| Locus | Gene model | Sequence | Description |
| AT1G05070 | AT1G05070.1 | AACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G05220 | AT1G05220.1 | TGGTTCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 103 Blast hits to 103 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 10; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G05220.1 | TGGTTCGGTTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 103 Blast hits to 103 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 10; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G05220.2 | TGGTTCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 103 Blast hits to 103 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 10; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G05220.2 | TGGTTCGGTTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 103 Blast hits to 103 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 10; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G06110 | AT1G06110.1 | TGGTTCGGT | SKP1/ASK-interacting protein 16 (SKIP16); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: SCF ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ApaG (InterPro:IPR007474); Has 1427 Blast hits to 1427 proteins in 496 species: Archae - 0; Bacteria - 836; Metazoa - 173; Fungi - 41; Plants - 47; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT1G06630 | AT1G06630.1 | TGGTTCGGTTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G60040.1); Has 1188 Blast hits to 1155 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1187; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G06630.2 | TGGTTCGGTTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G60040.1); Has 1188 Blast hits to 1155 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1187; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G06630.3 | TGGTTCGGTTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G60040.1); Has 1188 Blast hits to 1155 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1187; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G07870 | AT1G07870.1 | CCGAACCA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G28590.1); Has 82095 Blast hits to 81092 proteins in 2973 species: Archae - 50; Bacteria - 7578; Metazoa - 35765; Fungi - 6178; Plants - 18436; Viruses - 378; Other Eukaryotes - 13710 (source: NCBI BLink). |
| AT1G08130 | AT1G08130.1 | CCGAACCA | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. Indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
| AT1G08280 | AT1G08280.1 | CCGAACCA | glycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, integral to Golgi membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Sialyltransferase (InterPro:IPR012163), Glycosyl transferase, family 29 (InterPro:IPR001675); Has 1982 Blast hits to 1970 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 1819; Fungi - 0; Plants - 92; Viruses - 14; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT1G08530 | AT1G08530.1 | TGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09995.3); Has 90 Blast hits to 90 proteins in 36 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G10865 | AT1G10865.1 | TTAAACCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G10865.2 | TTAAACCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G15890 | AT1G15890.1 | TGGTTCGG | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G43730.1); Has 12716 Blast hits to 11782 proteins in 513 species: Archae - 12; Bacteria - 543; Metazoa - 2689; Fungi - 133; Plants - 9121; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| AT1G17020 | AT1G17020.1 | TGGTTCGGT | Encodes a novel member of the Fe(II)/ascorbate oxidase gene family; senescence-related gene. |
| AT1G18450 | AT1G18450.1 | TGGTTCGGTTTAG | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
| AT1G24120 | AT1G24120.1 | TCACGCGCCGAACCA | encodes a DnaJ-like protein similar to ARG1 and ARL2 that are both involved in root and hypocotyl gravitropism response. However, null mutation in this gene does not result in defects in gravitropism. Gene is expressed in all tissues examined. |
| AT1G24450 | AT1G24450.1 | CGAACCGAACCA | NUCLEAR FUSION DEFECTIVE 2 (NFD2); FUNCTIONS IN: RNA binding, ribonuclease III activity; INVOLVED IN: RNA processing; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease III (InterPro:IPR000999); Has 1405 Blast hits to 1405 proteins in 451 species: Archae - 3; Bacteria - 885; Metazoa - 2; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 508 (source: NCBI BLink). |
| AT1G25350 | AT1G25350.1 | TGGTTCGGTTCG | ovule abortion 9 (OVA9); FUNCTIONS IN: glutamine-tRNA ligase activity; INVOLVED IN: glutamyl-tRNA aminoacylation, translation, ovule development; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Glutamyl/glutaminyl-tRNA synthetase, class Ic (InterPro:IPR000924), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 1 (InterPro:IPR007639), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 2 (InterPro:IPR007638), Glutaminyl-tRNA synthetase, class Ic (InterPro:IPR004514); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (E and Q) family protein (TAIR:AT5G19720.1); Has 8783 Blast hits to 8778 proteins in 1656 species: Archae - 170; Bacteria - 4659; Metazoa - 349; Fungi - 257; Plants - 97; Viruses - 0; Other Eukaryotes - 3251 (source: NCBI BLink). |
