version

Summary of AtREG649 (All List)

OrganismArabidopsis thaliana  
IDAtREG649  
SequenceAGGCCTAT  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count109  

Entry Sequences (109 entries)

LocusGene modelSequenceDescription
AT1G02816AT1G02816.1TATAGGCCTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G19710AT1G19710.1AATAGGCCTTTTAAAGCCCATTATglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink). 
AT1G20760AT1G20760.1ATTAGGCCTATAAAGGCCCATTTAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink). 
AT1G51350AT1G51350.1ATAAGGCCTATarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G22125.1); Has 1009 Blast hits to 781 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 442; Fungi - 333; Plants - 157; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT1G55120AT1G55120.1ATAGGCCTAAAEncodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. 
AT1G55120.2ATAGGCCTAAAEncodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. 
AT1G60890AT1G60890.1ATAGGCCTTTTphosphatidylinositol-4-phosphate 5-kinase family protein; FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: phosphatidylinositol metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G10900.1); Has 22998 Blast hits to 6300 proteins in 384 species: Archae - 0; Bacteria - 2356; Metazoa - 3944; Fungi - 305; Plants - 691; Viruses - 0; Other Eukaryotes - 15702 (source: NCBI BLink). 
AT1G64680AT1G64680.1ATAGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03055.1); Has 64 Blast hits to 64 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G75870AT1G75870.1ATAGGCCTAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G80480AT1G80480.1CTAAGGCCTATPLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink). 
AT2G01400AT2G01400.1AGGCCTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G05220AT2G05220.1TATAGGCCT40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G05220.2TATAGGCCT40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G15930AT2G15930.1ATAGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G18800AT2G18800.1ATAGGCCTXYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 21 (XTH21); FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, xyloglucan endotransglucosylase activity; INVOLVED IN: primary root development, cell wall modification; LOCATED IN: endomembrane system, apoplast, cell wall; EXPRESSED IN: stem, flower, root, leaf; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Glycoside hydrolase, family 16 (InterPro:IPR000757), Glycoside hydrolase, family 16, active site (InterPro:IPR008263); BEST Arabidopsis thaliana protein match is: TCH4 (Touch 4); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase (TAIR:AT5G57560.1); Has 1424 Blast hits to 1415 proteins in 222 species: Archae - 0; Bacteria - 205; Metazoa - 0; Fungi - 298; Plants - 809; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink). 
AT2G25610AT2G25610.1AGGCCTATAH+-transporting two-sector ATPase, C subunit family protein; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: vacuolar ATP synthase, putative / V-ATPase, putative (TAIR:AT4G32530.1); Has 1596 Blast hits to 1304 proteins in 284 species: Archae - 70; Bacteria - 89; Metazoa - 650; Fungi - 323; Plants - 223; Viruses - 0; Other Eukaryotes - 241 (source: NCBI BLink). 
AT2G27100AT2G27100.1GTAAGGCCTATTIdentified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia. 
AT2G27430AT2G27430.1ATTAGGCCTATAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT4G31890.1); Has 303 Blast hits to 301 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 4; Plants - 288; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G28320AT2G28320.1AGGCCTATpleckstrin homology (PH) domain-containing protein / lipid-binding START domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913), Pleckstrin homology-type (InterPro:IPR011993), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: pleckstrin homology (PH) domain-containing protein / lipid-binding START domain-containing protein (TAIR:AT3G54800.2); Has 373 Blast hits to 365 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT2G30060AT2G30060.1GGCCTATAGGCCTRan-binding protein 1b (RanBP1b); FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: intracellular transport, protein import into nucleus, translocation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ran Binding Protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993); BEST Arabidopsis thaliana protein match is: SIRANBP; Ran GTPase binding (TAIR:AT1G07140.1); Has 1190 Blast hits to 924 proteins in 176 species: Archae - 0; Bacteria - 3; Metazoa - 728; Fungi - 225; Plants - 88; Viruses - 2; Other Eukaryotes - 144 (source: NCBI BLink). 
AT2G39460AT2G39460.1CAAAGGCCTATTEncodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. 
AT2G39460.2CAAAGGCCTATTEncodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. 
AT2G40940AT2G40940.1AGGCCTATAACACGTGAEthylene receptor, subfamily 1. Has histidine kinase activity. 
AT2G45500AT2G45500.1TATAGGCCTATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). 
AT2G45500.2TATAGGCCTATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). 
AT2G45510AT2G45510.1AGGCCTATAmember of CYP704A 
AT2G45690AT2G45690.1ATAAGGCCTATTEncodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica. 
AT2G46090AT2G46090.1AATAGGCCTTTTEncodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. 
AT2G46470AT2G46470.1ACCGTTAGGCCTATAINNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink). 
AT2G46580AT2G46580.1TTAAGGCCTATTpyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae - 0; Bacteria - 365; Metazoa - 49; Fungi - 36; Plants - 20; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). 
