900.1 | CGTAATTA | endonuclease-related; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, sequence-specific DNA binding, DNA binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), Endonuclease III, conserved site-2 (InterPro:IPR004036), Helix-hairpin-helix motif (InterPro:IPR000445), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: endonuclease-related (TAIR:AT2G31450.1); Has 9734 Blast hits to 9731 proteins in 1448 species: Archae - 228; Bacteria - 5250; Metazoa - 197; Fungi - 131; Plants - 86; Viruses - 0; Other Eukaryotes - 3842 (source: NCBI BLink).  |
| AT1G05900.2 | CGTAATTA | endonuclease-related; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, sequence-specific DNA binding, DNA binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), Endonuclease III, conserved site-2 (InterPro:IPR004036), Helix-hairpin-helix motif (InterPro:IPR000445), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: endonuclease-related (TAIR:AT2G31450.1); Has 9734 Blast hits to 9731 proteins in 1448 species: Archae - 228; Bacteria - 5250; Metazoa - 197; Fungi - 131; Plants - 86; Viruses - 0; Other Eukaryotes - 3842 (source: NCBI BLink).  |
| AT1G06890 | AT1G06890.1 | TAATTACG | transporter-related; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30460.2); Has 1730 Blast hits to 1725 proteins in 204 species: Archae - 2; Bacteria - 41; Metazoa - 571; Fungi - 289; Plants - 633; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).  |
| AT1G06890.2 | TAATTACG | transporter-related; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30460.2); Has 1730 Blast hits to 1725 proteins in 204 species: Archae - 2; Bacteria - 41; Metazoa - 571; Fungi - 289; Plants - 633; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).  |
| AT1G08180 | AT1G08180.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G02420.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G09330 | AT1G09330.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF846, eukaryotic (InterPro:IPR008564); Has 381 Blast hits to 381 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 100; Plants - 39; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink).  |
| AT1G09340 | AT1G09340.1 | TAATTACG | Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes.  |
| AT1G10500 | AT1G10500.1 | TAATTACG | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues.  |
| AT1G10690 | AT1G10690.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, leaf whorl, embryo; EXPRESSED DURING: E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G60783.1); Has 20 Blast hits to 20 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G11680 | AT1G11680.1 | CGTAATTA | putative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis.  |
| AT1G13150 | AT1G13150.1 | TAATTACG | member of CYP86C  |
| AT1G13210 | AT1G13210.1 | TAATTACG | autoinhibited Ca2+/ATPase II (ACA.l); FUNCTIONS IN: calmodulin binding, ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, phospholipid-translocating, flippase (InterPro:IPR006539), ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G25610.1); Has 8358 Blast hits to 7200 proteins in 893 species: Archae - 91; Bacteria - 1921; Metazoa - 2739; Fungi - 1382; Plants - 638; Viruses - 0; Other Eukaryotes - 1587 (source: NCBI BLink).  |
| AT1G13990 | AT1G13990.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages.  |
| AT1G13990.2 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages.  |
| AT1G13990.3 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages.  |
| AT1G14200 | AT1G14200.1 | CGTAATTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G26800.1); Has 6947 Blast hits to 6927 proteins in 223 species: Archae - 0; Bacteria - 6; Metazoa - 2376; Fungi - 551; Plants - 2760; Viruses - 56; Other Eukaryotes - 1198 (source: NCBI BLink).  |
| AT1G14620 | AT1G14620.1 | CGTAATTA | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT1G14620.2 | CGTAATTA | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT1G15370 | AT1G15370.1 | TAATTACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); Has 48 Blast hits to 48 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT1G15370.1 | TAATTACGAAAAGGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); Has 48 Blast hits to 48 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT1G15670 | AT1G15670.1 | CGTAATTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G80440.1); Has 847 Blast hits to 804 proteins in 93 species: Archae - 6; Bacteria - 58; Metazoa - 348; Fungi - 6; Plants - 389; Viruses - 2; Other Eukaryotes - 38 (source: NCBI BLink).  |
| AT1G17110 | AT1G17110.1 | TAATTACGTGTGA | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant.  |
| AT1G17820 | AT1G17820.1 | TAATTACG | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G73200.1); Has 444 Blast hits to 309 proteins in 108 species: Archae - 0; Bacteria - 7; Metazoa - 132; Fungi - 162; Plants - 27; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  |
| AT1G18470 | AT1G18470.1 | TAATTACG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73950.1); Has 2136 Blast hits to 2130 proteins in 191 species: Archae - 0; Bacteria - 0; Metazoa - 1341; Fungi - 16; Plants - 291; Viruses - 220; Other Eukaryotes - 268 (source: NCBI BLink).  |
| AT1G18470.2 | TAATTACG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73950.1); Has 2136 Blast hits to 2130 proteins in 191 species: Archae - 0; Bacteria - 0; Metazoa - 1341; Fungi - 16; Plants - 291; Viruses - 220; Other Eukaryotes - 268 (source: NCBI BLink).  |
| AT1G19110 | AT1G19110.1 | CGTAATTA | inter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
| AT1G19940 | AT1G19940.1 | CGTAATTACG | Arabidopsis thaliana Glycosyl Hydrolase 9B5 (AtGH9B5); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Six-hairpin glycosidase (InterPro:IPR012341), Glycoside hydrolase, family 9, active site (InterPro:IPR018221), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 9 (InterPro:IPR001701); BEST Arabidopsis thaliana protein match is: AtGH9B7 (Arabidopsis thaliana glycosyl hydrolase 9B7); catalytic/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G75680.1); Has 1148 Blast hits to 1144 proteins in 192 species: Archae - 0; Bacteria - 355; Metazoa - 133; Fungi - 14; Plants - 617; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
| AT1G20630 | AT1G20630.1 | CGTAATTA | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2.  |
| AT1G22160 | AT1G22160.1 | ATGACGTGTCGTAATTA | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT1G78020.1); Has 281 Blast hits to 281 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 281; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G23380 | AT1G23380.1 | CGTAATTA | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants.  |
| AT1G23380.2 | CGTAATTA | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants.  |
| AT1G29810 | AT1G29810.1 | TAATTACG | dehydratase family; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity, dihydroxy-acid dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: 4-alpha-hydroxytetrahydrobiopterin dehydratase (TAIR:AT5G51110.1); Has 3240 Blast hits to 3238 proteins in 657 species: Archae - 39; Bacteria - 1216; Metazoa - 166; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 1764 (source: NCBI BLink).  |
| AT1G29820 | AT1G29820.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29830.1); Has 257 Blast hits to 257 proteins in 116 species: Archae - 0; Bacteria - 201; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT1G29820.2 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29830.1); Has 257 Blast hits to 257 proteins in 116 species: Archae - 0; Bacteria - 201; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT1G30000 | AT1G30000.1 | CGTAATTA | glycoside hydrolase family 47 protein; FUNCTIONS IN: mannosyl-oligosaccharide 1,2-alpha-mannosidase activity, alpha-mannosidase activity, calcium ion binding; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 47 (InterPro:IPR001382); BEST Arabidopsis thaliana protein match is: mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative (TAIR:AT1G51590.1); Has 1507 Blast hits to 1364 proteins in 137 species: Archae - 0; Bacteria - 8; Metazoa - 700; Fungi - 557; Plants - 86; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  |
