| Locus | Gene model | Sequence | Description |
| AT1G02860 | AT1G02860.1 | CGTTTTGACTTT | Encodes a likely ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses. |
| AT1G02860.2 | CGTTTTGACTTT | Encodes a likely ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses. |
| AT1G03130 | AT1G03130.1 | TCAAAACG | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
| AT1G04270 | AT1G04270.1 | CGTTTTGA | Encodes cytosolic ribosomal protein S15. |
| AT1G04270.2 | CGTTTTGA | Encodes cytosolic ribosomal protein S15. |
| AT1G04750 | AT1G04750.1 | CGTTTTGA | vesicle-associated membrane protein 7B (At VAMP7B) mRNA, |
| AT1G04750.2 | CGTTTTGA | vesicle-associated membrane protein 7B (At VAMP7B) mRNA, |
| AT1G06460 | AT1G06460.1 | CGCGTTTTGA | ACD32.1 encodes an alpha-crystallin domain containing protein with homology to small heat shock proteins. |
| AT1G06470 | AT1G06470.1 | TCAAAACGCG | phosphate translocator-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G25400.1); Has 1538 Blast hits to 1535 proteins in 209 species: Archae - 2; Bacteria - 63; Metazoa - 491; Fungi - 247; Plants - 571; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink). |
| AT1G06470.2 | TCAAAACGCG | phosphate translocator-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G25400.1); Has 1538 Blast hits to 1535 proteins in 209 species: Archae - 2; Bacteria - 63; Metazoa - 491; Fungi - 247; Plants - 571; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink). |
| AT1G07670 | AT1G07670.1 | TCAAAACG | calcium-transporting ATPase; FUNCTIONS IN: calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: guard cell, callus, cultured cell; CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, calcium-transporting (InterPro:IPR005782), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068); BEST Arabidopsis thaliana protein match is: ECA1 (ER-TYPE CA2+-ATPASE 1); calcium-transporting ATPase (TAIR:AT1G07810.1); Has 28836 Blast hits to 19765 proteins in 1902 species: Archae - 663; Bacteria - 17966; Metazoa - 3771; Fungi - 1873; Plants - 1364; Viruses - 3; Other Eukaryotes - 3196 (source: NCBI BLink). |
| AT1G07750 | AT1G07750.1 | TCAAAACGCC | cupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: cupin family protein (TAIR:AT2G28680.1); Has 689 Blast hits to 606 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 685; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G08370 | AT1G08370.1 | CGTTTTGA | Encodes DCP1 involved in mRNA decapping. DCP1 forms a mRNA decapping complex with DCP2 (At5g13570) and VCS (VARICOSE) (At3g13300). However, unlike DCP2, DCP1 itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP2. |
| AT1G10865 | AT1G10865.1 | TCAAAACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G10865.2 | TCAAAACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G13960 | AT1G13960.1 | CGTTTTGA | Encodes WRKY DNA-binding protein 4 (WRKY4). |
| AT1G13960.2 | CGTTTTGA | Encodes WRKY DNA-binding protein 4 (WRKY4). |
| AT1G14240 | AT1G14240.1 | GCCGTTTTGA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT1G14240.2 | GCCGTTTTGA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT1G14240.3 | GCCGTTTTGA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT1G14240.4 | GCCGTTTTGA | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT1G14345 | AT1G14345.1 | TCAAAACG | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); Has 255 Blast hits to 255 proteins in 67 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G14590 | AT1G14590.1 | CGCAGCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14590.1 | CGCAGCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14660 | AT1G14660.1 | CGTTTTGA | member of putative Na+/H+ antiporter (AtNHX) family. Functions as a plasma membrane Li+/H+ antiporter. Involved in Li+ efflux and detoxification. |
| AT1G16190 | AT1G16190.1 | TCAAAACG | DNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink). |
| AT1G16905 | AT1G16905.1 | CGTTTTGA | sugar binding; FUNCTIONS IN: sugar binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480); BEST Arabidopsis thaliana protein match is: curculin-like (mannose-binding) lectin family protein (TAIR:AT1G78860.1); Has 1413 Blast hits to 1382 proteins in 73 species: Archae - 0; Bacteria - 26; Metazoa - 0; Fungi - 0; Plants - 1385; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G17690 | AT1G17690.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink). |
| AT1G19350 | AT1G19350.1 | TCAAAACGCG | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.4 | TCAAAACGCG | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.5 | TCAAAACGCG | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.6 | TCAAAACGCG | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G20840 | AT1G20840.1 | TCAAAACG | The protein encoded by this gene is found in the tonoplast (vacuole membrane) of Arabidopsis cells. The gene is expressed at highest levels in juvenile (sink) and adult (source) leaves, followed by flower tissues. |
| AT1G20920 | AT1G20920.2 | CGTTTTGA | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G09620.1); Has 311341 Blast hits to 125887 proteins in 2991 species: Archae - 1477; Bacteria - 39060; Metazoa - 141008; Fungi - 36045; Plants - 14531; Viruses - 1599; Other Eukaryotes - 77621 (source: NCBI BLink). |
| AT1G20960 | AT1G20960.1 | TCAAAACGGCA | embryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink). |
| AT1G24040 | AT1G24040.1 | TCAAAACGCGGCGTTTTA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24040.2 | TCAAAACGCGGCGTTTTA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24050 | AT1G24050.1 | TAAAACGCCGCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT1G26740 | AT1G26740.1 | TCAAAACGC | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32p (InterPro:IPR002677); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G69485.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 21; Metazoa - 0; Fungi - 12; Plants - 31; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G26750 | AT1G26750.1 | GCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29660 | AT1G29660.1 | TCAAAACG | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: apoplast, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT1G29670.1); Has 2112 Blast hits to 2093 proteins in 271 species: Archae - 0; Bacteria - 436; Metazoa - 1; Fungi - 65; Plants - 1585; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G30540 | AT1G30540.1 | TCAAAACG | ATPase, BadF/BadG/BcrA/BcrD-type family; FUNCTIONS IN: ATPase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, BadF/BadG/BcrA/BcrD type (InterPro:IPR002731); Has 975 Blast hits to 975 proteins in 386 species: Archae - 31; Bacteria - 696; Metazoa - 107; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT1G31130 | AT1G31130.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44860.1); Has 131 Blast hits to 129 proteins in 19 species: Archae - 2; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G32860 | AT1G32860.1 | TCAAAACG | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: ATBG_PAP; glucan endo-1,3-beta-D-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT5G42100.2); Has 1388 Blast hits to 1375 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1382; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G32940 | AT1G32940.1 | CGTTTTGA | SBT3.5; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, F mature embryo stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: SBT3.3; identical protein binding / serine-type endopeptidase (TAIR:AT1G32960.1); Has 3781 Blast hits to 3568 proteins in 616 species: Archae - 127; Bacteria - 2040; Metazoa - 74; Fungi - 118; Plants - 905; Viruses - 0; Other Eukaryotes - 517 (source: NCBI BLink). |
| AT1G48600 | AT1G48600.1 | CGTTTTGA | phosphoethanolamine N-methyltransferase 2, putative (NMT2); FUNCTIONS IN: methyltransferase activity, phosphoethanolamine N-methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: sperm cell, cotyledon, male gametophyte, guard cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: XPL1 (XIPOTL 1); methyltransferase/ phosphoethanolamine N-methyltransferase (TAIR:AT3G18000.1); Has 13276 Blast hits to 12887 proteins in 1498 species: Archae - 390; Bacteria - 8641; Metazoa - 259; Fungi - 577; Plants - 323; Viruses - 4; Other Eukaryotes - 3082 (source: NCBI BLink). |