| AT1G26230 | AT1G26230.1 | TGTTGGGCCCGAACCA | chaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink). |
| AT1G26530 | AT1G26530.1 | TGGTTCGGTTCGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT1G27461 | AT1G27461.1 | AACCGAACCA | unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G28320 | AT1G28320.1 | ACCGAACCA | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
| AT1G28320.1 | TGGTTCGG | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
| AT1G29240 | AT1G29240.1 | TGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF688 (InterPro:IPR007789); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G34170.2); Has 42 Blast hits to 42 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29350 | AT1G29350.1 | TGGTTCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: kinase-related (TAIR:AT1G29370.1); Has 13611 Blast hits to 7582 proteins in 387 species: Archae - 0; Bacteria - 354; Metazoa - 5683; Fungi - 1538; Plants - 892; Viruses - 68; Other Eukaryotes - 5076 (source: NCBI BLink). |
| AT1G30510 | AT1G30510.1 | TGGTTCGGTTTGG | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30510.2 | TGGTTCGGTTTGG | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30510.3 | TGGTTCGGTTTGG | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G31730 | AT1G31730.1 | AACCGAACCA | epsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). |
| AT1G33780 | AT1G33780.1 | TTTAACCGAACCAAACCG | unknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink). |
| AT1G47200 | AT1G47200.1 | ACCGAACCA | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity. |
| AT1G47550 | AT1G47550.1 | TGGTTCGGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, exocyst; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47560.1); Has 295 Blast hits to 291 proteins in 116 species: Archae - 3; Bacteria - 6; Metazoa - 134; Fungi - 71; Plants - 54; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT1G47550.1 | TGGTTCGGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, exocyst; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47560.1); Has 295 Blast hits to 291 proteins in 116 species: Archae - 3; Bacteria - 6; Metazoa - 134; Fungi - 71; Plants - 54; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT1G49970 | AT1G49970.1 | TGGTTCGGT | Encodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G51310 | AT1G51310.1 | AACCGAACCA | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase; FUNCTIONS IN: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity; INVOLVED IN: tRNA processing, RNA processing; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (InterPro:IPR004506), tRNA methyl transferase-like (InterPro:IPR018318); Has 5934 Blast hits to 5930 proteins in 1456 species: Archae - 0; Bacteria - 3103; Metazoa - 118; Fungi - 45; Plants - 26; Viruses - 0; Other Eukaryotes - 2642 (source: NCBI BLink). |
| AT1G51390 | AT1G51390.1 | TGGTTCGGTTAAATCCGGTTAAA | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. |
| AT1G52825 | AT1G52825.1 | TGGTTCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14615.1); Has 30 Blast hits to 28 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57610 | AT1G57610.1 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G57610.1 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G57610.2 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G57610.2 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G57610.3 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G57610.3 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G57660 | AT1G57660.1 | CTAAACCGAACCA | 60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT1G61450 | AT1G61450.1 | AACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61415.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G67700 | AT1G67700.1 | TGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G67700.2 | TGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G68660 | AT1G68660.1 | TGGTTCGGTAAACCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G68660.2 | TGGTTCGGTAAACCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G74030 | AT1G74030.1 | CCGAACCGAACCGAACCA | enolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: in 12 processes; LOCATED IN: phosphopyruvate hydratase complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9513 Blast hits to 9495 proteins in 2259 species: Archae - 189; Bacteria - 3126; Metazoa - 1415; Fungi - 220; Plants - 154; Viruses - 0; Other Eukaryotes - 4409 (source: NCBI BLink). |
| AT1G74040 | AT1G74040.1 | TGGTTCGGTTCGGTTCG | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
| AT1G76010 | AT1G76010.1 | TGGTTCGGTTTAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G20220.1); Has 75246 Blast hits to 26916 proteins in 1384 species: Archae - 54; Bacteria - 14987; Metazoa - 38865; Fungi - 4655; Plants - 6135; Viruses - 798; Other Eukaryotes - 9752 (source: NCBI BLink). |