| AT1G31340 | AT1G31340.1 | TAATTACG | Encodes a ubiquitin-related protein that is conjugated to target proteins by neddylation. It has been shown to be conjugated to the cullin AtCUL1. The RUB-conjugation pathway has been implicated in in auxin response.  |
| AT1G31720 | AT1G31720.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, petal, inflorescence meristem, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19370.1); Has 80 Blast hits to 80 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G32340 | AT1G32340.1 | CGTAATTA | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not detected under normal conditions and in response to cucumber mosaic virus or spermine.  |
| AT1G33090 | AT1G33090.1 | TAATTACG | MATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G33110.1); Has 5585 Blast hits to 5544 proteins in 1058 species: Archae - 132; Bacteria - 3651; Metazoa - 119; Fungi - 206; Plants - 704; Viruses - 0; Other Eukaryotes - 773 (source: NCBI BLink).  |
| AT1G33102 | AT1G33102.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G34470 | AT1G34470.1 | CGTAATTA | permease-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09640.1); Has 872 Blast hits to 852 proteins in 149 species: Archae - 0; Bacteria - 54; Metazoa - 361; Fungi - 240; Plants - 145; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).  |
| AT1G47200 | AT1G47200.1 | CGTAATTA | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity.  |
| AT1G48300 | AT1G48300.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT1G48450 | AT1G48450.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G48450.2 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G48460 | AT1G48460.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G49670 | AT1G49670.1 | CGTAATTA | molecular function has not been defined. Was shown involved in oxidative stress tolerance.  |
| AT1G50050 | AT1G50050.1 | TAATTACGGTTTGG | pathogenesis-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Ves allergen (InterPro:IPR002413), Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: pathogenesis-related protein, putative (TAIR:AT1G50060.1); Has 1743 Blast hits to 1713 proteins in 242 species: Archae - 0; Bacteria - 47; Metazoa - 855; Fungi - 195; Plants - 614; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
| AT1G52040 | AT1G52040.1 | CGTAATTACACGTGTT | Encodes myrosinase-binding protein expressed in flowers.  |
| AT1G56580 | AT1G56580.1 | CGTAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09310.1); Has 167 Blast hits to 165 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 167; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G62020 | AT1G62020.1 | TAATTACG | coatomer protein complex, subunit alpha, putative; FUNCTIONS IN: protein binding, structural molecule activity, transporter activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPI vesicle coat, plasma membrane, CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Coatomer, WD associated region (InterPro:IPR006692), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat (InterPro:IPR001680), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Coatomer, alpha subunit (InterPro:IPR016391), Coatomer, alpha subunit, C-terminal (InterPro:IPR010714); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit alpha, putative (TAIR:AT2G21390.1); Has 57996 Blast hits to 22179 proteins in 591 species: Archae - 44; Bacteria - 5747; Metazoa - 27691; Fungi - 10853; Plants - 5420; Viruses - 0; Other Eukaryotes - 8241 (source: NCBI BLink).  |
| AT1G63855 | AT1G63855.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27400.1); Has 816 Blast hits to 814 proteins in 147 species: Archae - 0; Bacteria - 48; Metazoa - 472; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
| AT1G63855.2 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27400.1); Has 816 Blast hits to 814 proteins in 147 species: Archae - 0; Bacteria - 48; Metazoa - 472; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
| AT1G63855.3 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27400.1); Has 816 Blast hits to 814 proteins in 147 species: Archae - 0; Bacteria - 48; Metazoa - 472; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
| AT1G64405 | AT1G64405.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G66430 | AT1G66430.1 | TAATTACG | pfkB-type carbohydrate kinase family protein; FUNCTIONS IN: kinase activity, ribokinase activity; INVOLVED IN: D-ribose metabolic process, acetate fermentation, sucrose biosynthetic process, sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611), Ribokinase (InterPro:IPR002139), Carbohydrate/puine kinase, PfkB, conserved site (InterPro:IPR002173); BEST Arabidopsis thaliana protein match is: pfkB-type carbohydrate kinase family protein (TAIR:AT5G51830.1); Has 12534 Blast hits to 12532 proteins in 1345 species: Archae - 227; Bacteria - 7790; Metazoa - 198; Fungi - 118; Plants - 340; Viruses - 0; Other Eukaryotes - 3861 (source: NCBI BLink).  |
| AT1G68400 | AT1G68400.1 | TAATTACG | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G26730.1); Has 109181 Blast hits to 85983 proteins in 3222 species: Archae - 64; Bacteria - 9468; Metazoa - 37963; Fungi - 6180; Plants - 40805; Viruses - 358; Other Eukaryotes - 14343 (source: NCBI BLink).  |
| AT1G69295 | AT1G69295.1 | TAATTACG | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose.  |
| AT1G70090 | AT1G70090.1 | TAATTACG | Encodes a protein with putative galacturonosyltransferase activity.  |
| AT1G70090.2 | TAATTACG | Encodes a protein with putative galacturonosyltransferase activity.  |
| AT1G70210 | AT1G70210.1 | CGTAATTA | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination.  |
| AT1G71810 | AT1G71810.1 | CGTAATTA | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7549 Blast hits to 7535 proteins in 1105 species: Archae - 71; Bacteria - 2630; Metazoa - 356; Fungi - 312; Plants - 352; Viruses - 14; Other Eukaryotes - 3814 (source: NCBI BLink).  |
| AT1G76070 | AT1G76070.1 | TAATTACGGAAGCCCATCCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20310.1); Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G78510 | AT1G78510.1 | CGTAATTA | Encodes a protein with solanesyl diphosphate synthase activity.  |
| AT1G78510.2 | CGTAATTA | Encodes a protein with solanesyl diphosphate synthase activity.  |
| AT1G78660 | AT1G78660.1 | CGTAATTA | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.  |
| AT1G78660.2 | CGTAATTA | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.  |
| AT1G78660.3 | CGTAATTA | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.  |
| AT1G80600 | AT1G80600.1 | CGTAATTACG | Encodes HopW1-1-Interacting protein 1 (WIN1). Interacts with the P. syringae effector HopW1-1. WIN1 is a putative acetylornithine transaminase. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320).  |
| AT1G80750 | AT1G80750.1 | CGTAATTA | 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  |
| AT2G01290 | AT2G01290.1 | TAATTACG | ribose-5-phosphate isomerase; FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: glucose catabolic process to lactate and acetate, 5-phosphoribose 1-diphosphate biosynthetic process, reductive pentose-phosphate cycle, D-ribose catabolic process, pentose-phosphate shunt, non-oxidative branch; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribose 5-phosphate isomerase (InterPro:IPR004788); BEST Arabidopsis thaliana protein match is: RSW10 (RADIAL SWELLING 10); ribose-5-phosphate isomerase (TAIR:AT1G71100.1); Has 3193 Blast hits to 3193 proteins in 1122 species: Archae - 153; Bacteria - 1919; Metazoa - 91; Fungi - 101; Plants - 85; Viruses - 0; Other Eukaryotes - 844 (source: NCBI BLink).  |