| AT1G48900 | AT1G48900.1 | CGTTTTGA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G48900.2 | CGTTTTGA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G52880 | AT1G52880.1 | CGTTTTGA | Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo. |
| AT1G56610 | AT1G56610.1 | CGTTTTGA | syntaxin-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14096.1); Has 624 Blast hits to 612 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 624; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G56610.2 | CGTTTTGA | syntaxin-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14096.1); Has 624 Blast hits to 612 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 624; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57820 | AT1G57820.1 | CGTTTTGA | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G57820.2 | CGTTTTGA | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G62290 | AT1G62290.1 | TCAAAACG | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT1G62290.2 | TCAAAACG | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT1G64190 | AT1G64190.1 | ACGACACCGTTTTGA | 6-phosphogluconate dehydrogenase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, decarboxylating (InterPro:IPR006113), 6-phosphogluconate dehydrogenase, C-terminal (InterPro:IPR006114), 6-phosphogluconate dehydrogenase (InterPro:IPR006183), NAD(P)-binding (InterPro:IPR016040), Fibritin/6-phosphogluconate dehydrogenase, C-terminal extension (InterPro:IPR012284); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase family protein (TAIR:AT5G41670.2); Has 8640 Blast hits to 8571 proteins in 1490 species: Archae - 50; Bacteria - 4787; Metazoa - 524; Fungi - 177; Plants - 212; Viruses - 2; Other Eukaryotes - 2888 (source: NCBI BLink). |
| AT1G65150 | AT1G65150.1 | CGTTTTGA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G65150.2 | CGTTTTGA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G67510 | AT1G67510.1 | TCAAAACG | leucine-rich repeat family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G01210.1); Has 96726 Blast hits to 71715 proteins in 2384 species: Archae - 68; Bacteria - 8296; Metazoa - 31560; Fungi - 5101; Plants - 39529; Viruses - 187; Other Eukaryotes - 11985 (source: NCBI BLink). |
| AT1G68660 | AT1G68660.1 | GCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G68660.2 | GCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G70090 | AT1G70090.1 | TCAAAACGAC | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G70090.2 | TCAAAACGAC | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G71270 | AT1G71270.1 | TCAAAACG | Encodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network. |
| AT1G71360 | AT1G71360.1 | TCAAAACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22882.1); Has 9785 Blast hits to 6992 proteins in 496 species: Archae - 108; Bacteria - 691; Metazoa - 4011; Fungi - 621; Plants - 261; Viruses - 70; Other Eukaryotes - 4023 (source: NCBI BLink). |
| AT1G73120 | AT1G73120.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G74920 | AT1G74920.1 | GGCTTTTTCGTTTTGA | Arabidopsis thaliana similar to betaine aldehyde dehydrogenase |
| AT1G77080 | AT1G77080.2 | TCAAAACGC | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
| AT1G77080.4 | TCAAAACGC | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
| AT1G77080.5 | TCAAAACGC | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
| AT1G77370 | AT1G77370.1 | CGTTTTGA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink). |
| AT1G77600 | AT1G77600.1 | TCAAAACG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47690.3); Has 420 Blast hits to 371 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 83; Plants - 153; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G79280 | AT1G79280.1 | TCAAAACGCC | Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. |
| AT1G80480 | AT1G80480.1 | CGTTTTGA | PLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink). |
| AT1G80580 | AT1G80580.1 | ATTGCCACGTCAAAACGC | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G80930 | AT1G80930.1 | GTGTCGTTTTGA | MIF4G domain-containing protein / MA3 domain-containing protein; FUNCTIONS IN: protein binding, RNA binding, binding; INVOLVED IN: translation, RNA metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891), Armadillo-type fold (InterPro:IPR016024), MIF4G-like, type 3 (InterPro:IPR003890), MIF4-like, type 1/2/3 (InterPro:IPR016021); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52325.1); Has 47042 Blast hits to 24073 proteins in 1049 species: Archae - 54; Bacteria - 3998; Metazoa - 22628; Fungi - 5603; Plants - 2672; Viruses - 351; Other Eukaryotes - 11736 (source: NCBI BLink). |
| AT2G01860 | AT2G01860.1 | GTCGTTTTGA | EMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G02000 | AT2G02000.1 | CGTTTTGA | glutamate decarboxylase 3 (GAD3); FUNCTIONS IN: calmodulin binding; INVOLVED IN: carboxylic acid metabolic process, glutamate metabolic process, glutamate decarboxylation to succinate; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent decarboxylase (InterPro:IPR002129), Glutamate decarboxylase (InterPro:IPR010107), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GAD4 (glutamate decarboxylase 4); calmodulin binding (TAIR:AT2G02010.1); Has 1647 Blast hits to 1645 proteins in 499 species: Archae - 126; Bacteria - 839; Metazoa - 130; Fungi - 220; Plants - 174; Viruses - 7; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT2G03350 | AT2G03350.1 | TCAAAACG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08890.2); Has 292 Blast hits to 292 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 291; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G03680 | AT2G03680.1 | CGTTTTGA | The SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. |
| AT2G03680.2 | CGTTTTGA | The SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. |
| AT2G04350 | AT2G04350.1 | GCGTTTTGA | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G04350.2 | GCGTTTTGA | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G05910 | AT2G05910.1 | AAAGTCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G07180 | AT2G07180.1 | CGTTTTGA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 83377 Blast hits to 82332 proteins in 3112 species: Archae - 42; Bacteria - 7499; Metazoa - 37069; Fungi - 6338; Plants - 18225; Viruses - 294; Other Eukaryotes - 13910 (source: NCBI BLink). |
| AT2G09990 | AT2G09990.1 | TCAAAACGCC | 40S ribosomal protein S16 (RPS16A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast, membrane; EXPRESSED IN: guard cell, callus, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4968 Blast hits to 4968 proteins in 1538 species: Archae - 152; Bacteria - 2664; Metazoa - 274; Fungi - 125; Plants - 112; Viruses - 0; Other Eukaryotes - 1641 (source: NCBI BLink). |
| AT2G10950 | AT2G10950.1 | TCAAAACG | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 132 Blast hits to 124 proteins in 24 species: Archae - 0; Bacteria - 2; Metazoa - 28; Fungi - 2; Plants - 81; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT2G13560 | AT2G13560.1 | CGTTTTGA | malate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: response to salt stress, malate metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT4G00570.1); Has 5981 Blast hits to 5971 proteins in 1332 species: Archae - 86; Bacteria - 3249; Metazoa - 553; Fungi - 152; Plants - 269; Viruses - 0; Other Eukaryotes - 1672 (source: NCBI BLink). |
| AT2G14890 | AT2G14890.1 | CGCGTTTTGA | putative proline-rich protein (At2g14890) mRNA, complete |
| AT2G14890.2 | CGCGTTTTGA | putative proline-rich protein (At2g14890) mRNA, complete |
| AT2G15240 | AT2G15240.1 | TCAAAACG | UNC-50 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UNC-50 (InterPro:IPR007881); Has 239 Blast hits to 239 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 63; Plants - 24; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT2G15790 | AT2G15790.1 | TGTCGTTTTGA | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. |