| AT1G76070 | AT1G76070.1 | TAATTACGGAAGCCCATCCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20310.1); Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G77800 | AT1G77800.1 | AAACCGAACCA | PHD finger family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: ATX1 (ARABIDOPSIS HOMOLOGUE OF TRITHORAX); histone-lysine N-methyltransferase/ phosphatidylinositol-5-phosphate binding (TAIR:AT2G31650.1); Has 2544 Blast hits to 1383 proteins in 151 species: Archae - 0; Bacteria - 2; Metazoa - 1640; Fungi - 401; Plants - 246; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). |
| AT2G03670 | AT2G03670.1 | TGGTTCGGT | CDC48 - like protein AAA-type ATPaseCell. division control protein 48 homolog B |
| AT2G04340 | AT2G04340.1 | TGGTTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04340.1 | TGGTTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04430 | AT2G04430.1 | AAACCGAACCA | Arabidopsis thaliana Nudix hydrolase homolog 5 (atnudt5); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Anti-sense to fibroblast growth factor protein GFG (InterPro:IPR003293); BEST Arabidopsis thaliana protein match is: ATNUDT6 (Arabidopsis thaliana Nudix hydrolase homolog 6); ADP-ribose diphosphatase/ NAD or NADH binding / hydrolase (TAIR:AT2G04450.1); Has 1869 Blast hits to 1867 proteins in 436 species: Archae - 16; Bacteria - 904; Metazoa - 164; Fungi - 13; Plants - 89; Viruses - 9; Other Eukaryotes - 674 (source: NCBI BLink). |
| AT2G06010 | AT2G06010.1 | AACCGAACCA | encodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3. |
| AT2G16930 | AT2G16930.1 | TGGTTCGG | ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT2G16930.2 | TGGTTCGG | ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT2G16930.3 | TGGTTCGG | ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT2G19385 | AT2G19385.1 | TGGTTCGGTTTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 443 Blast hits to 397 proteins in 133 species: Archae - 0; Bacteria - 6; Metazoa - 196; Fungi - 75; Plants - 41; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT2G19570 | AT2G19570.1 | AAACCGAACCA | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
| AT2G20450 | AT2G20450.1 | TTTAACCGAACCA | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT2G24650 | AT2G24650.2 | AACCGAACCA | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: apoplast; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: MEE45 (maternal effect embryo arrest 45); DNA binding / transcription factor (TAIR:AT4G00260.1); Has 527 Blast hits to 125 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G27260 | AT2G27260.1 | TGGTTCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); Has 584 Blast hits to 584 proteins in 25 species: Archae - 2; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 578; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G27590 | AT2G27590.1 | CCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT2G32840 | AT2G32840.1 | AAACCGAACCA | proline-rich family protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G04930.1); Has 733 Blast hits to 646 proteins in 145 species: Archae - 4; Bacteria - 102; Metazoa - 178; Fungi - 111; Plants - 168; Viruses - 37; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G32840.2 | AAACCGAACCA | proline-rich family protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G04930.1); Has 733 Blast hits to 646 proteins in 145 species: Archae - 4; Bacteria - 102; Metazoa - 178; Fungi - 111; Plants - 168; Viruses - 37; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G34690 | AT2G34690.1 | TGGTTCGG | Gene product transports the glycolipid precursor sphingosine between membranes in vitro. Mutant constitutively expresses defense-related genes that accompany the hypersensitive response normally triggered by avirulent pathogens. |
| AT2G37600 | AT2G37600.1 | CCGAACCA | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT2G37600.2 | CCGAACCA | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT2G38600 | AT2G38600.1 | ACCGAACCA | acid phosphatase class B family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase, putative (TAIR:AT4G25150.1); Has 458 Blast hits to 458 proteins in 101 species: Archae - 0; Bacteria - 159; Metazoa - 0; Fungi - 0; Plants - 236; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT2G38670 | AT2G38670.1 | AAACCGGTTTTGGTTCGGTTTAG | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. |
| AT2G38670.1 | TGGTTCGGTTTAG | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. |
| AT2G40085 | AT2G40085.1 | TGGTTCGGTTTGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT2G40270 | AT2G40270.1 | TGGTTCGG | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G56050.2); Has 26726 Blast hits to 26497 proteins in 928 species: Archae - 2; Bacteria - 1013; Metazoa - 9654; Fungi - 683; Plants - 12592; Viruses - 117; Other Eukaryotes - 2665 (source: NCBI BLink). |
| AT2G40270.2 | TGGTTCGG | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G56050.2); Has 26726 Blast hits to 26497 proteins in 928 species: Archae - 2; Bacteria - 1013; Metazoa - 9654; Fungi - 683; Plants - 12592; Viruses - 117; Other Eukaryotes - 2665 (source: NCBI BLink). |