| AT2G01640 | AT2G01640.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT2G02140 | AT2G02140.1 | GCCTTTAATTACG | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.  |
| AT2G02790 | AT2G02790.1 | CGTAATTA | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink).  |
| AT2G03120 | AT2G03120.1 | TGTCACGTAATTA | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant.  |
| AT2G04940 | AT2G04940.1 | CGTAATTACG | scramblase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Scramblase (InterPro:IPR005552); Has 321 Blast hits to 312 proteins in 92 species: Archae - 0; Bacteria - 10; Metazoa - 206; Fungi - 72; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT2G15910 | AT2G15910.1 | CGTAATTA | CSL zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, DPH-type (InterPro:IPR007872); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44150.1); Has 316 Blast hits to 314 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 93; Plants - 69; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
| AT2G21195 | AT2G21195.1 | AATAGGCCGGTTAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G21195.2 | AATAGGCCGGTTAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G21195.3 | AATAGGCCGGTTAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G22500 | AT2G22500.1 | TAATTACGTAATTA | UNCOUPLING PROTEIN 5 (UCP5); FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrion, mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial brown fat uncoupling protein (InterPro:IPR002030), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT4G24570.1); Has 18126 Blast hits to 9497 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 9042; Fungi - 4779; Plants - 2727; Viruses - 0; Other Eukaryotes - 1578 (source: NCBI BLink).  |
| AT2G23120 | AT2G23120.1 | AACCGCGTAATTAACGTGTCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G23630 | AT2G23630.1 | CGTAATTA | SKU5 Similar 16 (sks16); FUNCTIONS IN: pectinesterase activity, copper ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, hypocotyl, root; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: sks15 (SKU5 Similar 15); copper ion binding / oxidoreductase (TAIR:AT4G37160.1); Has 3666 Blast hits to 3642 proteins in 654 species: Archae - 2; Bacteria - 1007; Metazoa - 248; Fungi - 1479; Plants - 775; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
| AT2G24290 | AT2G24290.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30996.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT2G24290.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30996.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT2G26300 | AT2G26300.1 | CGTAATTA | Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling.  |
| AT2G29530 | AT2G29530.1 | CGTAATTA | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
| AT2G29530.2 | CGTAATTA | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
| AT2G29530.3 | CGTAATTA | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
| AT2G30590 | AT2G30590.1 | TAATTACGACCCGA | Encodes WRKY DNA-binding protein 21 (WRKY21).  |
| AT2G30700 | AT2G30700.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61900.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G31170 | AT2G31170.1 | CGTAATTA | SYCO ARATH; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT5G38830.1); Has 8663 Blast hits to 8413 proteins in 1630 species: Archae - 200; Bacteria - 3464; Metazoa - 434; Fungi - 181; Plants - 82; Viruses - 3; Other Eukaryotes - 4299 (source: NCBI BLink).  |
| AT2G32450 | AT2G32450.1 | CGTAATTA | calcium-binding EF hand family protein; FUNCTIONS IN: binding, zinc ion binding, calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), EF-HAND 2 (InterPro:IPR018249), Zinc finger, ZZ-type (InterPro:IPR000433), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G05150.1); Has 27398 Blast hits to 12741 proteins in 970 species: Archae - 1202; Bacteria - 12147; Metazoa - 3677; Fungi - 452; Plants - 511; Viruses - 0; Other Eukaryotes - 9409 (source: NCBI BLink).  |
| AT2G32510 | AT2G32510.1 | TAATTACG | member of MEKK subfamily  |
| AT2G36835 | AT2G36835.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G36880 | AT2G36880.1 | TAATTACG | methionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).  |
| AT2G36880.2 | TAATTACG | methionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).  |
| AT2G37660 | AT2G37660.1 | CGTAATTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae - 20; Bacteria - 1147; Metazoa - 3; Fungi - 23; Plants - 245; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink).  |
| AT2G37760 | AT2G37760.1 | TAATTACG | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).  |
| AT2G37760.2 | TAATTACG | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).  |
| AT2G37760.3 | TAATTACG | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).  |
| AT2G37760.4 | TAATTACG | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).  |
| AT2G37760.5 | TAATTACG | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).  |
| AT2G38480 | AT2G38480.1 | TAATTACG | integral membrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36330.1); Has 109 Blast hits to 109 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 109; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G39710 | AT2G39710.1 | CGTAATTA | Encodes a Cysteine-rich peptide (CRP) family protein  |
| AT2G39870 | AT2G39870.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55690.1); Has 42 Blast hits to 42 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G42590 | AT2G42590.1 | CCGCGTTAATTACG | 14-3-3 gene. Binds calcium and displays induced structural changes.  |
| AT2G42590.2 | CCGCGTTAATTACG | 14-3-3 gene. Binds calcium and displays induced structural changes.  |
| AT2G42590.3 | CCGCGTTAATTACG | 14-3-3 gene. Binds calcium and displays induced structural changes.  |
| AT2G42610 | AT2G42610.1 | CGTAATTA | LIGHT SENSITIVE HYPOCOTYLS 10 (LSH10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH6 (LIGHT SENSITIVE HYPOCOTYLS 6) (TAIR:AT1G07090.1); Has 183 Blast hits to 183 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G42610.2 | CGTAATTA | LIGHT SENSITIVE HYPOCOTYLS 10 (LSH10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH6 (LIGHT SENSITIVE HYPOCOTYLS 6) (TAIR:AT1G07090.1); Has 183 Blast hits to 183 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G43010 | AT2G43010.1 | CGTAATTA | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.  |
| AT2G43010.2 | CGTAATTA | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.  |
| AT2G45070 | AT2G45070.1 | TAATTACG | Sec61 Beta Subunit  |
| AT2G45070.2 | TAATTACG | Sec61 Beta Subunit  |
| AT2G45070.3 | TAATTACG | Sec61 Beta Subunit  |
| AT2G45070.4 | TAATTACG | Sec61 Beta Subunit  |
| AT2G46540 | AT2G46540.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G47110 | AT2G47110.1 | AGGGGTAATTACG | polyubiquitin gene  |
| AT2G47470 | AT2G47470.1 | AGCCACGTAATTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.  |
| AT2G47470.2 | AGCCACGTAATTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.  |
| AT2G47470.3 | AGCCACGTAATTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.  |
| AT2G47470.4 | AGCCACGTAATTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.  |
| AT2G47610 | AT2G47610.1 | TAATTACG | 60S ribosomal protein L7A (RPL7aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aB) (TAIR:AT3G62870.1); Has 1594 Blast hits to 1594 proteins in 293 species: Archae - 217; Bacteria - 0; Metazoa - 627; Fungi - 243; Plants - 175; Viruses - 0; Other Eukaryotes - 332 (source: NCBI BLink).  |
| AT3G01040 | AT3G01040.1 | TAATTACG | Encodes a protein with putative galacturonosyltransferase activity.  |
| AT3G01040.2 | TAATTACG | Encodes a protein with putative galacturonosyltransferase activity.  |