| AT2G17240 | AT2G17240.1 | TTATGGGCCACCCAATAAAAGCCTTTAAAAGCCCACTATCAAAACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24506.1); Has 3052 Blast hits to 987 proteins in 134 species: Archae - 0; Bacteria - 363; Metazoa - 1137; Fungi - 63; Plants - 119; Viruses - 54; Other Eukaryotes - 1316 (source: NCBI BLink). |
| AT2G19385 | AT2G19385.1 | CGTTTTGA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 443 Blast hits to 397 proteins in 133 species: Archae - 0; Bacteria - 6; Metazoa - 196; Fungi - 75; Plants - 41; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT2G21960 | AT2G21960.1 | CGTTTTGA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56180.1); Has 140 Blast hits to 140 proteins in 40 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT2G23985 | AT2G23985.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G23985.2 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25670 | AT2G25670.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32610.1); Has 39716 Blast hits to 23014 proteins in 1226 species: Archae - 64; Bacteria - 4437; Metazoa - 16033; Fungi - 4681; Plants - 1370; Viruses - 266; Other Eukaryotes - 12865 (source: NCBI BLink). |
| AT2G25670.2 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32610.1); Has 39716 Blast hits to 23014 proteins in 1226 species: Archae - 64; Bacteria - 4437; Metazoa - 16033; Fungi - 4681; Plants - 1370; Viruses - 266; Other Eukaryotes - 12865 (source: NCBI BLink). |
| AT2G26280 | AT2G26280.1 | TCAAAACG | smr (Small MutS Related) domain-containing protein mRNA, complete cds |
| AT2G26450 | AT2G26450.1 | CGTTTTGA | pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT4G33230.1); Has 1480 Blast hits to 1433 proteins in 226 species: Archae - 0; Bacteria - 312; Metazoa - 5; Fungi - 138; Plants - 1022; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G26975 | AT2G26975.1 | TCAAAACG | copper transporter, putative; FUNCTIONS IN: copper ion transmembrane transporter activity; INVOLVED IN: copper ion transport; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ctr copper transporter (InterPro:IPR007274); BEST Arabidopsis thaliana protein match is: COPT2; copper ion transmembrane transporter/ high affinity copper ion transmembrane transporter (TAIR:AT3G46900.1); Has 272 Blast hits to 271 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 32; Plants - 81; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT2G30280 | AT2G30280.1 | CGTTTTGA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink). |
| AT2G30330 | AT2G30330.1 | TCAAAACGGCGCGT | GCN5L1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-like 1 (InterPro:IPR009395); Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 4; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G33530 | AT2G33530.1 | TCAAAACG | serine carboxypeptidase-like 46 (scpl46); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL45 (SERINE CARBOXYPEPTIDASE-LIKE 45 PRECURSOR); serine-type carboxypeptidase (TAIR:AT1G28110.2); Has 2557 Blast hits to 2506 proteins in 333 species: Archae - 0; Bacteria - 228; Metazoa - 572; Fungi - 560; Plants - 882; Viruses - 0; Other Eukaryotes - 315 (source: NCBI BLink). |
| AT2G34520 | AT2G34520.1 | TCAAAACG | nuclear-encoded mitochondrial ribosomal protein S14 |
| AT2G35060 | AT2G35060.1 | TCAAAACGC | potassium transporter |
| AT2G35060.2 | TCAAAACGC | potassium transporter |
| AT2G36300 | AT2G36300.1 | TCAAAACG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT3G52760.1); Has 503 Blast hits to 503 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 288; Fungi - 81; Plants - 66; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT2G36390 | AT2G36390.1 | TCAAAACG | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. |
| AT2G37400 | AT2G37400.1 | CAGCGTTTTGA | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink). |
| AT2G38760 | AT2G38760.1 | TCAAAACG | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. |
| AT2G40060 | AT2G40060.1 | CGTTTTGA | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT2G41830 | AT2G41830.1 | CGTTTTGA | cyclin-related; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21080.1); Has 188 Blast hits to 186 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 115; Fungi - 3; Plants - 65; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT2G43100 | AT2G43100.1 | TCAAAACGC | aconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: leucine biosynthetic process, metabolic process; LOCATED IN: 3-isopropylmalate dehydratase complex, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT2G43090.1); Has 5949 Blast hits to 5949 proteins in 1261 species: Archae - 224; Bacteria - 3135; Metazoa - 7; Fungi - 224; Plants - 45; Viruses - 0; Other Eukaryotes - 2314 (source: NCBI BLink). |
| AT2G43210 | AT2G43210.1 | TCAAAACG | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink). |
| AT2G43210.2 | TCAAAACG | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink). |
| AT2G43980 | AT2G43980.1 | TCAAAACGAC | inositol 1,3,4-trisphosphate 5/6-kinase 4 (AtITPK4); FUNCTIONS IN: magnesium ion binding, inositol-1,3,4-trisphosphate 5/6-kinase activity, catalytic activity, ATP binding, inositol tetrakisphosphate 1-kinase activity; INVOLVED IN: inositol trisphosphate metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATP-grasp fold (InterPro:IPR011761), Inositol-tetrakisphosphate 1-kinase, uncharacterised-N-terminal (InterPro:IPR017418), Inositol 1, 3, 4-trisphosphate 56-kinase (InterPro:IPR008656); BEST Arabidopsis thaliana protein match is: inositol 1,3,4-trisphosphate 5/6-kinase family protein (TAIR:AT4G08170.2); Has 282 Blast hits to 279 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 0; Plants - 168; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT2G44310 | AT2G44310.1 | TCAAAACG | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G54530.1); Has 158 Blast hits to 153 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT2G44890 | AT2G44890.1 | TCAAAACGACA | member of CYP704A |
| AT2G46915 | AT2G46915.1 | GTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19340.1); Has 101 Blast hits to 96 proteins in 30 species: Archae - 0; Bacteria - 24; Metazoa - 10; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT3G03050 | AT3G03050.1 | GGCGTTTTGA | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT3G03650 | AT3G03650.1 | CGTTTTGA | embryo sac development arrest 5 (EDA5); FUNCTIONS IN: catalytic activity; INVOLVED IN: megagametogenesis, pollen tube development; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT3G45400.1); Has 625 Blast hits to 623 proteins in 41 species: Archae - 0; Bacteria - 6; Metazoa - 31; Fungi - 0; Plants - 536; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G03840 | AT3G03840.1 | CGTTTTGA | auxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT3G03820.1); Has 578 Blast hits to 575 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 577; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G04560 | AT3G04560.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G05520 | AT3G05520.1 | TCAAAACGACACCGTCAGA | F-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865). |
| AT3G05520.2 | TCAAAACGACACCGTCAGA | F-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865). |
| AT3G06310 | AT3G06310.1 | TCAAAACGCAGCGTTT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06310.2 | TCAAAACGCAGCGTTT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06320 | AT3G06320.1 | AAACGCTGCGTTTTGA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G06455 | AT3G06455.1 | TCAAAACGAAAAGCCCAACT | splicing factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT4G01000.1); Has 5886 Blast hits to 2871 proteins in 525 species: Archae - 0; Bacteria - 0; Metazoa - 2661; Fungi - 609; Plants - 1364; Viruses - 154; Other Eukaryotes - 1098 (source: NCBI BLink). |
| AT3G06950 | AT3G06950.1 | TCAAAACG | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G34150.1); Has 6144 Blast hits to 6136 proteins in 1570 species: Archae - 113; Bacteria - 2971; Metazoa - 267; Fungi - 167; Plants - 77; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). |