| AT2G40316 | AT2G40316.1 | TGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G40316.2 | TGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G40490 | AT2G40490.1 | AAACCGAACCA | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). |
| AT2G42120 | AT2G42120.1 | AACCGAACCA | DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT2G42120.2 | AACCGAACCA | DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT2G42160 | AT2G42160.1 | TATATGGGCCGAACCAAAAGCCCATAT | zinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT2G42780 | AT2G42780.1 | TGGTTCGGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: integral to membrane, nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II transcription factor SIII, subunit A (InterPro:IPR010684); Has 143 Blast hits to 142 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 19; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G43180 | AT2G43180.1 | TGGTTCGGT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). |
| AT2G43180.2 | TGGTTCGGT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). |
| AT2G43180.3 | TGGTTCGGT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). |
| AT2G43180.4 | TGGTTCGGT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). |
| AT2G43510 | AT2G43510.1 | TGGTTCGGTT | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
| AT2G43780 | AT2G43780.1 | ACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G43780.2 | ACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46170 | AT2G46170.1 | CCGAACCA | reticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT2G46170.2 | CCGAACCA | reticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT3G02540 | AT3G02540.1 | TGGTTCGGT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink). |
| AT3G02540.2 | TGGTTCGGT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink). |
| AT3G07670 | AT3G07670.1 | AAACCGAACCAAACCG | SET domain-containing protein; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT5G14260.3); Has 844 Blast hits to 844 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 238; Plants - 226; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G08920 | AT3G08920.1 | TGGTTCGG | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G42220.1); Has 151 Blast hits to 151 proteins in 36 species: Archae - 0; Bacteria - 36; Metazoa - 1; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G10030 | AT3G10030.1 | TGGTTCGGTTTGG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). |
| AT3G10030.2 | TGGTTCGGTTTGG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). |
| AT3G14580 | AT3G14580.1 | CCGAACCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, embryo, sepal; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 16419 Blast hits to 4807 proteins in 153 species: Archae - 2; Bacteria - 2; Metazoa - 276; Fungi - 148; Plants - 15495; Viruses - 0; Other Eukaryotes - 496 (source: NCBI BLink). |
| AT3G14930 | AT3G14930.1 | ACCGAACCA | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G14930.2 | ACCGAACCA | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G14930.3 | ACCGAACCA | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G18160 | AT3G18160.1 | TGGTTCGGTTAAGTTCGGTTAAA | peroxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). |
| AT3G18160.2 | TGGTTCGGTTAAGTTCGGTTAAA | peroxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). |
| AT3G18160.3 | TGGTTCGGTTAAGTTCGGTTAAA | peroxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). |
| AT3G19515 | AT3G19515.2 | CCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23935.1); Has 489 Blast hits to 360 proteins in 69 species: Archae - 0; Bacteria - 3; Metazoa - 215; Fungi - 17; Plants - 81; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT3G19515.2 | CCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23935.1); Has 489 Blast hits to 360 proteins in 69 species: Archae - 0; Bacteria - 3; Metazoa - 215; Fungi - 17; Plants - 81; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT3G23255 | AT3G23255.1 | ACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G26630 | AT3G26630.1 | CCGAACCA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT3G42790 | AT3G42790.1 | TGACCCGACCCGAACCA | AL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT3G49645 | AT3G49645.1 | ACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51100 | AT3G51100.1 | TGGTTCGGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51100.2 | TGGTTCGGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51100.3 | TGGTTCGGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G54190 | AT3G54190.1 | TGGTTCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G58970 | AT3G58970.1 | CCGAACCAAACCG | magnesium transporter CorA-like family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-6) (TAIR:AT4G28580.1); Has 487 Blast hits to 476 proteins in 123 species: Archae - 2; Bacteria - 17; Metazoa - 63; Fungi - 134; Plants - 201; Viruses - 2; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT3G60190 | AT3G60190.1 | ACCGAACCA | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central ‘dynamin 2‘ domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