| AT3G01500 | AT3G01500.1 | TAATTACG | CARBONIC ANHYDRASE 1 (CA1); FUNCTIONS IN: carbonate dehydratase activity, zinc ion binding; INVOLVED IN: response to cold, defense response to bacterium, carbon utilization; LOCATED IN: in 8 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Carbonic anhydrase, prokaryotic-like, conserved site (InterPro:IPR015892), Carbonic anhydrase (InterPro:IPR001765); BEST Arabidopsis thaliana protein match is: CA2 (CARBONIC ANHYDRASE 2); carbonate dehydratase/ zinc ion binding (TAIR:AT5G14740.2); Has 3258 Blast hits to 3244 proteins in 952 species: Archae - 20; Bacteria - 2328; Metazoa - 48; Fungi - 143; Plants - 233; Viruses - 0; Other Eukaryotes - 486 (source: NCBI BLink).  |
| AT3G01961 | AT3G01961.1 | TAATTACG | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
| AT3G02290 | AT3G02290.1 | CGTAATTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G15790.2); Has 4111 Blast hits to 4103 proteins in 198 species: Archae - 0; Bacteria - 2; Metazoa - 1589; Fungi - 258; Plants - 1425; Viruses - 17; Other Eukaryotes - 820 (source: NCBI BLink).  |
| AT3G02290.2 | CGTAATTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G15790.2); Has 4111 Blast hits to 4103 proteins in 198 species: Archae - 0; Bacteria - 2; Metazoa - 1589; Fungi - 258; Plants - 1425; Viruses - 17; Other Eukaryotes - 820 (source: NCBI BLink).  |
| AT3G02630 | AT3G02630.1 | CGTAATTA | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
| AT3G04040 | AT3G04040.1 | TAATTACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G05727 | AT3G05727.1 | CGTAATTA | Encodes a defensin-like (DEFL) family protein.  |
| AT3G06110 | AT3G06110.1 | TAATTACG | Encodes a nuclear-localized MAP kinase phosphatase. Plants with reduced levels of MKP2 transcripts are hypersensitive to ozone and ozone-mediated activation of MPK3 and MPK6 is prolonged in these plants.  |
| AT3G06110.2 | TAATTACG | Encodes a nuclear-localized MAP kinase phosphatase. Plants with reduced levels of MKP2 transcripts are hypersensitive to ozone and ozone-mediated activation of MPK3 and MPK6 is prolonged in these plants.  |
| AT3G07410 | AT3G07410.1 | CGTAATTA | Arabidopsis Rab GTPase homolog A5b (AtRABA5b); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ARA4; GTP binding / GTPase/ protein binding (TAIR:AT2G43130.1); Has 22386 Blast hits to 22351 proteins in 619 species: Archae - 15; Bacteria - 99; Metazoa - 12578; Fungi - 2607; Plants - 2049; Viruses - 19; Other Eukaryotes - 5019 (source: NCBI BLink).  |
| AT3G07540 | AT3G07540.1 | CGTAATTA | formin homology 2 domain-containing protein / FH2 domain-containing protein; FUNCTIONS IN: actin binding; INVOLVED IN: cellular component organization, actin cytoskeleton organization; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 and DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: formin homology 2 domain-containing protein / FH2 domain-containing protein (TAIR:AT5G48360.1); Has 3523 Blast hits to 2955 proteins in 263 species: Archae - 0; Bacteria - 116; Metazoa - 1604; Fungi - 302; Plants - 670; Viruses - 102; Other Eukaryotes - 729 (source: NCBI BLink).  |
| AT3G07880 | AT3G07880.1 | CGTAATTA | Rho GDP-dissociation inhibitor family protein; FUNCTIONS IN: Rho GDP-dissociation inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin E-set (InterPro:IPR014756), RHO protein GDP dissociation inhibitor (InterPro:IPR000406); BEST Arabidopsis thaliana protein match is: Rho GDP-dissociation inhibitor family protein (TAIR:AT1G62450.1); Has 499 Blast hits to 499 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 285; Fungi - 107; Plants - 63; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).  |
| AT3G09560 | AT3G09560.1 | TAATTACG | lipin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: LNS2, Lipin/Ned1/Smp2 (InterPro:IPR013209), Lipin, N-terminal conserved region (InterPro:IPR007651); BEST Arabidopsis thaliana protein match is: lipin family protein (TAIR:AT5G42870.1); Has 4533 Blast hits to 2669 proteins in 322 species: Archae - 14; Bacteria - 1642; Metazoa - 1233; Fungi - 542; Plants - 130; Viruses - 16; Other Eukaryotes - 956 (source: NCBI BLink).  |
| AT3G09560.2 | TAATTACG | lipin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: LNS2, Lipin/Ned1/Smp2 (InterPro:IPR013209), Lipin, N-terminal conserved region (InterPro:IPR007651); BEST Arabidopsis thaliana protein match is: lipin family protein (TAIR:AT5G42870.1); Has 4533 Blast hits to 2669 proteins in 322 species: Archae - 14; Bacteria - 1642; Metazoa - 1233; Fungi - 542; Plants - 130; Viruses - 16; Other Eukaryotes - 956 (source: NCBI BLink).  |
| AT3G09560.3 | TAATTACG | lipin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: LNS2, Lipin/Ned1/Smp2 (InterPro:IPR013209), Lipin, N-terminal conserved region (InterPro:IPR007651); BEST Arabidopsis thaliana protein match is: lipin family protein (TAIR:AT5G42870.1); Has 4533 Blast hits to 2669 proteins in 322 species: Archae - 14; Bacteria - 1642; Metazoa - 1233; Fungi - 542; Plants - 130; Viruses - 16; Other Eukaryotes - 956 (source: NCBI BLink).  |
| AT3G09770 | AT3G09770.1 | CGTAATTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G03200.1); Has 8637 Blast hits to 5803 proteins in 428 species: Archae - 8; Bacteria - 389; Metazoa - 3031; Fungi - 915; Plants - 2765; Viruses - 462; Other Eukaryotes - 1067 (source: NCBI BLink).  |
| AT3G09770.2 | CGTAATTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G03200.1); Has 8637 Blast hits to 5803 proteins in 428 species: Archae - 8; Bacteria - 389; Metazoa - 3031; Fungi - 915; Plants - 2765; Viruses - 462; Other Eukaryotes - 1067 (source: NCBI BLink).  |
| AT3G11220 | AT3G11220.1 | TAATTACG | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.  |
| AT3G11220.2 | TAATTACG | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.  |
| AT3G11410 | AT3G11410.1 | GCCCGTTAATTACG | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA.  |
| AT3G11780 | AT3G11780.1 | TAATTACG | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin E-set (InterPro:IPR014756), MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G06480.1); Has 141 Blast hits to 141 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 76; Plants - 53; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT3G11910 | AT3G11910.1 | CGTAATTA | UBIQUITIN-SPECIFIC PROTEASE 13 (UBP13); FUNCTIONS IN: ubiquitin-specific protease activity, ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (InterPro:IPR018200), MATH (InterPro:IPR002083), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: UBP12 (UBIQUITIN-SPECIFIC PROTEASE 12); ubiquitin thiolesterase/ ubiquitin-specific protease (TAIR:AT5G06600.1); Has 5914 Blast hits to 5327 proteins in 200 species: Archae - 0; Bacteria - 15; Metazoa - 3076; Fungi - 783; Plants - 832; Viruses - 7; Other Eukaryotes - 1201 (source: NCBI BLink).  |
| AT3G12260 | AT3G12260.1 | TAACCGGAAATAATTACG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
| AT3G12800 | AT3G12800.1 | CGTAATTA | SHORT-CHAIN DEHYDROGENASE-REDUCTASE B (SDRB); FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: D2,D4-dienoyl-CoA reductase-related (TAIR:AT2G07640.1); Has 72870 Blast hits to 72725 proteins in 2181 species: Archae - 462; Bacteria - 41132; Metazoa - 3880; Fungi - 3552; Plants - 1537; Viruses - 2; Other Eukaryotes - 22305 (source: NCBI BLink).  |
| AT3G14172 | AT3G14172.1 | CGTAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink).  |
| AT3G14240 | AT3G14240.1 | CGTAATTA | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: SLP2; serine-type peptidase (TAIR:AT4G34980.1); Has 5240 Blast hits to 4507 proteins in 782 species: Archae - 159; Bacteria - 2860; Metazoa - 145; Fungi - 483; Plants - 911; Viruses - 0; Other Eukaryotes - 682 (source: NCBI BLink).  |
| AT3G14770 | AT3G14770.1 | CGTAATTA | nodulin MtN3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MtN3 and saliva related transmembrane protein, conserved region (InterPro:IPR018169), RAG1-activating protein 1 homologue (InterPro:IPR018179), MtN3 and saliva related transmembrane protein (InterPro:IPR004316); BEST Arabidopsis thaliana protein match is: nodulin MtN3 family protein (TAIR:AT1G21460.1); Has 523 Blast hits to 517 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 184; Fungi - 0; Plants - 290; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