| AT3G07790 | AT3G07790.1 | TCAAAACG | DGCR14-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 242 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 55; Plants - 18; Viruses - 13; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09090 | AT3G09090.1 | TCAAAACGGCA | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
| AT3G09090.2 | TCAAAACGGCA | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
| AT3G09570 | AT3G09570.1 | TCAAAACGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G09650 | AT3G09650.1 | TCAAAACGACGACGT | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
| AT3G10330 | AT3G10330.1 | TAGGGCTTCAAAACGTTGGGCCGGG | transcription initiation factor IIB-2 / general transcription factor TFIIB-2 (TFIIB2); FUNCTIONS IN: protein binding, RNA polymerase II transcription factor activity, transcription regulator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of transcription, DNA-dependent, transcription initiation, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Zinc finger, TFIIB-type (InterPro:IPR013137), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: TFIIB (TRANSCRIPTION FACTOR II B); RNA polymerase II transcription factor/ protein binding / transcription regulator/ translation initiation factor/ zinc ion binding (TAIR:AT2G41630.1); Has 1521 Blast hits to 1508 proteins in 255 species: Archae - 348; Bacteria - 0; Metazoa - 268; Fungi - 189; Plants - 107; Viruses - 10; Other Eukaryotes - 599 (source: NCBI BLink). |
| AT3G10350 | AT3G10350.1 | TCAAAACG | anion-transporting ATPase family protein; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1736 Blast hits to 1472 proteins in 461 species: Archae - 116; Bacteria - 1153; Metazoa - 110; Fungi - 90; Plants - 58; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink). |
| AT3G10420 | AT3G10420.1 | TCAAAACG | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink). |
| AT3G10420.2 | TCAAAACG | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink). |
| AT3G11400 | AT3G11400.1 | TCAAAACG | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). |
| AT3G11400.2 | TCAAAACG | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). |
| AT3G11620 | AT3G11620.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.2 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.3 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.4 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11630 | AT3G11630.1 | CGTTTTGA | Encodes a 2-Cys peroxiredoxin (2-Cys PrxA) that contains two catalytic Cys residues. |
| AT3G12580 | AT3G12580.1 | TCAAAACG | heat shock protein 70 (HSP70); FUNCTIONS IN: ATP binding; INVOLVED IN: in 8 processes; LOCATED IN: cytosol, mitochondrion, cell wall, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24865 Blast hits to 24554 proteins in 3102 species: Archae - 103; Bacteria - 9662; Metazoa - 3184; Fungi - 1196; Plants - 727; Viruses - 243; Other Eukaryotes - 9750 (source: NCBI BLink). |
| AT3G13450 | AT3G13450.1 | GTGTCGTTTTGA | branched chain alpha-keto acid dehydrogenase E1 beta |
| AT3G13772 | AT3G13772.1 | TCAAAACGAC | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT1G55130.1); Has 1018 Blast hits to 1005 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 142; Plants - 240; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT3G15920 | AT3G15920.1 | GCGTTTTGA | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT4G32160.1); Has 32140 Blast hits to 19498 proteins in 1025 species: Archae - 337; Bacteria - 2422; Metazoa - 17764; Fungi - 2188; Plants - 1026; Viruses - 108; Other Eukaryotes - 8295 (source: NCBI BLink). |
| AT3G19760 | AT3G19760.1 | TGTCGTTTTGA | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink). |
| AT3G19980 | AT3G19980.1 | GCGTTTTGA | Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype. |
| AT3G20230 | AT3G20230.1 | TCAAAACGC | 50S ribosomal protein L18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G08845.2); Has 911 Blast hits to 911 proteins in 312 species: Archae - 0; Bacteria - 630; Metazoa - 35; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT3G20240 | AT3G20240.1 | GCGTTTTGA | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SHS1 (SODIUM HYPERSENSITIVE 1); binding / nucleotide transmembrane transporter/ transporter (TAIR:AT4G32400.1); Has 16786 Blast hits to 9647 proteins in 354 species: Archae - 0; Bacteria - 0; Metazoa - 7901; Fungi - 4785; Plants - 2484; Viruses - 0; Other Eukaryotes - 1616 (source: NCBI BLink). |
| AT3G20280 | AT3G20280.1 | GCGTTTTGA | PHD finger family protein; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT1G50620.1); Has 9770 Blast hits to 5029 proteins in 476 species: Archae - 22; Bacteria - 1974; Metazoa - 3487; Fungi - 1858; Plants - 150; Viruses - 195; Other Eukaryotes - 2084 (source: NCBI BLink). |
| AT3G20910 | AT3G20910.1 | TCAAAACG | NUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT3G21300 | AT3G21300.1 | TCAAAACGCTG | RNA methyltransferase family protein; FUNCTIONS IN: methyltransferase activity, RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280), 23S rRNA methyltransferase/RumA (InterPro:IPR001566), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G28450.1); Has 5920 Blast hits to 5453 proteins in 1374 species: Archae - 144; Bacteria - 4401; Metazoa - 174; Fungi - 148; Plants - 63; Viruses - 6; Other Eukaryotes - 984 (source: NCBI BLink). |
| AT3G21400 | AT3G21400.1 | TCAAAACGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G25290 | AT3G25290.1 | TCAAAACG | auxin-responsive family protein; INVOLVED IN: multicellular organismal development; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT4G12980.1); Has 386 Blast hits to 386 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 67; Plants - 253; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G25290.2 | TCAAAACG | auxin-responsive family protein; INVOLVED IN: multicellular organismal development; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT4G12980.1); Has 386 Blast hits to 386 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 67; Plants - 253; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G26330 | AT3G26330.1 | CGTTTTGA | putative cytochrome P450 |
| AT3G26980 | AT3G26980.1 | TCAAAACGCC | MEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN 4 PRECURSOR (MUB4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-anchored ubiquitin-fold protein, HCG-1 (InterPro:IPR017000), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ATGP4 (TAIR:AT4G24990.1); Has 103 Blast hits to 103 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 7; Plants - 96; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G44100 | AT3G44100.1 | CCCAATAAGTCAAAACGAC | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT3G11780.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 77; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT3G45870 | AT3G45870.2 | CGTTTTGA | integral membrane family protein / nodulin MtN21-related; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: integral membrane family protein (TAIR:AT4G19185.1); Has 2381 Blast hits to 2369 proteins in 430 species: Archae - 23; Bacteria - 1346; Metazoa - 6; Fungi - 3; Plants - 624; Viruses - 0; Other Eukaryotes - 379 (source: NCBI BLink). |
| AT3G49720 | AT3G49720.1 | CGTGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G49720.2 | CGTGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G50630 | AT3G50630.1 | TCAAAACG | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. |
| AT3G51660 | AT3G51660.1 | TCAAAACG | macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; LOCATED IN: peroxisome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G01650.2); Has 238 Blast hits to 238 proteins in 65 species: Archae - 0; Bacteria - 18; Metazoa - 119; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G51880 | AT3G51880.1 | CGTTTTGA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT3G51880.2 | CGTTTTGA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT3G51880.3 | CGTTTTGA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT3G53410 | AT3G53410.1 | CGTTTTGA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G09770.1); Has 1550 Blast hits to 1550 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 783; Fungi - 60; Plants - 277; Viruses - 82; Other Eukaryotes - 348 (source: NCBI BLink). |