| AT3G60190.1 | GTAAACCGACCGAACCA | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central ‘dynamin 2‘ domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
| AT3G61600 | AT3G61600.1 | AAACCGAACCA | POZ/BTB containing-protein AtPOB1 |
| AT3G61600.2 | AAACCGAACCA | POZ/BTB containing-protein AtPOB1 |
| AT4G00850 | AT4G00850.1 | TGGTTCGG | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
| AT4G05400 | AT4G05400.1 | AAACCGAACCA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G05400.2 | AAACCGAACCA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G09340 | AT4G09340.1 | ACCGAACCA | SPla/RYanodine receptor (SPRY) domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT1G35470.2); Has 922 Blast hits to 864 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 443; Fungi - 205; Plants - 109; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT4G11150 | AT4G11150.1 | TGGTTCGGTT | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis. |
| AT4G11220 | AT4G11220.1 | CCGAACCA | VIRB2-INTERACTING PROTEIN 2 (BTI2); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: BTI1 (VIRB2-INTERACTING PROTEIN 1) (TAIR:AT4G23630.1); Has 982 Blast hits to 982 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 664; Fungi - 12; Plants - 283; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT4G11380 | AT4G11380.1 | TGGTTCGGTTCGGTT | beta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). |
| AT4G11980 | AT4G11980.1 | AACCGAACCA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 14 (ATNUDX14); FUNCTIONS IN: hydrolase activity, ADP-sugar diphosphatase activity, ADP-ribose pyrophosphohydrolase activity, ADP-glucose pyrophosphohydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 845 Blast hits to 845 proteins in 388 species: Archae - 4; Bacteria - 636; Metazoa - 8; Fungi - 51; Plants - 17; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT4G13340 | AT4G13340.1 | AAACCGAACCA | leucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink). |
| AT4G18460 | AT4G18460.1 | TGGTTCGGTTT | D-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink). |
| AT4G18465 | AT4G18465.1 | AAACCGAACCA | RNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 7224 Blast hits to 6791 proteins in 1024 species: Archae - 6; Bacteria - 1974; Metazoa - 1905; Fungi - 796; Plants - 374; Viruses - 693; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G21440 | AT4G21440.1 | ACCGAACCA | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT4G21650 | AT4G21650.1 | TTAAACCGAACCA | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT4G21630.1); Has 4532 Blast hits to 3933 proteins in 710 species: Archae - 129; Bacteria - 2684; Metazoa - 30; Fungi - 172; Plants - 917; Viruses - 0; Other Eukaryotes - 600 (source: NCBI BLink). |
| AT4G23630 | AT4G23630.1 | CCGAACCA | VIRB2-INTERACTING PROTEIN 1 (BTI1); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: BTI2 (VIRB2-INTERACTING PROTEIN 2) (TAIR:AT4G11220.1); Has 962 Blast hits to 962 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 10; Plants - 284; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G24840 | AT4G24840.1 | CCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT4G26630 | AT4G26630.1 | TGGTTCGGAACCGGAC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). |
| AT4G26630.2 | TGGTTCGGAACCGGAC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). |
| AT4G27130 | AT4G27130.1 | CTAAACCGAACCA | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT5G54760.2); Has 620 Blast hits to 617 proteins in 201 species: Archae - 6; Bacteria - 1; Metazoa - 295; Fungi - 109; Plants - 120; Viruses - 3; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT4G29120 | AT4G29120.1 | TTTAACCGAACCA | 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, phosphogluconate dehydrogenase (decarboxylating) activity, binding, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 12459 Blast hits to 12442 proteins in 1308 species: Archae - 93; Bacteria - 6200; Metazoa - 393; Fungi - 342; Plants - 184; Viruses - 2; Other Eukaryotes - 5245 (source: NCBI BLink). |
| AT4G29160 | AT4G29160.1 | TGGTTCGGTTAAA | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29160.2 | TGGTTCGGTTAAA | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29160.3 | TGGTTCGGTTAAA | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29850 | AT4G29850.1 | TGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G32175 | AT4G32175.1 | TGGTTCGGT | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: exonuclease-related (TAIR:AT2G25355.1); Has 380 Blast hits to 380 proteins in 172 species: Archae - 65; Bacteria - 0; Metazoa - 101; Fungi - 101; Plants - 32; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT4G32285 | AT4G32285.1 | TGGTTCGG | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT2G25430.1); Has 1251 Blast hits to 1096 proteins in 211 species: Archae - 8; Bacteria - 172; Metazoa - 457; Fungi - 134; Plants - 334; Viruses - 22; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT4G32285.2 | TGGTTCGG | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT2G25430.1); Has 1251 Blast hits to 1096 proteins in 211 species: Archae - 8; Bacteria - 172; Metazoa - 457; Fungi - 134; Plants - 334; Viruses - 22; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT4G33670 | AT4G33670.1 | CCGAACCA | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis |
| AT4G34265 | AT4G34265.1 | ATAAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G34265.2 | ATAAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35785 | AT4G35785.1 | CCGAACCAAACCGAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.1 | TTAAACCGAACCA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.2 | CCGAACCAAACCGAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.2 | TTAAACCGAACCA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.3 | CCGAACCAAACCGAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.3 | TTAAACCGAACCA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G37190 | AT4G37190.1 | TGGTTCGGT | INVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G37190.2 | TGGTTCGGT | INVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G39080 | AT4G39080.1 | ACCGAACCA | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. |
| AT5G01420 | AT5G01420.1 | TGGTTCGGTTTAT | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT5G03870.1); Has 300 Blast hits to 300 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 0; Plants - 195; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT5G02100 | AT5G02100.1 | ATCCGGTTTGGTTCGGTT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT5G03970 | AT5G03970.1 | CCGAACCA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G03970.2 | CCGAACCA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G04260 | AT5G04260.1 | ACCGAACCA | Encodes a thioredoxin (WCRKC2) localized in chloroplast stroma. Contains a WCRKC motif. |
| AT5G05550 | AT5G05550.1 | TGGTTCGGT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G11100.1); Has 203 Blast hits to 195 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G05550.2 | TGGTTCGGT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G11100.1); Has 203 Blast hits to 195 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G05590 | AT5G05590.1 | TTCGGTTTGGTTCGGTTTAA | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT5G05590.2 | TTCGGTTTGGTTCGGTTTAA | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT5G05920 | AT5G05920.1 | CGAACCGAACCA | Encodes a deoxyhypusine synthase. |
| AT5G05920.2 | CGAACCGAACCA | Encodes a deoxyhypusine synthase. |
| AT5G06130 | AT5G06130.1 | TGGTTCGGTT | chaperone protein dnaJ-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61670.2); Has 65 Blast hits to 65 proteins in 13 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G06130.2 | TGGTTCGGTT | chaperone protein dnaJ-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61670.2); Has 65 Blast hits to 65 proteins in 13 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G06830 | AT5G06830.1 | TGGTTCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF773 (InterPro:IPR008491); Has 301 Blast hits to 298 proteins in 82 species: Archae - 7; Bacteria - 7; Metazoa - 191; Fungi - 5; Plants - 24; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G08160 | AT5G08160.1 | CCGAACCA | Encodes a serine/threonine protein kinase. |
| AT5G08160.2 | CCGAACCA | Encodes a serine/threonine protein kinase. |
| AT5G09680 | AT5G09680.1 | AACCGAACCA | cytochrome b5 domain-containing protein; FUNCTIONS IN: heme binding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome b5, heme-binding site (InterPro:IPR018506), Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: CB5-A (CYTOCHROME B5 ISOFORM A); heme binding (TAIR:AT1G26340.1); Has 2233 Blast hits to 2217 proteins in 344 species: Archae - 1; Bacteria - 7; Metazoa - 608; Fungi - 741; Plants - 527; Viruses - 0; Other Eukaryotes - 349 (source: NCBI BLink). |
| AT5G09680.2 | AACCGAACCA | cytochrome b5 domain-containing protein; FUNCTIONS IN: heme binding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome b5, heme-binding site (InterPro:IPR018506), Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: CB5-A (CYTOCHROME B5 ISOFORM A); heme binding (TAIR:AT1G26340.1); Has 2233 Blast hits to 2217 proteins in 344 species: Archae - 1; Bacteria - 7; Metazoa - 608; Fungi - 741; Plants - 527; Viruses - 0; Other Eukaryotes - 349 (source: NCBI BLink). |
| AT5G10100 | AT5G10100.1 | TGGTTCGG | trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae - 29; Bacteria - 765; Metazoa - 195; Fungi - 100; Plants - 258; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT5G16820 | AT5G16820.1 | CCGAACCA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT5G16820.2 | CCGAACCA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT5G17400 | AT5G17400.1 | ACCGAACCA | This gene is predicted to encode an ER-localized adenine nucleotide transporter with six putative transmembrane helices. It appears to act as a ATP:ADP antiporter when expressed in E.coli plasma membranes. Transcript levels for several ER-localized chaperones (e.g. BIP1/2) and other ATP-requiring ER proteins (e.g. CPK2) are reduced in er-ant1 knock-out lines, suggesting a lack of adequate ATP transport into the ER in these mutants. They also have reduced seed oil and seed protein levels. |