| AT3G15510 | AT3G15510.1 | TAATTACG | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2.  |
| AT3G16570 | AT3G16570.1 | CGTAATTA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.  |
| AT3G16990 | AT3G16990.1 | GTGCCACGTAATTA | TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
| AT3G17000 | AT3G17000.1 | TAATTACGTGGCAC | ubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink).  |
| AT3G17820 | AT3G17820.1 | CGTAATTA | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium  |
| AT3G18440 | AT3G18440.1 | CGTAATTA | Belongs to the aluminum-activated malate transporter family. Encodes a vacuolar malate channel. Expressed in all parts of plants. Almost exclusively expressed in mesophyll cells of leaves.  |
| AT3G18850 | AT3G18850.1 | CGTAATTA | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  |
| AT3G18850.2 | CGTAATTA | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  |
| AT3G18850.3 | CGTAATTA | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  |
| AT3G18850.4 | CGTAATTA | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  |
| AT3G18850.5 | CGTAATTA | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  |
| AT3G18860 | AT3G18860.1 | TAATTACG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink).  |
| AT3G18860.2 | TAATTACG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink).  |
| AT3G21690 | AT3G21690.1 | TAATTACG | MATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G61890.1); Has 6111 Blast hits to 6057 proteins in 1118 species: Archae - 150; Bacteria - 4001; Metazoa - 121; Fungi - 210; Plants - 709; Viruses - 0; Other Eukaryotes - 920 (source: NCBI BLink).  |
| AT3G27050 | AT3G27050.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT3G27300 | AT3G27300.1 | CGTAATTA | glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  |
| AT3G27300.2 | CGTAATTA | glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  |
| AT3G27300.3 | CGTAATTA | glucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).  |
| AT3G44890 | AT3G44890.1 | TAATTACGGGGTCAAA | Plastid ribosomal protein CL9  |
| AT3G45730 | AT3G45730.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G45740 | AT3G45740.1 | TAATTACG | hydrolase family protein / HAD-superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIA, CECR5 (InterPro:IPR006353), HAD-superfamily hydrolase, subfamily IIA (InterPro:IPR006357); Has 367 Blast hits to 355 proteins in 105 species: Archae - 5; Bacteria - 2; Metazoa - 102; Fungi - 197; Plants - 14; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT3G47730 | AT3G47730.1 | CGTAATTA | member of ATH subfamily  |
| AT3G48930 | AT3G48930.1 | CTAAGGCCCGTAATTAAAGGCCCAATAA | embryo defective 1080 (EMB1080); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: RPS11-BETA (RIBOSOMAL PROTEIN S11-BETA); structural constituent of ribosome (TAIR:AT5G23740.1); Has 956 Blast hits to 954 proteins in 334 species: Archae - 160; Bacteria - 168; Metazoa - 241; Fungi - 98; Plants - 94; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).  |
| AT3G52920 | AT3G52920.1 | ACGACACGTAATTA | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36410.1); Has 2316 Blast hits to 1969 proteins in 271 species: Archae - 54; Bacteria - 179; Metazoa - 1055; Fungi - 129; Plants - 121; Viruses - 9; Other Eukaryotes - 769 (source: NCBI BLink).  |
| AT3G52920.2 | ACGACACGTAATTA | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36410.1); Has 2316 Blast hits to 1969 proteins in 271 species: Archae - 54; Bacteria - 179; Metazoa - 1055; Fungi - 129; Plants - 121; Viruses - 9; Other Eukaryotes - 769 (source: NCBI BLink).  |
| AT3G53140 | AT3G53140.1 | TAATTACG | O-diphenol-O-methyl transferase, putative; FUNCTIONS IN: methyltransferase activity, protein dimerization activity, O-methyltransferase activity; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: ATOMT1 (O-METHYLTRANSFERASE 1); caffeate O-methyltransferase/ myricetin 3'-O-methyltransferase/ quercetin 3-O-methyltransferase (TAIR:AT5G54160.1); Has 1925 Blast hits to 1921 proteins in 388 species: Archae - 0; Bacteria - 516; Metazoa - 73; Fungi - 340; Plants - 919; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
| AT3G53960 | AT3G53960.1 | CGTAATTA | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT2G37900.1); Has 3547 Blast hits to 3464 proteins in 645 species: Archae - 0; Bacteria - 1265; Metazoa - 445; Fungi - 278; Plants - 1143; Viruses - 0; Other Eukaryotes - 416 (source: NCBI BLink).  |
| AT3G54260 | AT3G54260.1 | CGTAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42570.1); Has 731 Blast hits to 699 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 730; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G54960 | AT3G54960.1 | TAATTACG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.  |
| AT3G54960.2 | TAATTACG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.  |
| AT3G56460 | AT3G56460.1 | TAATTACG | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 27533 Blast hits to 27426 proteins in 1649 species: Archae - 279; Bacteria - 14496; Metazoa - 1760; Fungi - 2501; Plants - 878; Viruses - 3; Other Eukaryotes - 7616 (source: NCBI BLink).  |
| AT3G56590 | AT3G56590.1 | CGTAATTA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G10810.1); Has 14277 Blast hits to 9531 proteins in 665 species: Archae - 26; Bacteria - 1625; Metazoa - 4928; Fungi - 2262; Plants - 3165; Viruses - 515; Other Eukaryotes - 1756 (source: NCBI BLink).  |
| AT3G56590.2 | CGTAATTA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G10810.1); Has 14277 Blast hits to 9531 proteins in 665 species: Archae - 26; Bacteria - 1625; Metazoa - 4928; Fungi - 2262; Plants - 3165; Viruses - 515; Other Eukaryotes - 1756 (source: NCBI BLink).  |
| AT3G58990 | AT3G58990.1 | CGTAATTA | aconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: leucine biosynthetic process, metabolic process; LOCATED IN: 3-isopropylmalate dehydratase complex, chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT2G43090.1); Has 6188 Blast hits to 6188 proteins in 1286 species: Archae - 227; Bacteria - 3055; Metazoa - 1; Fungi - 250; Plants - 45; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink).  |
| AT3G62790 | AT3G62790.1 | CGTAATTA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 85 Blast hits to 85 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT3G66658 | AT3G66658.1 | CGTAATTA | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures.  |
| AT3G66658.2 | CGTAATTA | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures.  |
| AT4G01550 | AT4G01550.1 | CGTAATTACG | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G01550.1 | TAATTACG | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G01550.2 | CGTAATTACG | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G01550.2 | TAATTACG | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G01720 | AT4G01720.1 | CGTAATTA | member of WRKY Transcription Factor; Group II-b  |
| AT4G01790 | AT4G01790.1 | TAATTACG | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein / ribonuclease P-related; FUNCTIONS IN: ribonuclease P activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); Has 68 Blast hits to 68 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT4G01800 | AT4G01800.1 | CGTAATTA | preprotein translocase secA subunit, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein import; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecA Wing and Scaffold (InterPro:IPR011116), SecA preprotein cross-linking region (InterPro:IPR011130), SecA DEAD-like (InterPro:IPR011115), SecA motor DEAD (InterPro:IPR014018), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: ATP binding / protein binding (TAIR:AT1G21650.1); Has 15109 Blast hits to 10309 proteins in 1586 species: Archae - 2; Bacteria - 6696; Metazoa - 44; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 8307 (source: NCBI BLink).  |