| AT3G55070 | AT3G55070.1 | AAACGCTGTCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G55070.2 | AAACGCTGTCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G57420 | AT3G57420.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41770.1); Has 155 Blast hits to 155 proteins in 20 species: Archae - 2; Bacteria - 7; Metazoa - 47; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT3G58180 | AT3G58180.1 | CGTTTTGA | PBS lyase HEAT-like repeat-containing protein; FUNCTIONS IN: lyase activity, binding; INVOLVED IN: biological_process unknown; LOCATED IN: phycobilisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), PBS lyase HEAT-like repeat (InterPro:IPR004155); BEST Arabidopsis thaliana protein match is: PBS lyase HEAT-like repeat-containing protein (TAIR:AT3G62530.1); Has 1505 Blast hits to 797 proteins in 276 species: Archae - 192; Bacteria - 504; Metazoa - 254; Fungi - 237; Plants - 43; Viruses - 0; Other Eukaryotes - 275 (source: NCBI BLink). |
| AT3G60490 | AT3G60490.1 | TCAAAACG | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G61960 | AT3G61960.1 | TCAAAACG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 96538 Blast hits to 94555 proteins in 3142 species: Archae - 71; Bacteria - 8635; Metazoa - 41764; Fungi - 8770; Plants - 18509; Viruses - 485; Other Eukaryotes - 18304 (source: NCBI BLink). |
| AT3G61960.2 | TCAAAACG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 96538 Blast hits to 94555 proteins in 3142 species: Archae - 71; Bacteria - 8635; Metazoa - 41764; Fungi - 8770; Plants - 18509; Viruses - 485; Other Eukaryotes - 18304 (source: NCBI BLink). |
| AT3G62080 | AT3G62080.1 | CGTTTTGA | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT3G62200 | AT3G62200.1 | TCAAAACGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: EDA32 (embryo sac development arrest 32) (TAIR:AT3G62210.1); Has 3380 Blast hits to 2820 proteins in 272 species: Archae - 0; Bacteria - 93; Metazoa - 1555; Fungi - 720; Plants - 473; Viruses - 42; Other Eukaryotes - 497 (source: NCBI BLink). |
| AT3G63220 | AT3G63220.1 | CGTTTTGA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G63220.2 | CGTTTTGA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT4G00830 | AT4G00830.1 | GCGTTTTGA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink). |
| AT4G00830.2 | GCGTTTTGA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink). |
| AT4G01700 | AT4G01700.1 | AAAGTCAAAACG | chitinase, putative; FUNCTIONS IN: chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: cell wall; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 19 (InterPro:IPR016283), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT1G02360.1); Has 1469 Blast hits to 1463 proteins in 349 species: Archae - 0; Bacteria - 354; Metazoa - 35; Fungi - 2; Plants - 989; Viruses - 19; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G02820 | AT4G02820.1 | CGTTTTGA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 6981 Blast hits to 3279 proteins in 125 species: Archae - 0; Bacteria - 14; Metazoa - 76; Fungi - 59; Plants - 6627; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT4G04340 | AT4G04340.1 | TCAAAACG | early-responsive to dehydration protein-related / ERD protein-related; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT4G22120.5); Has 937 Blast hits to 829 proteins in 136 species: Archae - 0; Bacteria - 2; Metazoa - 161; Fungi - 457; Plants - 259; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT4G04340.2 | TCAAAACG | early-responsive to dehydration protein-related / ERD protein-related; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT4G22120.5); Has 937 Blast hits to 829 proteins in 136 species: Archae - 0; Bacteria - 2; Metazoa - 161; Fungi - 457; Plants - 259; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT4G04340.3 | TCAAAACG | early-responsive to dehydration protein-related / ERD protein-related; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT4G22120.5); Has 937 Blast hits to 829 proteins in 136 species: Archae - 0; Bacteria - 2; Metazoa - 161; Fungi - 457; Plants - 259; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT4G04885 | AT4G04885.1 | TCAAAACG | Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time. |
| AT4G10970 | AT4G10970.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1). |
| AT4G10970.2 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1). |
| AT4G10970.3 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1). |
| AT4G10970.4 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1). |
| AT4G10970.5 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1). |
| AT4G10970.6 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1). |
| AT4G11670 | AT4G11670.1 | TCAAAACGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06970.1); Has 147 Blast hits to 87 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 138; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G14315 | AT4G14315.1 | CGCAGCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16380 | AT4G16380.1 | AACACGTGTCAAAACG | metal ion binding; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT1G51090.1); Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16380.2 | AACACGTGTCAAAACG | metal ion binding; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT1G51090.1); Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G19390 | AT4G19390.1 | TCAAAACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022348 (InterPro:IPR016804), Uncharacterised protein family UPF0114 (InterPro:IPR005134); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13720.1); Has 553 Blast hits to 553 proteins in 219 species: Archae - 18; Bacteria - 407; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT4G19500 | AT4G19500.1 | CGTTTTGA | ATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor; FUNCTIONS IN: protein binding, transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat 3 (InterPro:IPR011713), Toll-Interleukin receptor (InterPro:IPR000157), Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: SNC1 (SUPPRESSOR OF NPR1-1, CONSTITUTIVE 1); nucleotide binding (TAIR:AT4G16890.1); Has 13999 Blast hits to 8175 proteins in 320 species: Archae - 7; Bacteria - 332; Metazoa - 274; Fungi - 32; Plants - 12934; Viruses - 4; Other Eukaryotes - 416 (source: NCBI BLink). |
| AT4G20300 | AT4G20300.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G20300.2 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G21320 | AT4G21320.1 | GCGTTTTGA | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
| AT4G22140 | AT4G22140.1 | TCAAAACGACA | DNA binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Bromo adjacent region (InterPro:IPR001025), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT4G04260.1); Has 1467 Blast hits to 1417 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 921; Fungi - 186; Plants - 236; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT4G22140.2 | TCAAAACGACA | DNA binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Bromo adjacent region (InterPro:IPR001025), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT4G04260.1); Has 1467 Blast hits to 1417 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 921; Fungi - 186; Plants - 236; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT4G22320 | AT4G22320.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55210.1); Has 9841 Blast hits to 5053 proteins in 396 species: Archae - 29; Bacteria - 556; Metazoa - 3805; Fungi - 755; Plants - 226; Viruses - 158; Other Eukaryotes - 4312 (source: NCBI BLink). |
| AT4G24240 | AT4G24240.1 | TCAAAACGC | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT4G24770 | AT4G24770.1 | CGTTTTGA | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G24930 | AT4G24930.1 | GCGTTTTGA | thylakoid lumenal 17.9 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25000 | AT4G25000.1 | TCAAAACGTGACA | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT4G25290 | AT4G25290.1 | ACGACGTCGTTTTGA | DNA photolyase; FUNCTIONS IN: DNA photolyase activity; INVOLVED IN: DNA repair; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), DNA photolyase, N-terminal (InterPro:IPR006050), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G36530.2); Has 4147 Blast hits to 4144 proteins in 685 species: Archae - 35; Bacteria - 2248; Metazoa - 244; Fungi - 30; Plants - 260; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink). |