| AT5G17410 | AT5G17410.1 | TGGTTCGGT | tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT5G17410.2 | TGGTTCGGT | tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT5G19540 | AT5G19540.1 | TGGTTCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 48 Blast hits to 47 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G19660 | AT5G19660.1 | CCAAACCGAACCA | S1P appears to function as a Golgi-localized subtilase and to help protect seedlings against salt and osmotic stress. The roots of s1p-3 mutants are hypersensitive to NaCl, KCl, LiCl, and mannitol. Several salt-stress responsive genes show weaker induction in an s1P-3 mutant background. The proteolytic cleavage of the bZIP17 transcription factor depends on S1P in vitro. And there is evidence that S1P can cleave bZIP17 in vitro. |
| AT5G19670 | AT5G19670.1 | TGGTTCGGTTTGG | exostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 802 Blast hits to 800 proteins in 88 species: Archae - 0; Bacteria - 10; Metazoa - 236; Fungi - 4; Plants - 470; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). |
| AT5G20910 | AT5G20910.1 | TTGAACCGAACCAAACCGAAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G19950.1); Has 6524 Blast hits to 6509 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2244; Fungi - 556; Plants - 2592; Viruses - 49; Other Eukaryotes - 1083 (source: NCBI BLink). |
| AT5G21070 | AT5G21070.1 | TGGTTCGGTTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 17 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G22040 | AT5G22040.1 | TGGTTCGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22040.2 | TGGTTCGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G23080 | AT5G23080.1 | GACCCGAACCAGGCCCAGA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. |
| AT5G23080.2 | GACCCGAACCAGGCCCAGA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. |
| AT5G23090 | AT5G23090.1 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23090.2 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23090.3 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23090.4 | TCTGGGCCTGGTTCGGGTC | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23390 | AT5G23390.1 | TGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF639 (InterPro:IPR006927); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48840.1); Has 83 Blast hits to 81 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24080 | AT5G24080.1 | ACCGAACCA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT2G19130.1); Has 83012 Blast hits to 81933 proteins in 3234 species: Archae - 50; Bacteria - 7141; Metazoa - 37012; Fungi - 6145; Plants - 18411; Viruses - 299; Other Eukaryotes - 13954 (source: NCBI BLink). |
| AT5G24360 | AT5G24360.1 | ACCGAACCA | INOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink). |
| AT5G25600 | AT5G25600.1 | TGGTTCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: nucleic acid binding / zinc ion binding (TAIR:AT5G36228.1); Has 119 Blast hits to 119 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G25757 | AT5G25757.1 | CCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25754.1); Has 298 Blast hits to 292 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 59; Plants - 28; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT5G26610 | AT5G26610.1 | TGGTTCGGTTTAG | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink). |
| AT5G26610.2 | TGGTTCGGTTTAG | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink). |
| AT5G26820 | AT5G26820.1 | CGAACCGAACCA | IRON-REGULATED PROTEIN 3 (ATIREG3); LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATIREG2 (IRON-REGULATED PROTEIN 2); nickel ion transmembrane transporter (TAIR:AT5G03570.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 84; Fungi - 42; Plants - 43; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G27470 | AT5G27470.1 | TGGTTCGGT | seryl-tRNA synthetase / serine--tRNA ligase; FUNCTIONS IN: serine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, seryl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: tRNA-binding arm (InterPro:IPR010978), Seryl-tRNA synthetase, class IIa, N-terminal (InterPro:IPR015866), Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Seryl-tRNA synthetase, class IIa (InterPro:IPR002317), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Seryl-tRNA synthetase, class IIa, C-terminal (InterPro:IPR018156); BEST Arabidopsis thaliana protein match is: SRS (SERYL-TRNA SYNTHETASE); serine-tRNA ligase (TAIR:AT1G11870.2); Has 7169 Blast hits to 7168 proteins in 1635 species: Archae - 140; Bacteria - 3036; Metazoa - 295; Fungi - 180; Plants - 68; Viruses - 0; Other Eukaryotes - 3450 (source: NCBI BLink). |
| AT5G27680 | AT5G27680.1 | CCGAACCA | DNA helicase |