| AT4G01970 | AT4G01970.1 | TAATTACG | Encodes a putative stachyose synthetase.  |
| AT4G02660 | AT4G02660.1 | TAATTACG | WD-40 repeat family protein / beige-related; FUNCTIONS IN: binding; INVOLVED IN: signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Beige/BEACH (InterPro:IPR000409), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / beige-related (TAIR:AT1G03060.1); Has 5849 Blast hits to 4353 proteins in 269 species: Archae - 8; Bacteria - 956; Metazoa - 2990; Fungi - 677; Plants - 315; Viruses - 0; Other Eukaryotes - 903 (source: NCBI BLink).  |
| AT4G10080 | AT4G10080.1 | CGTAATTA | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13530.1); Has 73 Blast hits to 67 proteins in 15 species: Archae - 2; Bacteria - 1; Metazoa - 0; Fungi - 12; Plants - 54; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G10300 | AT4G10300.1 | CGTAATTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 356 Blast hits to 356 proteins in 93 species: Archae - 0; Bacteria - 181; Metazoa - 0; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
| AT4G10840 | AT4G10840.1 | TAATTACG | kinesin light chain-related; FUNCTIONS IN: binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: kinesin light chain-related (TAIR:AT3G27960.1); Has 11121 Blast hits to 4321 proteins in 387 species: Archae - 236; Bacteria - 3062; Metazoa - 5775; Fungi - 596; Plants - 190; Viruses - 6; Other Eukaryotes - 1256 (source: NCBI BLink).  |
| AT4G10840.2 | TAATTACG | kinesin light chain-related; FUNCTIONS IN: binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: kinesin light chain-related (TAIR:AT3G27960.1); Has 11121 Blast hits to 4321 proteins in 387 species: Archae - 236; Bacteria - 3062; Metazoa - 5775; Fungi - 596; Plants - 190; Viruses - 6; Other Eukaryotes - 1256 (source: NCBI BLink).  |
| AT4G10960 | AT4G10960.1 | CGTAATTA | Encodes a protein with UDP-D-glucose 4-epimerase activity.  |
| AT4G11570 | AT4G11570.1 | TAATTACG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
| AT4G11570.2 | TAATTACG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
| AT4G13030 | AT4G13030.1 | TAATTACG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage; Has 48 Blast hits to 48 proteins in 22 species: Archae - 0; Bacteria - 20; Metazoa - 11; Fungi - 2; Plants - 14; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT4G13030.2 | TAATTACG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage; Has 48 Blast hits to 48 proteins in 22 species: Archae - 0; Bacteria - 20; Metazoa - 11; Fungi - 2; Plants - 14; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT4G13710 | AT4G13710.1 | TAATTACG | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT1G04680.1); Has 881 Blast hits to 876 proteins in 159 species: Archae - 0; Bacteria - 369; Metazoa - 0; Fungi - 103; Plants - 403; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT4G14020 | AT4G14020.1 | TAATTACG | rapid alkalinization factor (RALF) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Rapid ALkalinization Factor (InterPro:IPR008801); Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G14440 | AT4G14440.1 | TAATTACG | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation  |
| AT4G14880 | AT4G14880.1 | CGTAATTA | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.  |
| AT4G14880.2 | CGTAATTA | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.  |
| AT4G14890 | AT4G14890.1 | TAATTACG | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink).  |
| AT4G15450 | AT4G15450.1 | CGTAATTA | CONTAINS InterPro DOMAIN/s: Senescence-associated (InterPro:IPR009686); BEST Arabidopsis thaliana protein match is: senescence/dehydration-associated protein-related (TAIR:AT3G21600.1); Has 81 Blast hits to 81 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT4G15900 | AT4G15900.1 | CGTAATTA | Mutations confer hypersensitivity to glucose and sucrose and augments sensitivity to cytokinin, ethylene, ABA and auxin. Encodes a nuclear WD40 protein that is imported into the nucleus. Essential for plant innate immunity. Interacts with MOS4 and AtCDC5. It is also predicted to have two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase, and may affect the stability of AKIN10.  |
| AT4G18710 | AT4G18710.1 | CGTAATTA | ATSK (shaggy-like kinase) family member that encodes an AtSK protein involved in the cross-talk between auxin and brassinosteroid signaling pathways. BR-INSENSITIVE 2 mutant indicated that the BR-insensitive dwarf phenotype was due to a semidominant mutation in the BIN2. BIN2 is not allelic to BRI1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus.  |
| AT4G18760 | AT4G18760.1 | CGTAATTA | Receptor Like Protein 51 (AtRLP51); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP55 (Receptor Like Protein 55); protein binding (TAIR:AT5G45770.1); Has 49381 Blast hits to 18169 proteins in 775 species: Archae - 21; Bacteria - 2325; Metazoa - 12582; Fungi - 717; Plants - 30648; Viruses - 12; Other Eukaryotes - 3076 (source: NCBI BLink).  |
| AT4G20260 | AT4G20260.1 | CGTAATTA | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.  |
| AT4G20260.2 | CGTAATTA | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.  |
| AT4G20260.3 | CGTAATTA | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.  |
| AT4G20260.4 | CGTAATTA | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.  |
| AT4G22010 | AT4G22010.1 | TAATTACG | SKU5 Similar 4 (sks4); FUNCTIONS IN: oxidoreductase activity, copper ion binding; LOCATED IN: membrane, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: sks5 (SKU5 Similar 5); copper ion binding / oxidoreductase (TAIR:AT1G76160.1); Has 3691 Blast hits to 3663 proteins in 668 species: Archae - 2; Bacteria - 955; Metazoa - 261; Fungi - 1515; Plants - 831; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
| AT4G23493 | AT4G23493.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 5 Blast hits to 5 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G24972 | AT4G24972.1 | TAATTACG | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1.  |
| AT4G26130 | AT4G26130.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56980.1); Has 73 Blast hits to 72 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G27410 | AT4G27410.1 | CGTAATTA | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.  |
| AT4G27410.2 | CGTAATTA | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.  |
| AT4G27410.3 | CGTAATTA | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.  |
| AT4G28420 | AT4G28420.1 | CGTAATTA | aminotransferase, putative; FUNCTIONS IN: 1-aminocyclopropane-1-carboxylate synthase activity, transferase activity, transferring nitrogenous groups, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: cellular amino acid and derivative metabolic process, biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176), Aminotransferase, class I and II (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Tyrosine/nicotianamine aminotransferase (InterPro:IPR005958), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: SUR1 (SUPERROOT 1); S-alkylthiohydroximate lyase/ carbon-sulfur lyase/ transaminase (TAIR:AT2G20610.1); Has 26121 Blast hits to 26117 proteins in 1754 species: Archae - 656; Bacteria - 15811; Metazoa - 648; Fungi - 515; Plants - 893; Viruses - 0; Other Eukaryotes - 7598 (source: NCBI BLink).  |
| AT4G28420.2 | CGTAATTA | aminotransferase, putative; FUNCTIONS IN: 1-aminocyclopropane-1-carboxylate synthase activity, transferase activity, transferring nitrogenous groups, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: cellular amino acid and derivative metabolic process, biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176), Aminotransferase, class I and II (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Tyrosine/nicotianamine aminotransferase (InterPro:IPR005958), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: SUR1 (SUPERROOT 1); S-alkylthiohydroximate lyase/ carbon-sulfur lyase/ transaminase (TAIR:AT2G20610.1); Has 26121 Blast hits to 26117 proteins in 1754 species: Archae - 656; Bacteria - 15811; Metazoa - 648; Fungi - 515; Plants - 893; Viruses - 0; Other Eukaryotes - 7598 (source: NCBI BLink).  |