| AT4G25300 | AT4G25300.1 | TCAAAACGACGTCGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink). |
| AT4G25300.2 | TCAAAACGACGTCGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink). |
| AT4G26160 | AT4G26160.1 | TCAAAACG | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT4G26540 | AT4G26540.1 | TCAAAACG | kinase; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: inflorescence meristem; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: leucine-rich repeat protein kinase, putative (TAIR:AT5G56040.2); Has 146520 Blast hits to 84763 proteins in 2645 species: Archae - 97; Bacteria - 13340; Metazoa - 56291; Fungi - 5522; Plants - 53478; Viruses - 285; Other Eukaryotes - 17507 (source: NCBI BLink). |
| AT4G26860 | AT4G26860.1 | CGTTTTGAAAGGGTAT | pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: alanine racemase family protein (TAIR:AT1G11930.2); Has 5001 Blast hits to 5001 proteins in 1281 species: Archae - 14; Bacteria - 2219; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT4G27340 | AT4G27340.1 | CGTTTTGA | Met-10+ like family protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT3G56120.1); Has 1006 Blast hits to 996 proteins in 336 species: Archae - 244; Bacteria - 250; Metazoa - 158; Fungi - 92; Plants - 67; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT4G27970 | AT4G27970.1 | CGTTTTGATTCGGTTT | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT4G28025 | AT4G28025.1 | AAACGACGACGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G29905 | AT4G29905.1 | TCAAAACG | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 41 Blast hits to 41 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30410 | AT4G30410.1 | TCAAAACG | transcription factor; FUNCTIONS IN: transcription factor activity; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57780.1); Has 76 Blast hits to 76 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G30410.2 | TCAAAACG | transcription factor; FUNCTIONS IN: transcription factor activity; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57780.1); Has 76 Blast hits to 76 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G30660 | AT4G30660.1 | TCAAAACG | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G30660.2 | TCAAAACG | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G30996 | AT4G30996.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24290.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G31180 | AT4G31180.1 | GGGTCAAAACG | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink). |
| AT4G31180.2 | GGGTCAAAACG | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink). |
| AT4G31360 | AT4G31360.1 | TCAAAACG | selenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT4G32340 | AT4G32340.1 | CGTTTTGA | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G80130.1); Has 2680 Blast hits to 1282 proteins in 184 species: Archae - 2; Bacteria - 433; Metazoa - 1247; Fungi - 71; Plants - 657; Viruses - 13; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G32960 | AT4G32960.1 | TCAAAACGCTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32970.1); Has 78 Blast hits to 78 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G33400 | AT4G33400.1 | TCAAAACGACA | dem protein-related / defective embryo and meristems protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Vacuolar import and degradation, Vid27-related (InterPro:IPR013863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19240.1); Has 171 Blast hits to 171 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 88; Plants - 38; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT4G33410 | AT4G33410.1 | TGTCGTTTTGA | signal peptide peptidase family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT2G43070.1); Has 697 Blast hits to 691 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 390; Fungi - 77; Plants - 139; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT4G33530 | AT4G33530.1 | TCAAAACG | potassium transporter |
| AT4G33540 | AT4G33540.1 | CGTTTTGA | metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink). |
| AT4G34120 | AT4G34120.1 | TCAAAACGC | LOSS OF THE TIMING OF ET AND JA BIOSYNTHESIS 1 (LEJ1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: LEJ2 (LOSS OF THE TIMING OF ET AND JA BIOSYNTHESIS 2) (TAIR:AT4G36910.1); Has 4785 Blast hits to 4390 proteins in 996 species: Archae - 682; Bacteria - 3142; Metazoa - 98; Fungi - 77; Plants - 110; Viruses - 0; Other Eukaryotes - 676 (source: NCBI BLink). |
| AT4G34480 | AT4G34480.1 | TCAAAACG | catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT2G16230.1); Has 1388 Blast hits to 1379 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 5; Plants - 1380; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G35700 | AT4G35700.1 | TCAAAACG | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G35610.1); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G36910 | AT4G36910.1 | CGTTTTGA | Has a cystathionine Beta-synthase domain. |
| AT4G37820 | AT4G37820.1 | AAATGACGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G22795.1); Has 363989 Blast hits to 137148 proteins in 2858 species: Archae - 1191; Bacteria - 38325; Metazoa - 151130; Fungi - 38393; Plants - 14217; Viruses - 2059; Other Eukaryotes - 118674 (source: NCBI BLink). |
| AT4G37820.1 | GTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G22795.1); Has 363989 Blast hits to 137148 proteins in 2858 species: Archae - 1191; Bacteria - 38325; Metazoa - 151130; Fungi - 38393; Plants - 14217; Viruses - 2059; Other Eukaryotes - 118674 (source: NCBI BLink). |
| AT4G37970 | AT4G37970.1 | AAAGTCAAAACG | CINNAMYL ALCOHOL DEHYDROGENASE 6 (CAD6); FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 22264 Blast hits to 22252 proteins in 1793 species: Archae - 377; Bacteria - 12614; Metazoa - 1134; Fungi - 1791; Plants - 1846; Viruses - 3; Other Eukaryotes - 4499 (source: NCBI BLink). |
| AT4G40045 | AT4G40045.1 | TCAAAACGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G01590 | AT5G01590.1 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 32 proteins in 18 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G02270 | AT5G02270.1 | TCAAAACGGCGTCGTT | member of NAP subfamily |
| AT5G02280 | AT5G02280.1 | AACGACGCCGTTTTGA | synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT1G51160.2); Has 419 Blast hits to 413 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 100; Plants - 56; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | CGCAGCGTTTTGA | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G05450 | AT5G05450.1 | TCAAAACGCTGCGTTTTG | DEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae - 410; Bacteria - 10515; Metazoa - 4736; Fungi - 3110; Plants - 1301; Viruses - 7; Other Eukaryotes - 5946 (source: NCBI BLink). |
| AT5G06660 | AT5G06660.1 | TCAAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G08520 | AT5G08520.1 | GGCGTTTTGACCC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya (InterPro:IPR017884), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT5G23650.1); Has 1430 Blast hits to 1399 proteins in 120 species: Archae - 0; Bacteria - 4; Metazoa - 98; Fungi - 50; Plants - 802; Viruses - 0; Other Eukaryotes - 476 (source: NCBI BLink). |
| AT5G08680 | AT5G08680.1 | CGTTTTGA | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G09540 | AT5G09540.1 | CGTTTTGA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding, response to salt stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G64360.4); Has 752 Blast hits to 732 proteins in 227 species: Archae - 8; Bacteria - 304; Metazoa - 100; Fungi - 51; Plants - 254; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G10240 | AT5G10240.1 | TCAAAACGCGTCGTTTT | Encodes asparagine synthetase (ASN3). |
| AT5G10240.2 | TCAAAACGCGTCGTTTT | Encodes asparagine synthetase (ASN3). |
| AT5G11240 | AT5G11240.1 | CGCCGTTTTGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink). |