| AT5G39600 | AT5G39600.1 | AAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G43150 | AT5G43150.1 | CCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G46410 | AT5G46410.1 | AACACGTGTTGGTTCGGT | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT4G18140.2); Has 1966 Blast hits to 1962 proteins in 182 species: Archae - 0; Bacteria - 10; Metazoa - 732; Fungi - 353; Plants - 202; Viruses - 7; Other Eukaryotes - 662 (source: NCBI BLink). |
| AT5G46410.2 | AACACGTGTTGGTTCGGT | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT4G18140.2); Has 1966 Blast hits to 1962 proteins in 182 species: Archae - 0; Bacteria - 10; Metazoa - 732; Fungi - 353; Plants - 202; Viruses - 7; Other Eukaryotes - 662 (source: NCBI BLink). |
| AT5G48385 | AT5G48385.1 | CCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 987 Blast hits to 921 proteins in 78 species: Archae - 0; Bacteria - 16; Metazoa - 58; Fungi - 7; Plants - 873; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT5G50080 | AT5G50080.1 | TGGTTCGG | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G51020 | AT5G51020.1 | TGGTTCGG | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT5G51350 | AT5G51350.1 | TGGTTCGGTTTGG | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G61480.1); Has 68844 Blast hits to 28909 proteins in 838 species: Archae - 29; Bacteria - 3219; Metazoa - 20839; Fungi - 694; Plants - 39080; Viruses - 14; Other Eukaryotes - 4969 (source: NCBI BLink). |
| AT5G51510 | AT5G51510.1 | TGGTTCGGTTTAGTTCGGTTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G52300 | AT5G52300.1 | TGGTTCGG | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. |
| AT5G52300.2 | TGGTTCGG | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. |
| AT5G52580 | AT5G52580.1 | TGGTTCGGTTCGGTTCGGTT | RAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT4G27100.2); Has 4077 Blast hits to 3776 proteins in 168 species: Archae - 0; Bacteria - 0; Metazoa - 2490; Fungi - 593; Plants - 357; Viruses - 0; Other Eukaryotes - 637 (source: NCBI BLink). |
| AT5G53050 | AT5G53050.1 | AAACCGAACCGAACCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G53050.2 | AAACCGAACCGAACCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G53050.3 | AAACCGAACCGAACCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G54310 | AT5G54310.1 | TTAAACCGAACCA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT5G55000 | AT5G55000.1 | CCGAACCA | FH protein interacting protein FIP2 |
| AT5G55000.2 | CCGAACCA | FH protein interacting protein FIP2 |
| AT5G58290 | AT5G58290.1 | TGGTTCGG | 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA, |
| AT5G62050 | AT5G62050.1 | TGGTTCGGT | essential factor for protein sorting and assembly into membranes |
| AT5G62060 | AT5G62060.1 | ACCGAACCA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G32420.1); Has 662 Blast hits to 644 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 662; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G62440 | AT5G62440.1 | ACCGAACCAGTTCGGTTCAA | Encodes a protein DOMINO1 that belongs to a plant-specific gene family sharing a common motif present in the tomato DEFECTIVE CHLOROPLASTS AND LEAVES (LeDCL) protein. DOMINO1 is located in the nucleus. Arabidopsis embryos carrying the domino1 mutation grow slowly in comparison with wild type embryos and reach only the globular stage at desiccation. The primary defect of the mutation at the cellular level is the large size of the nucleolus that can be observed soon after fertilization in the nuclei of both the embryo and the endosperm. DOMINO1 might have a role in ribosome biogenesis and in determining the rate of cell division. |
| AT5G64290 | AT5G64290.1 | TGGTTCGGTTCAA | DICARBOXYLATE TRANSPORT 2.1 (DIT2.1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: malate transport, response to nematode; LOCATED IN: chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DiT2.2 (dicarboxylate transporter 2.2); oxoglutarate:malate antiporter (TAIR:AT5G64280.1); Has 2721 Blast hits to 2720 proteins in 602 species: Archae - 47; Bacteria - 2055; Metazoa - 43; Fungi - 9; Plants - 101; Viruses - 2; Other Eukaryotes - 464 (source: NCBI BLink). |
| AT5G64830 | AT5G64830.1 | AACCGAACCGAACCA | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G64830.2 | AACCGAACCGAACCA | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G64930 | AT5G64930.1 | TGGTTCGGT | Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR). |
| AT5G64940 | AT5G64940.1 | ACCGAACCA | Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins. |
| AT5G64940.2 | ACCGAACCA | Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins. |
| ATCG00120 | ATCG00120.1 | TGGTTCGG | Encodes the ATPase alpha subunit, which is a subunit of ATP synthase and part of the CF1 portion which catalyzes the conversion of ADP to ATP using the proton motive force. This complex is located in the thylakoid membrane of the chloroplast. |
| ATCG00640 | ATCG00640.1 | TGGTTCGGTTCG | encodes a chloroplast ribosomal protein L33, a constituent of the large subunit of the ribosomal complex |
| ATCG00650 | ATCG00650.1 | TGGTTCGGTTCG | chloroplast-encoded ribosomal protein S18 |