| AT4G29080 | AT4G29080.1 | TAATTACGGTTTAT | phytochrome-associated protein 2 (PAP2)  |
| AT4G30210 | AT4G30210.1 | CGTAATTA | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway.  |
| AT4G30210.2 | CGTAATTA | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway.  |
| AT4G30500 | AT4G30500.1 | CGTAATTACGACACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
| AT4G31490 | AT4G31490.1 | TAATTACG | coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative; FUNCTIONS IN: protein binding, clathrin binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Coatomer, beta subunit, C-terminal (InterPro:IPR011710), Armadillo-like helical (InterPro:IPR011989), Coatomer, beta subunit (InterPro:IPR016460), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative (TAIR:AT4G31480.1); Has 2132 Blast hits to 2068 proteins in 250 species: Archae - 0; Bacteria - 0; Metazoa - 1042; Fungi - 407; Plants - 225; Viruses - 0; Other Eukaryotes - 458 (source: NCBI BLink).  |
| AT4G31750 | AT4G31750.1 | CGTAATTA | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320).  |
| AT4G32130 | AT4G32130.1 | TAATTACG | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: male gametophyte, callus, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784); BEST Arabidopsis thaliana protein match is: carbohydrate binding (TAIR:AT2G25310.1); Has 213 Blast hits to 213 proteins in 94 species: Archae - 0; Bacteria - 2; Metazoa - 121; Fungi - 44; Plants - 26; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
| AT4G32190 | AT4G32190.1 | CGTAATTA | centromeric protein-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 175667 Blast hits to 79884 proteins in 2342 species: Archae - 1846; Bacteria - 27476; Metazoa - 82690; Fungi - 12086; Plants - 6517; Viruses - 595; Other Eukaryotes - 44457 (source: NCBI BLink).  |
| AT4G32330 | AT4G32330.1 | CGTAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink).  |
| AT4G32330.2 | CGTAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink).  |
| AT4G32330.3 | CGTAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink).  |
| AT4G36210 | AT4G36210.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT4G36210.2 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT4G36210.3 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT4G37410 | AT4G37410.1 | TAATTACG | member of CYP81F  |
| AT4G38690 | AT4G38690.1 | CGTAATTA | 1-phosphatidylinositol phosphodiesterase-related; FUNCTIONS IN: phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: intracellular signaling cascade, N-terminal protein myristoylation, lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphatidylinositol-specific , X region (InterPro:IPR000909), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946); BEST Arabidopsis thaliana protein match is: 1-phosphatidylinositol phosphodiesterase-related (TAIR:AT4G34920.1); Has 491 Blast hits to 491 proteins in 117 species: Archae - 0; Bacteria - 349; Metazoa - 45; Fungi - 48; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
| AT4G38800 | AT4G38800.1 | TAATTACG | ATMTN1; FUNCTIONS IN: methylthioadenosine nucleosidase activity, catalytic activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN2; methylthioadenosine nucleosidase (TAIR:AT4G34840.1); Has 1331 Blast hits to 1331 proteins in 597 species: Archae - 0; Bacteria - 1240; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
| AT5G04990 | AT5G04990.1 | CGTAATTA | sad1/unc-84 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, endoplasmic reticulum; EXPRESSED IN: cultured cell, callus; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919); BEST Arabidopsis thaliana protein match is: sad1/unc-84-like 2 family protein (TAIR:AT3G10730.1); Has 536 Blast hits to 535 proteins in 121 species: Archae - 6; Bacteria - 51; Metazoa - 331; Fungi - 53; Plants - 40; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
| AT5G05250 | AT5G05250.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56360.1); Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G05610 | AT5G05610.1 | CGTAATTA | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
| AT5G05610.2 | CGTAATTA | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
| AT5G07400 | AT5G07400.1 | CGTAATTA | forkhead-associated domain-containing protein / FHA domain-containing protein; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, phosphoric diester hydrolase activity, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA repair; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, seed; EXPRESSED DURING: F mature embryo stage; CONTAINS InterPro DOMAIN/s: Tyrosyl-DNA phosphodiesterase (InterPro:IPR010347), SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253), HIP116, Rad5p N-terminal (InterPro:IPR014905); BEST Arabidopsis thaliana protein match is: tyrosyl-DNA phosphodiesterase-related (TAIR:AT5G15170.1); Has 327 Blast hits to 296 proteins in 84 species: Archae - 0; Bacteria - 2; Metazoa - 187; Fungi - 58; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
| AT5G09760 | AT5G09760.1 | CGTAATTACG | pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, chloroplast, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G64640.1); Has 1447 Blast hits to 1415 proteins in 271 species: Archae - 0; Bacteria - 416; Metazoa - 1; Fungi - 117; Plants - 911; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G09790 | AT5G09790.1 | TAATTACG | Encodes a SET-domain protein. Contains a PCNA-binding domain. ATXR5 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.  |
| AT5G09790.2 | TAATTACG | Encodes a SET-domain protein. Contains a PCNA-binding domain. ATXR5 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.  |
| AT5G09800 | AT5G09800.1 | CGTAATTA | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, LP.06 six leaves visible, 4 anthesis; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G64660.1); Has 1124 Blast hits to 1107 proteins in 67 species: Archae - 0; Bacteria - 16; Metazoa - 72; Fungi - 4; Plants - 941; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).  |
| AT5G09960 | AT5G09960.1 | CGTAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64850.1); Has 37 Blast hits to 37 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G10070 | AT5G10070.1 | CGTAATTA | RNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).  |
| AT5G10070.2 | CGTAATTA | RNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).  |
| AT5G10290 | AT5G10290.1 | ATCCACGTAATTA | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: kinase (TAIR:AT5G65240.1); Has 122421 Blast hits to 85605 proteins in 2936 species: Archae - 56; Bacteria - 9576; Metazoa - 41410; Fungi - 5522; Plants - 50342; Viruses - 397; Other Eukaryotes - 15118 (source: NCBI BLink).  |
| AT5G11380 | AT5G11380.1 | CGTAATTA | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity.  |
| AT5G11380.2 | CGTAATTA | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity.  |
| AT5G11710 | AT5G11710.1 | TAATTACG | EPSIN1 plays an important role in the vacuolar trafficking of soluble proteins at the trans-Golgi network via its interaction with gamma-ADR, VTI11, VSR1, and clathrin. Associated with actin filaments and with the Golgi complex. Expressed in most tissues.  |
| AT5G13990 | AT5G13990.1 | TAATTACG | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.  |
| AT5G14040 | AT5G14040.1 | CGTAATTA | mitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink).  |
| AT5G14050 | AT5G14050.1 | TAATTACG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink).  |
| AT5G14120 | AT5G14120.1 | CGTAATTA | nodulin family protein; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT3G01930.2); Has 1558 Blast hits to 1511 proteins in 424 species: Archae - 7; Bacteria - 707; Metazoa - 14; Fungi - 166; Plants - 321; Viruses - 0; Other Eukaryotes - 343 (source: NCBI BLink).  |