AT3G01680AT3G01680.1AGGCCTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 49 Blast hits to 46 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04610AT3G04610.1ATAGGCCTTAAflowering locus KH domain (FLK); FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: positive regulation of flower development; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: PEP (PEPPER); RNA binding / nucleic acid binding (TAIR:AT4G26000.1); Has 7517 Blast hits to 4602 proteins in 299 species: Archae - 0; Bacteria - 217; Metazoa - 3660; Fungi - 662; Plants - 669; Viruses - 248; Other Eukaryotes - 2061 (source: NCBI BLink). 
AT3G09250AT3G09250.1TATAGGCCTAAADNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G12180AT3G12180.1TATAGGCCTAAAcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 450 Blast hits to 450 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 110; Plants - 41; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). 
AT3G12180.1TATAGGCCTAAAcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 450 Blast hits to 450 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 110; Plants - 41; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). 
AT3G14010AT3G14010.1AGGCCTATAhydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. 
AT3G14010.2AGGCCTATAhydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. 
AT3G14010.3AGGCCTATAhydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. 
AT3G14730AT3G14730.1AAAAGGCCTATpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). 
AT3G15250AT3G15250.1AGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53163.1); Has 475 Blast hits to 212 proteins in 55 species: Archae - 0; Bacteria - 19; Metazoa - 271; Fungi - 73; Plants - 18; Viruses - 1; Other Eukaryotes - 93 (source: NCBI BLink). 
AT3G16990AT3G16990.1AATAGGCCTTGGCCCATTAATENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT3G17000AT3G17000.1TTAATGGGCCAAGGCCTATTubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink). 
AT3G17712AT3G17712.1ATAGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1740 (InterPro:IPR013633); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17740.1). 
AT3G18740AT3G18740.1TATAGGCCTTTT60S ribosomal protein L30 (RPL30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L30e (InterPro:IPR000231); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L30 (RPL30B) (TAIR:AT1G77940.1); Has 768 Blast hits to 768 proteins in 281 species: Archae - 141; Bacteria - 3; Metazoa - 274; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). 
AT3G23820AT3G23820.1ATAGGCCTAATUDP-D-glucuronate 4-epimerase 
AT3G27770AT3G27770.1TTTAGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G27770.2TTTAGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G52150AT3G52150.1CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink). 
AT3G52150.2CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink). 
AT3G54140AT3G54140.1AATAGGCCTEncodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source 
AT3G55600AT3G55600.1AGGCCTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cation exchanger, putative (CAX10) (TAIR:AT1G54110.1); Has 167 Blast hits to 167 proteins in 56 species: Archae - 0; Bacteria - 8; Metazoa - 84; Fungi - 28; Plants - 42; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G58600AT3G58600.1ATAATGGGCCTAGGCCTATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). 
AT3G58610AT3G58610.1AATAGGCCTAGGCCCATTATketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). 
AT3G58610.2AATAGGCCTAGGCCCATTATketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). 
AT3G62030AT3G62030.1AATAGGCCTnuclear-encoded chloroplast stromal cyclophilin CYP20-3 (also known as ROC4). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. 
AT3G62580AT3G62580.1AATAGGCCTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT1G72100.1); Has 237 Blast hits to 236 proteins in 85 species: Archae - 0; Bacteria - 4; Metazoa - 103; Fungi - 69; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G62840AT3G62840.1ATAGGCCTFUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT3G62840.2ATAGGCCTFUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT3G63460AT3G63460.1ATAGGCCTWD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). 
AT3G63460.2ATAGGCCTWD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). 
AT4G01560AT4G01560.1ATAGGCCTATmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT4G01570AT4G01570.1ATAGGCCTATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink). 
AT4G02210AT4G02210.1ATAGGCCTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02220AT4G02220.1TATAGGCCTATzinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). 
AT4G02230AT4G02230.1AGGCCTATAATGGGCTTAG60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). 
AT4G05460AT4G05460.1AGGCCTATF-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT4G10250AT4G10250.1AATAGGCCTColumbia endomembrane-localized small heat shock protein 
AT4G14905AT4G14905.1AGGCCTATTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G14905.2AGGCCTATTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G24880AT4G24880.1TATAGGCCTunknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; Has 140 Blast hits to 140 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). 
AT4G25050AT4G25050.1ATAGGCCTencodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. 
AT4G25890AT4G25890.1AGGCCTATA60S acidic ribosomal protein P3 (RPP3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3B) (TAIR:AT5G57290.2); Has 578 Blast hits to 577 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 262; Fungi - 76; Plants - 177; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT4G27680AT4G27680.1AGGCCTATTAAAGGCCCMSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT5G53540.1); Has 20791 Blast hits to 19084 proteins in 1738 species: Archae - 856; Bacteria - 5934; Metazoa - 4055; Fungi - 2306; Plants - 1353; Viruses - 23; Other Eukaryotes - 6264 (source: NCBI BLink). 
AT4G28100AT4G28100.1AGGCCTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18050.1); Has 35 Blast hits to 35 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30200AT4G30200.2TATAGGCCTEncodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. 
AT4G30200.3TATAGGCCTEncodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. 
AT4G30500AT4G30500.1ATAGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT4G38130AT4G38130.1AATAGGCCTTATEncodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation. 
AT4G38130.2AATAGGCCTTATEncodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation. 
AT5G01810AT5G01810.1ATAGGCCTEncodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. 
AT5G01810.2ATAGGCCTEncodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. 
AT5G03850AT5G03850.1AGGCCTATA40S ribosomal protein S28 (RPS28B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, cell wall, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S28e (InterPro:IPR000289); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S28 (RPS28A) (TAIR:AT3G10090.1); Has 804 Blast hits to 804 proteins in 280 species: Archae - 145; Bacteria - 0; Metazoa - 262; Fungi - 104; Plants - 121; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink). 
AT5G04180AT5G04180.1AATAGGCCTATTALPHA CARBONIC ANHYDRASE 3 (ACA3); FUNCTIONS IN: carbonate dehydratase activity, zinc ion binding; INVOLVED IN: response to carbon dioxide, one-carbon compound metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Carbonic anhydrase, alpha-class, catalytic domain (InterPro:IPR001148), Carbonic anhydrase, CAH1-like (InterPro:IPR018340); BEST Arabidopsis thaliana protein match is: ACA4 (ALPHA CARBONIC ANHYDRASE 4); carbonate dehydratase/ zinc ion binding (TAIR:AT4G20990.1); Has 2429 Blast hits to 2419 proteins in 314 species: Archae - 0; Bacteria - 343; Metazoa - 1747; Fungi - 52; Plants - 158; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). 
AT5G06780AT5G06780.1AGGCCTATemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT3G12140.2); Has 145 Blast hits to 134 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G09290AT5G09290.1ATAGGCCT3'(2'),5'-bisphosphate nucleotidase, putative / inositol polyphosphate 1-phosphatase, putative; FUNCTIONS IN: 3'(2'),5'-bisphosphate nucleotidase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: sulfur metabolic process; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase (InterPro:IPR000760), 3(2),5 -bisphosphate nucleotidase HAL2 (InterPro:IPR006239); BEST Arabidopsis thaliana protein match is: SAL2; 3'(2'),5'-bisphosphate nucleotidase/ inositol or phosphatidylinositol phosphatase (TAIR:AT5G64000.1); Has 7391 Blast hits to 7391 proteins in 1133 species: Archae - 37; Bacteria - 3751; Metazoa - 361; Fungi - 190; Plants - 183; Viruses - 0; Other Eukaryotes - 2869 (source: NCBI BLink). 
AT5G15840AT5G15840.1ATAGGCCTEncodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1. 
AT5G15840.2ATAGGCCTEncodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1. 
AT5G22040AT5G22040.1AGGCCTATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G22040.2AGGCCTATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G22440AT5G22440.1ATAAGGCCTATA60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). 
AT5G22440.2ATAAGGCCTATA60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). 
AT5G23110AT5G23110.1AATAGGCCTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding, ATP binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73950.1); Has 2476 Blast hits to 1796 proteins in 199 species: Archae - 0; Bacteria - 49; Metazoa - 1652; Fungi - 152; Plants - 284; Viruses - 80; Other Eukaryotes - 259 (source: NCBI BLink). 
AT5G39740AT5G39740.1TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT5G42220AT5G42220.1AGGCCTATAubiquitin family protein; INVOLVED IN: protein modification process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25270.1); Has 9149 Blast hits to 5042 proteins in 638 species: Archae - 2; Bacteria - 184; Metazoa - 4041; Fungi - 1003; Plants - 1687; Viruses - 163; Other Eukaryotes - 2069 (source: NCBI BLink). 
AT5G42790AT5G42790.1ATAGGCCTAAAencodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome) 
AT5G53540AT5G53540.1AGGCCTATTMSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT4G27680.1); Has 21950 Blast hits to 20239 proteins in 1757 species: Archae - 878; Bacteria - 6604; Metazoa - 4050; Fungi - 2359; Plants - 1467; Viruses - 23; Other Eukaryotes - 6569 (source: NCBI BLink). 
AT5G55190AT5G55190.1AGGCCTATA member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression. 
AT5G57700AT5G57700.1ATAAGCCCATTGGGCTTTTATAGGCCTBNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT5G57700.2ATAAGCCCATTGGGCTTTTATAGGCCTBNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT5G57700.3ATAAGCCCATTGGGCTTTTATAGGCCTBNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT5G57700.4ATAAGCCCATTGGGCTTTTATAGGCCTBNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT5G58510AT5G58510.1ATAATGGGCCAATATTAGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT5G63460AT5G63460.1ATAAGGCCTATASAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT5G63460.2ATAAGGCCTATASAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT5G66500AT5G66500.1AGGCCTATApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, cauline leaf, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G13600.1); Has 10819 Blast hits to 4139 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 15; Plants - 10655; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
ATCG00630ATCG00630.1AATAGGCCTTTAEncodes subunit J of photosystem I. 
ATCG00640ATCG00640.1AATAGGCCTTTAencodes a chloroplast ribosomal protein L33, a constituent of the large subunit of the ribosomal complex 
ATCG00650ATCG00650.1AATAGGCCTTTAchloroplast-encoded ribosomal protein S18 
ATCG00790ATCG00790.1AGGCCTATchloroplast gene encoding a ribosomal protein L16, which is a constituent of 50S large ribosomal subunit 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.