| AT5G11480 | AT5G11480.1 | TCAAAACG | GTP binding; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: EMB2001 (embryo defective 2001); GTP binding (TAIR:AT2G22870.1); Has 5119 Blast hits to 5076 proteins in 1347 species: Archae - 69; Bacteria - 3394; Metazoa - 92; Fungi - 98; Plants - 89; Viruses - 0; Other Eukaryotes - 1377 (source: NCBI BLink). |
| AT5G11490 | AT5G11490.1 | CGTTTTGA | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 1821 Blast hits to 1784 proteins in 168 species: Archae - 0; Bacteria - 0; Metazoa - 868; Fungi - 426; Plants - 151; Viruses - 0; Other Eukaryotes - 376 (source: NCBI BLink). |
| AT5G11490.1 | TCAAAACGC | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 1821 Blast hits to 1784 proteins in 168 species: Archae - 0; Bacteria - 0; Metazoa - 868; Fungi - 426; Plants - 151; Viruses - 0; Other Eukaryotes - 376 (source: NCBI BLink). |
| AT5G11860 | AT5G11860.1 | TCAAAACG | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G11860.2 | TCAAAACG | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G11860.3 | TCAAAACG | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G11860.4 | TCAAAACG | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chromosome, centromeric region, chromosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.2); Has 2040 Blast hits to 2040 proteins in 179 species: Archae - 0; Bacteria - 12; Metazoa - 736; Fungi - 368; Plants - 198; Viruses - 1; Other Eukaryotes - 725 (source: NCBI BLink). |
| AT5G12130 | AT5G12130.1 | CGTTTTGA | PIGMENT DEFECTIVE 149 (PDE149); INVOLVED IN: thylakoid membrane organization; LOCATED IN: chloroplast thylakoid membrane, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Integral membrane protein TerC (InterPro:IPR005496); Has 2303 Blast hits to 2303 proteins in 668 species: Archae - 4; Bacteria - 1555; Metazoa - 2; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 721 (source: NCBI BLink). |
| AT5G13250 | AT5G13250.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28080.1); Has 1127 Blast hits to 1024 proteins in 44 species: Archae - 0; Bacteria - 2; Metazoa - 35; Fungi - 35; Plants - 7; Viruses - 0; Other Eukaryotes - 1048 (source: NCBI BLink). |
| AT5G13850 | AT5G13850.1 | TCAAAACG | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT3G12390.1); Has 794 Blast hits to 784 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 341; Fungi - 176; Plants - 104; Viruses - 14; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G15200 | AT5G15200.1 | TCAAAACGGGCCCAATATAAAGCC | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15200.2 | TCAAAACGGGCCCAATATAAAGCC | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15540 | AT5G15540.1 | TCAAAACGAC | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
| AT5G15910 | AT5G15910.1 | TCAAAACG | dehydrogenase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 4174 Blast hits to 4174 proteins in 940 species: Archae - 63; Bacteria - 2510; Metazoa - 105; Fungi - 172; Plants - 313; Viruses - 2; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT5G17410 | AT5G17410.1 | CGTTTTGA | tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT5G17410.2 | CGTTTTGA | tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT5G18260 | AT5G18260.1 | TCAAAACG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G14180.2); Has 168 Blast hits to 131 proteins in 29 species: Archae - 0; Bacteria - 4; Metazoa - 60; Fungi - 7; Plants - 87; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G19250 | AT5G19250.1 | TCAAAACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G06035.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19430 | AT5G19430.1 | TGTCGTTTTGA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G12310.1); Has 381 Blast hits to 381 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 19; Plants - 127; Viruses - 42; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G19950 | AT5G19950.1 | TCAAAACG | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.2 | TCAAAACG | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.3 | TCAAAACG | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19960 | AT5G19960.1 | CGTTTTGA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP8; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G39260.2); Has 17397 Blast hits to 14212 proteins in 592 species: Archae - 12; Bacteria - 964; Metazoa - 9774; Fungi - 1887; Plants - 2774; Viruses - 3; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT5G22100 | AT5G22100.1 | TCAAAACGC | RNA cyclase family protein; FUNCTIONS IN: RNA-3'-phosphate cyclase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA 3'-terminal phosphate cyclase- like (InterPro:IPR000228), RNA 3'-terminal phosphate cyclase, insert region (InterPro:IPR013796), RNA 3'-terminal phosphate cyclase-like, eukaryotic (InterPro:IPR016443), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); Has 760 Blast hits to 750 proteins in 310 species: Archae - 113; Bacteria - 208; Metazoa - 233; Fungi - 95; Plants - 22; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT5G26980 | AT5G26980.1 | TCAAAACG | member of SYP4 Gene Family |
| AT5G26980.2 | TCAAAACG | member of SYP4 Gene Family |
| AT5G27120 | AT5G27120.1 | CGCAGCGTTTTGA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein |
| AT5G36180 | AT5G36180.1 | GCGTTTTGA | serine carboxypeptidase-like 1 (scpl1); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl2 (serine carboxypeptidase-like 2); serine-type carboxypeptidase (TAIR:AT1G73300.1); Has 2836 Blast hits to 2748 proteins in 348 species: Archae - 0; Bacteria - 360; Metazoa - 588; Fungi - 551; Plants - 997; Viruses - 0; Other Eukaryotes - 340 (source: NCBI BLink). |
| AT5G36890 | AT5G36890.1 | CGTTTTGA | BETA GLUCOSIDASE 42 (BGLU42); FUNCTIONS IN: cation binding, beta-glucosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellulose catabolic process, carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1, beta-glucosidase (InterPro:IPR017736), Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU40 (BETA GLUCOSIDASE 40); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G26560.1); Has 5821 Blast hits to 5565 proteins in 799 species: Archae - 98; Bacteria - 3179; Metazoa - 610; Fungi - 134; Plants - 849; Viruses - 0; Other Eukaryotes - 951 (source: NCBI BLink). |
| AT5G36890.2 | CGTTTTGA | BETA GLUCOSIDASE 42 (BGLU42); FUNCTIONS IN: cation binding, beta-glucosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellulose catabolic process, carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1, beta-glucosidase (InterPro:IPR017736), Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU40 (BETA GLUCOSIDASE 40); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G26560.1); Has 5821 Blast hits to 5565 proteins in 799 species: Archae - 98; Bacteria - 3179; Metazoa - 610; Fungi - 134; Plants - 849; Viruses - 0; Other Eukaryotes - 951 (source: NCBI BLink). |
| AT5G37070 | AT5G37070.1 | CGTGTCGTTTTGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08890.2); Has 322 Blast hits to 320 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 321; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G38460 | AT5G38460.1 | TCAAAACG | ALG6, ALG8 glycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; LOCATED IN: endoplasmic reticulum membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyltransferase, ALG6/ALG8 (InterPro:IPR004856); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G44660.1); Has 504 Blast hits to 492 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 258; Fungi - 169; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT5G39570 | AT5G39570.1 | TCAAAACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G40670 | AT5G40670.1 | TCAAAACGGCA | PQ-loop repeat family protein / transmembrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Lysosomal cystine transporter (InterPro:IPR005282); Has 261 Blast hits to 261 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G41150 | AT5G41150.1 | TAAACGACGCCGTTTTGA | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41150.2 | TAAACGACGCCGTTTTGA | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41330 | AT5G41330.1 | CGTTTTGA | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT3G09030.1); Has 474 Blast hits to 473 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 378; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT5G42220 | AT5G42220.1 | TCAAAACGTCGTCGTT | ubiquitin family protein; INVOLVED IN: protein modification process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25270.1); Has 9149 Blast hits to 5042 proteins in 638 species: Archae - 2; Bacteria - 184; Metazoa - 4041; Fungi - 1003; Plants - 1687; Viruses - 163; Other Eukaryotes - 2069 (source: NCBI BLink). |