| AT5G15260 | AT5G15260.1 | CGTAATTA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G01170.1); Has 39 Blast hits to 39 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G15980 | AT5G15980.1 | CGTAATTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G02490.1); Has 4016 Blast hits to 1961 proteins in 56 species: Archae - 0; Bacteria - 17; Metazoa - 19; Fungi - 4; Plants - 3946; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
| AT5G16120 | AT5G16120.1 | CGTAATTA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G77420.1); Has 3068 Blast hits to 3064 proteins in 815 species: Archae - 20; Bacteria - 1988; Metazoa - 126; Fungi - 101; Plants - 252; Viruses - 41; Other Eukaryotes - 540 (source: NCBI BLink).  |
| AT5G16800 | AT5G16800.1 | CGTAATTA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT3G02980.1); Has 653 Blast hits to 653 proteins in 208 species: Archae - 49; Bacteria - 129; Metazoa - 223; Fungi - 49; Plants - 61; Viruses - 2; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT5G16800.2 | CGTAATTA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT3G02980.1); Has 653 Blast hits to 653 proteins in 208 species: Archae - 49; Bacteria - 129; Metazoa - 223; Fungi - 49; Plants - 61; Viruses - 2; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT5G17380 | AT5G17380.1 | TAATTACGTGTAC | pyruvate decarboxylase family protein; FUNCTIONS IN: pyruvate decarboxylase activity, magnesium ion binding, thiamin pyrophosphate binding, transferase activity, catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TPP-binding enzymes, conserved site (InterPro:IPR000399), Thiamine pyrophosphate enzyme, central region (InterPro:IPR012000), Thiamine pyrophosphate enzyme, N-terminal TPP binding region (InterPro:IPR012001), Thiamine pyrophosphate enzyme, C-terminal TPP-binding (InterPro:IPR011766); BEST Arabidopsis thaliana protein match is: CSR1 (CHLORSULFURON/IMIDAZOLINONE RESISTANT 1); acetolactate synthase/ pyruvate decarboxylase (TAIR:AT3G48560.1); Has 19451 Blast hits to 19340 proteins in 1483 species: Archae - 251; Bacteria - 8187; Metazoa - 204; Fungi - 529; Plants - 438; Viruses - 2; Other Eukaryotes - 9840 (source: NCBI BLink).  |
| AT5G18940 | AT5G18940.1 | CGTAATTA | Mo25 family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mo25-like (InterPro:IPR013878), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47540.1); Has 393 Blast hits to 393 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 181; Fungi - 88; Plants - 79; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
| AT5G18940.2 | CGTAATTA | Mo25 family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mo25-like (InterPro:IPR013878), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47540.1); Has 393 Blast hits to 393 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 181; Fungi - 88; Plants - 79; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
| AT5G19320 | AT5G19320.1 | TAATTACG | Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase.  |
| AT5G21160 | AT5G21160.1 | TAATTACG | La domain-containing protein / proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Protein of unknown function DM15 (InterPro:IPR006607); BEST Arabidopsis thaliana protein match is: La domain-containing protein (TAIR:AT4G35890.1); Has 34543 Blast hits to 19975 proteins in 870 species: Archae - 32; Bacteria - 3816; Metazoa - 18229; Fungi - 4234; Plants - 3998; Viruses - 856; Other Eukaryotes - 3378 (source: NCBI BLink).  |
| AT5G27100 | AT5G27100.1 | CGTAATTA | member of Putative ligand-gated ion channel subunit family  |
| AT5G27680 | AT5G27680.1 | TAATTACG | DNA helicase  |
| AT5G37720 | AT5G37720.1 | TAATTACG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT1G66260.1); Has 7601 Blast hits to 6318 proteins in 473 species: Archae - 0; Bacteria - 595; Metazoa - 3780; Fungi - 1246; Plants - 1211; Viruses - 56; Other Eukaryotes - 713 (source: NCBI BLink).  |
| AT5G37720.2 | TAATTACG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT1G66260.1); Has 7601 Blast hits to 6318 proteins in 473 species: Archae - 0; Bacteria - 595; Metazoa - 3780; Fungi - 1246; Plants - 1211; Viruses - 56; Other Eukaryotes - 713 (source: NCBI BLink).  |
| AT5G43680 | AT5G43680.1 | TAATTACG | unknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 56 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
| AT5G50460 | AT5G50460.1 | CGTAATTA | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT5G52410 | AT5G52410.2 | CGTAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23890.1); Has 29575 Blast hits to 18344 proteins in 1264 species: Archae - 368; Bacteria - 3336; Metazoa - 14847; Fungi - 1875; Plants - 1082; Viruses - 170; Other Eukaryotes - 7897 (source: NCBI BLink).  |
| AT5G53290 | AT5G53290.1 | TAATTACG | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.  |
| AT5G53490 | AT5G53490.1 | TAATTACG | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  |
| AT5G53490.2 | TAATTACG | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  |
| AT5G54540 | AT5G54540.1 | TAATTACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP012943 (InterPro:IPR016606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25170.1); Has 60 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G55730 | AT5G55730.1 | CGTAATTA | fasciclin-like arabinogalactan-protein 1 (Fla1)  |
| AT5G57290 | AT5G57290.1 | TAATTACG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  |
| AT5G57290.2 | TAATTACG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  |
| AT5G57290.3 | TAATTACG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  |
| AT5G58390 | AT5G58390.1 | CGTAATTA | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G58400.1); Has 2891 Blast hits to 2875 proteins in 212 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 66; Plants - 2777; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
| AT5G59960 | AT5G59960.1 | TAATTACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT5G61160 | AT5G61160.1 | TAATTACG | anthocyanin 5-aromatic acyltransferase 1 (AACT1); FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G29680.1); Has 1009 Blast hits to 1001 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 24; Plants - 985; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G63140 | AT5G63140.1 | CGTAATTA | ARABIDOPSIS THALIANA PURPLE ACID PHOSPHATASE 29 (ATPAP29); FUNCTIONS IN: protein serine/threonine phosphatase activity, acid phosphatase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843), Phosphoesterase At2g46880 (InterPro:IPR011230); BEST Arabidopsis thaliana protein match is: PAP14 (PURPLE ACID PHOSPHATASE 14); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G46880.1); Has 317 Blast hits to 316 proteins in 98 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 132; Plants - 63; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink).  |
| AT5G64420 | AT5G64420.1 | TAATTACG | DNA polymerase V family; FUNCTIONS IN: DNA-directed DNA polymerase activity, DNA binding; INVOLVED IN: DNA replication, transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase V (InterPro:IPR007015); Has 2876 Blast hits to 1503 proteins in 203 species: Archae - 0; Bacteria - 276; Metazoa - 1312; Fungi - 350; Plants - 103; Viruses - 88; Other Eukaryotes - 747 (source: NCBI BLink).  |
| AT5G64900 | AT5G64900.1 | TAATTACGCGTGAA | Encodes a putative 92-aa protein that is the precursor of AtPep1, a 23-aa peptide which activates transcription of the defensive gene defensin (PDF1.2) and activates the synthesis of H2O2, both being components of the innate immune response.  |
| AT5G65220 | AT5G65220.1 | CGTAATTA | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, nucleoid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); Has 749 Blast hits to 747 proteins in 266 species: Archae - 0; Bacteria - 516; Metazoa - 5; Fungi - 12; Plants - 29; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  |