| AT5G45140 | AT5G45140.1 | TCAAAACG | Encodes a subunit of RNA polymerase III (aka RNA polymerase C). |
| AT5G47690 | AT5G47690.1 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.2 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.3 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47710 | AT5G47710.1 | TCAAAACGC | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G70790.2); Has 3689 Blast hits to 3095 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 2170; Fungi - 415; Plants - 810; Viruses - 0; Other Eukaryotes - 294 (source: NCBI BLink). |
| AT5G47710.2 | TCAAAACGC | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G70790.2); Has 3689 Blast hits to 3095 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 2170; Fungi - 415; Plants - 810; Viruses - 0; Other Eukaryotes - 294 (source: NCBI BLink). |
| AT5G48240 | AT5G48240.1 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). |
| AT5G48240.2 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). |
| AT5G48240.3 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). |
| AT5G48540 | AT5G48540.1 | GCGTTTTGACCGACT | 33 kDa secretory protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902); BEST Arabidopsis thaliana protein match is: receptor protein kinase-related (TAIR:AT3G22060.1); Has 1085 Blast hits to 938 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1085; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G49510 | AT5G49510.1 | TCAAAACGATGGGCTTA | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49510.2 | TCAAAACGATGGGCTTA | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G51070 | AT5G51070.1 | TCAAAACGC | ATP-dependent Clp protease regulatory subunit |
| AT5G51150 | AT5G51150.1 | TCAAAACGC | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34630.1); Has 381 Blast hits to 298 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 87; Plants - 35; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT5G51180 | AT5G51180.1 | CGTTTTGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25770.1); Has 499 Blast hits to 490 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 189; Plants - 98; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G51180.2 | CGTTTTGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25770.1); Has 499 Blast hits to 490 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 189; Plants - 98; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G51960 | AT5G51960.1 | TCAAAACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATP synthase assembly factor FMC1, mitochondrial (InterPro:IPR018471); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G53650 | AT5G53650.1 | CCACGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G53650.1 | GTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55210 | AT5G55210.1 | TAAAACGCCGCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55210.1 | TCAAAACGCAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55220 | AT5G55220.1 | AAACGCTGCGTTTTGA | trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). |
| AT5G55220.1 | TCAAAACGCGGCGTTTTA | trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). |
| AT5G58490 | AT5G58490.1 | TCAAAACGACACG | cinnamoyl-CoA reductase family; FUNCTIONS IN: 3-beta-hydroxy-delta5-steroid dehydrogenase activity, binding, cinnamoyl-CoA reductase activity, catalytic activity; INVOLVED IN: lignin biosynthetic process, steroid biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-beta hydroxysteroid dehydrogenase/isomerase (InterPro:IPR002225), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: cinnamoyl-CoA reductase family (TAIR:AT2G02400.1); Has 8253 Blast hits to 8243 proteins in 1158 species: Archae - 140; Bacteria - 2986; Metazoa - 418; Fungi - 574; Plants - 1442; Viruses - 7; Other Eukaryotes - 2686 (source: NCBI BLink). |
| AT5G58640 | AT5G58640.1 | ATTTGGGCCGTTTTGA | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT5G58640.2 | ATTTGGGCCGTTTTGA | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT5G59790 | AT5G59790.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF966 (InterPro:IPR010369); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46110.1); Has 96 Blast hits to 95 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 90; Viruses - 3; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59960 | AT5G59960.1 | GTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G61430 | AT5G61430.1 | CGTTTTGA | ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 100 (ANAC100); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC080 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 80); transcription factor (TAIR:AT5G07680.1); Has 1683 Blast hits to 1681 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1683; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G62920 | AT5G62920.1 | CGTTTTGA | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT5G63160 | AT5G63160.1 | TCAAAACG | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT5G63970 | AT5G63970.1 | CGTTTTGA | copine-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Copine (InterPro:IPR010734), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: RGLG1 (RING domain Ligase1); protein binding / zinc ion binding (TAIR:AT3G01650.1); Has 1324 Blast hits to 1320 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 910; Fungi - 0; Plants - 170; Viruses - 35; Other Eukaryotes - 209 (source: NCBI BLink). |
| AT5G63970.2 | CGTTTTGA | copine-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Copine (InterPro:IPR010734), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: RGLG1 (RING domain Ligase1); protein binding / zinc ion binding (TAIR:AT3G01650.1); Has 1324 Blast hits to 1320 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 910; Fungi - 0; Plants - 170; Viruses - 35; Other Eukaryotes - 209 (source: NCBI BLink). |
| AT5G64120 | AT5G64120.1 | TCAAAACG | encodes a cell wall bound peroxidase that is induced by hypo-osmolarity |
| AT5G64120.1 | TCAAAACG | encodes a cell wall bound peroxidase that is induced by hypo-osmolarity |
| AT5G64420 | AT5G64420.1 | CGTTTTGA | DNA polymerase V family; FUNCTIONS IN: DNA-directed DNA polymerase activity, DNA binding; INVOLVED IN: DNA replication, transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase V (InterPro:IPR007015); Has 2876 Blast hits to 1503 proteins in 203 species: Archae - 0; Bacteria - 276; Metazoa - 1312; Fungi - 350; Plants - 103; Viruses - 88; Other Eukaryotes - 747 (source: NCBI BLink). |
| AT5G64670 | AT5G64670.1 | TCAAAACGACA | ribosomal protein L15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15, bacterial-type (InterPro:IPR005749), Ribosomal protein L15 (InterPro:IPR001196); Has 5287 Blast hits to 5287 proteins in 1515 species: Archae - 0; Bacteria - 2940; Metazoa - 111; Fungi - 84; Plants - 51; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink). |
| AT5G64680 | AT5G64680.1 | TGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT5G64680.2 | TGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT5G64680.3 | TGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT5G65050 | AT5G65050.1 | TCAAAACGC | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
| AT5G65050.2 | TCAAAACGC | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
| AT5G65050.3 | TCAAAACGC | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
| AT5G65250 | AT5G65250.1 | CGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 106 Blast hits to 106 proteins in 29 species: Archae - 0; Bacteria - 53; Metazoa - 35; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G66880 | AT5G66880.1 | TCAAAACGCG | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |